Association of an extended haplotype in the tau gene with progressive supranuclear palsy
Association of an extended haplotype in the tau gene with progressive supranuclear palsy
Matt Baker, Irene Litvan1, Henry Houlden, Jennifer Adamson, Dennis Dickson, Jordi Perez-Tur, John Hardy, Timothy Lynch2, Eileen Bigio3 and Mike Hutton*
Mayo Clinic Jacksonville, 4500 San Pablo Road, Jacksonville, FL 32224, USA, 1National Institutes of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892-9130, USA, 2Department of Pathology, UT Southwestern Medical School, 5323 Harry Hines Boulevard, Dallas, TX 75235, USA and 3The Mater Misericordiae Hospital, Eccles Street, Dublin 7, Ireland
Received November 27, 1998;Revised and Accepted January 29, 1999
We describe two extended haplotypes that cover the human tau gene. In a total of ~200 unrelated caucasian individuals there is complete disequilibrium between polymorphisms which span the gene (which covers ~100 kb of DNA). This suggests that the establishment of the two haplotypes was an ancient event and either that recombination is suppressed in this region, or that recombinant genes are selected against. Furthermore, we show that the more common haplotype (H1) is significantly over-represented in patients with progressive supranuclear palsy (PSP), extending earlier reports of an association between an intronic dinucleotide polymorphism and PSP.
Progressive supranuclear palsy (PSP) is the second most frequent cause of degenerative parkinsonism after Parkinson’s disease (PD) (1). In addition to parkinsonism, the clinical symptoms include early postural instability and supranuclear gaze palsy (2). Neuropathologically, PSP is characterized by abundant neurofibrillary tangles (NFTs) and neuropil threads consisting of hyperphosphorylated Tau protein. The tangles observed in PSP differ in both distribution and composition from those associated with Alzheimer’s disease (AD). In PSP, the tangles are primarily localized to subcortical regions and are found in both neurons and glia, whereas in AD they are more widespread, largely cortical and are limited to neurons. At the ultrastructural level the filaments that make up the tangles in PSP are straight, in contrast to the paired helical filaments (PHFs) that are the most abundant species associated with the tangles in AD (3,4).
There are six major protein isoforms of Tau in the adult human brain (Fig. 1). These are generated by alternative splicing of exons 2, 3 and 10 (5). Exons 9-12 encode four microtubule binding domains that are imperfect repeats of 31 or 32 residues (6). Alternative splicing of exon 10 generates isoforms with either four (exon 10+; ‘4-repeat Tau’) or three (exon 10-; ‘3-repeat Tau’) microtubule binding domains (7). The NFTs consisting of straight filaments that are observed in PSP contain only 4-repeat Tau isoforms, whereas the NFTs consisting of PHFs found in AD contain all six major Tau isoforms (4-repeat and 3-repeat) (4).
Mutations in the tau gene have recently been found to be associated with frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17) (8-10). In this context, we have recently shown that mutations in the 5[prime] splice site of tau exon 10 increase the incorporation of this exon into tau mRNA (9) and thus increase the proportion of 4-repeat Tau isoforms (10). In affected families this increase is associated with the formation of 4-repeat Tau NFTs and leads to frontotemporal dementia. This observation shows that the control of this alternative splice event is critical and that disregulation can result in tangle formation and neurodegeneration (9-11).
The genetics of PSP had not been studied in great detail until recently, as the disease was usually considered to be sporadic in nature. However, Conrad et al. (12) demonstrated an association between a polymorphic dinucleotide marker, found between exon 9 and exon 10 of the tau gene, and PSP. This initial result has subsequently been confirmed by at least four other studies (13-16). In each case, an over-representation of the most common allele (a0) and genotype (a0a0) in the PSP group was reported. However, due to the nature of the dinucleotide polymorphism it was considered unlikely that this variation was biologically significant in the disease process, but was in fact in disequilibrium with other polymorphisms (12). The identification of mutations in the tau gene that influence alternative splicing of exon 10 and lead to the development of FTDP-17 (9,10) has led to speculation that the location of the dinucleotide polymorphism (between exons 9 and 10) might be significant and an indication that if the polymorphism itself was not functionally relevant, the critical variation would be nearby.
During the sequencing of the tau gene in FTDP-17 cases, we and others identified a series of polymorphisms scattered through the gene (8,9). Here we investigate the extent of disequilibrium between these polymorphisms and their association with PSP as a step towards defining the precise mechanism of genetic susceptibility for PSP at the tau locus.
Figure1. The six major isoforms of Tau. Regions encoded by alternatively spliced exons 2, 3 and 10 are indicated by light shaded boxes. Microtubule binding repeats encoded by exons 9-12 are indicated by vertical black bars.
Sequence analysis of the coding region and flanking intronic sequences in the tau gene, primarily in FTDP-17 families (8,9), identified a series of single nucleotide polymorphisms (SNPs) in exons 1, 2, 3, 9 (three polymorphisms), 11 and 13 (Table 1) which were present in both controls and patients. Analysis of the occurrence of these polymorphisms (Table 2) revealed that they are in complete disequilibrium with each other (P < 1 × 10-100). Thus, there are two extended haplotypes (designated H1 and H2) that cover the entire tau gene (~100kb; Fig. 2). We did not identify a single recombinant event within these haplotypes in any of the unrelated patient and control individuals tested (>200 total). The absence of recombinant events within the tau gene in this large group of unrelated individuals implies strongly that these haplotypes were established early in the history of the Caucasian population tested. One rare SNP (SNP 9iii in Tables 1 and 2) in exon 9 is present only on the more common H1 haplotype, suggesting that it arose by an independent mutagenic event after the establishment of this haplotype. In addition, the dinucleotide polymorphism (a0), which had been shown previously to be associated with PSP, is also inherited with the two extended haplotypes: dinucleotide polymorphism alleles a0 (11 repeats), a1 (12 repeats) and a2 (13 repeats) are inherited with the H1 haplotype, whereas the a3 (14 repeats) and a4 (15 repeats) alleles are inherited with the H2 haplotype. Given that a0 and a3 are the most common alleles (70.5 and 23%, respectively, in our control individuals; Table 3), it seems highly likely that a0 and a3 were present when the extended haplotypes were established, and that a1, a2 and a4 arose from subsequent slippage events (Fig. 2). This observation provides further testament to the conservation and antiquity of the two haplotypes.
We tested each of the polymorphisms (SNP and dinucleotide) and, thus, the extended haplotypes for association with PSP. A total of 65 cases of PSP were employed in this analysis (mean age 65.3 years); 18 were autopsy-confirmed cases while the remainder conformed to National Institute of Neurological Disorders and Stroke (NINDS) criteria for probable PSP. Aged caucasian controls (n = 135, mean age 63 years) were used for comparison.
aMismatch primer sequence, designed to create an artificial restriction site. SNP numbering denotes the exon in which each is observed. SNPs were originally identified through sequence analysis of the tau gene primarily in FTDP-17 families (8,9).
Figure2. Human tau haplotypes. Schematic representation of the development of various human tau gene haplotypes. Ancestral haplotypes H1 and H2 are modified by subsequent mutational events (slippage of the dinucleotide polymorphism and the appearance of the exon 9iii polymorphism) but are not altered by recombination. SNPs that were typed in this study are shown at points along the tau gene with the nucleotide present in each haplotype indicated. The 238 bp deletion between exons 9 and 10 is shown by a break in the gene in the H2 haplotype. The presence or absence of this region is denoted by (+) or (-), respectively.
Genotype frequencies of the common tau SNPs in PSP and control series
SNP
Genotype frequency % (number of individuals with each genotype)
[chi]2
P-value
H1 H1
H1 H2
H2 H2
PSP
Control
PSP
Control
PSP
Control
exon 1
88.9 (56)
62.8 (91)
11.1 (7)
30.3 (44)
0
6.9 (10)
15.214
0.0005
exon 2
87.3 (55)
62.8 (91)
12.7 (8)
31.0 (45)
0
6.2 (10)
13.944
0.0009
exon 3
88.0 (44)
62.2 (89)
12.0 (6)
30.8 (44)
0
7.0 (10)
12.102
0.0024
exon 9i
88.5 (54)
63.8 (74)
11.5 (7)
30.2 (35)
0
6.0 (7)
12.952
0.0015
exon 9ii
88.3 (53)
63.0 (92)
11.7 (7)
30.8 (45)
0
6.2 (9)
13.753
0.0010
exon 9iiia
95.0 (57)
91.0 (131)
5.0 (3)
9.0 (13)
0
0
0.951
0.6217
exon 11
88.4 (38)
64.4 (87)
11.6 (5)
28.9 (39)
0
6.7 (9)
9.456
0.0088
exon 13
88.7 (47)
63.3 (83)
11.3 (5)
29.8 (39)
0
6.9 (9)
12.317
0.0021
a9iii is a rare polymorphism that occurs only on the H1 haplotype. The number of individuals typed with each genotype for individual polymorphisms is given in parentheses. Chi-squared analysis testing association between individual tau polymorphism genotypes and PSP is presented. H1 allele frequencies (not shown) also displayed a significant association with PSP.
Extended haplotype and genotype frequencies in PSP and the aged control series
PSP (n = 64)
Controls (n = 145)
Haplotype
H1
93.7% (120)
78.4% (228)
H2
6.3% (8)
21.6% (62)
[chi]2 = 14.58, P = 0.00013 (1 df)
Genotype
H1 H1
87.5% (56)
62.8% (91)
H1 H2
12.5% (8)
31.0% (45)
H2 H2
0
6.2% (9)
[chi]2 = 13.85, P = 0.00098 (2 df)
For analysis of the extended haplotypes, all cases in which two or more of the SNPs had been scored were used, thus for this series more samples (for PSP n = 64) were available. Chi-squared analysis of association between tau extended haplotypes and genotypes and PSP is presented.
Initial analysis focused on the dinucleotide TG repeat polymorphism that had previously been shown to be associated with PSP. A significant over-representation of the most common allele (a0) and genotype (a0a0) was observed in the PSP cases compared with controls (Table 3). A proportion of the cases (n = 24) in this study had previously been used to demonstrate the association of this polymorphism with PSP (14); therefore, this observation was anticipated.
In addition, each of the polymorphisms displayed evidence of association with PSP in that the most common allele (H1) and genotype (H1H1) were significantly over-represented in this group compared with controls (Table 2). Since each of these SNPs are in complete disequilibrium with each other in this population, we also analyzed the data for association between each extended haplotype and PSP (Table 4). Again, a significant association with PSP was observed with the most common haplotype [H1, [chi]2 = 14.58, P = 0.00013, 1 degree of freedom (df)] and genotype [H1H1, [chi]2 = 13.85, P = 0.00098, 2 df). The odds ratio, for developing PSP, with the inheritance of the H1H1 genotype was calculated to be 4.08 [8.79 > CI (95%) > 1.89].
Exons 9-13 were sequenced in 60 of the PSP cases employed in the association study, 13 of which were autopsy confirmed. These exons were analyzed as all of the mutations identified in tau associated with FTDP-17 have been found in this region of the gene. No missense or exon 10 5[prime] splice site mutations were identified in any of 60 PSP cases sequenced, indicating that typical PSP is not caused by similar mutations to those observed in FTDP-17 families. In 27 of these PSP cases (six confirmed by autopsy), the entire coding region of the tau gene was analyzed; again, no mutations were identified.
In addition to sequencing the coding exons, we also examined ~1 kb of intronic sequence 5[prime] and 3[prime] of tau exon 10. The reason for this analysis is that we consider the region around exon 10 to be the most likely candidate for biologically relevant genetic variation. This is because the tangles in PSP consist of 4-repeat Tau isoforms and when similar inclusions are observed in FTDP-17 families they are associated with missense or splice site mutations in exon 10 (4,9,11,17,18).
Sequence analysis of the introns flanking tau exon 10 revealed the presence of a deletion, positioned between -951 and -713 nucleotides upstream of exon 10. This 238 bp deletion is inherited as part of the less common H2 extended haplotype and thus shows a negative association with PSP.
We identified a series of eight common SNPs in the tau gene and found that these were inherited in complete disequilibrium with each other and with the dinucleotide polymorphism. Together, these polymorphisms define two extended haplotypes that contain at least the entire tau gene (exons 1-13; ~100 kb) and have remained uninterrupted by recombination in all the unrelated individuals examined in this study. These data clearly suggest that these two haplotypes were established early in the history of the Caucasian population. Indeed, additional polymorphisms have clearly arisen by independent mutational events rather than recombination since the establishment of the two haplotypes (point mutations and slippage of the dinucleotide polymorphism). The fact that there is little or no recombination over the entire length of the tau gene suggests that there must either be suppression of recombination in this chromosomal region, or selection against recombinant alleles.
Our association studies have demonstrated that there is a significant over-representation of the more common (H1) haplotype and genotype in PSP cases compared with controls. Thus, the earlier reports (12-16) of an association with the most common allele of the dinucleotide polymorphism (a0), between exon 9 and 10, are a reflection of this association with the broader haplotype. Indeed, using the results from the association study alone, it is not possible to determine any information about the position of the biologically relevant polymorphism that directly influences the risk of developing PSP, since the extended haplotype contains all of the tau gene analyzed.
From a biological perspective, there are three possibilities that might explain the association between tau and PSP: (i) there may be crucial differences between the two haplotypes in terms of the expression of the Tau protein; (ii) there may be differences in the splicing of the two cognate proteins; or (iii) a pathogenic, but non-coding, mutation has occurred on the H1 background. The fact that the brains of patients with PSP contain NFTs that consist of Tau isoforms with four microtubule binding repeats (4) suggests that there may be disruption of exon 10 alternative splicing in brain regions affected by PSP. Therefore, it would seem that the best candidate for a role in the pathogenesis in PSP is genetic variability that affects the alternative splicing of tau exon 10. In order to search for such variability we sequenced 1 kb into each intron flanking exon 10 and located a 238 bp deletion. It is possible that the presence or absence of the deleted region influences the alternative splicing of exon 10 in a neuron-specific manner, thus affecting the risk of developing PSP. Clearly, further studies, such as splicing analysis, will be needed to determine the role of tau exon 10 alternative splicing in the development of PSP and, thus, the significance, if any, of this deletion.
The association of polymorphisms in tau with PSP demonstrates that Tau dysfunction is probably crucial to the development of this disease. However, it remains to be determined if Tau dysfunction is the primary lesion in the pathogenesis of PSP or if some other initiating event is required first and that variability in the tau gene simply influences the sensitivity of specific neurons and glia to this initial insult.
All patients used in this study were Caucasian. Individuals were diagnosed with probable PSP utilizing guidelines set by the NINDS (2). These criteria have been reported to have an optimal specificity of 100% (2). Neuropathologic findings in 18 cases were also consistent with PSP (NINDS criteria).
Tau exons (1-5,7,9-13) were amplified from genomic DNA from individuals with primers designed to flanking intronic sequence (8,9,19). Exons 4A, 6 and 8 are essentially absent in Human tau brain mRNA and were therefore not analyzed (19). Twenty-five nanograms of DNA were used in a 50 µl reaction mixture containing 20 pmol of each primer, 0.2 mM dNTPs, 1 U Taq Gold polymerase (Perkin Elmer, Foster City, CA), 1.5 mM MgCl2, 75 mM Tris-HCl, pH 9.0, 20 mM (NH4)2SO4 and 0.01% Tween-20. Amplification of exon 9 required the addition of 5% DMSO. Amplifications were performed oil-free in Hybaid Touchdown thermal cyclers (Hybaid, Cambridge, UK). Conditions were 35 cycles of 94°C for 30 s, 60 to 50°C touchdown annealing for 30 s, and 72°C for 45 s with a final extension of 72°C for 10 min. All products were purified using the Qiaquick PCR Purification kit (Qiagen, Chatsworth, CA). For each exon, 100 ng of product was sequenced in both directions using the Big Dye kit (Perkin Elmer) and relevant PCR primers. Sequencing was performed on an ABI377 automated sequencer and processed using Factura and Sequence Navigator software (Perkin Elmer).
Previously reported polymorphisms (8,9) were analyzed by PCR amplification followed by digestion of the product with the diagnostic restriction enzyme (PCR-RFLP). For polymorphisms 9i and 11, where the polymorphic site did not alter an enzyme recognition site, a mismatch primer was designed to create an artificial site that could be used for genotyping (Table 1). In the PSP series, the genotypes in exons 9 and 11 were determined from the sequence analysis. The presence of the intronic 238 bp deletion was determined by visualizing PCR product on an agarose gel. PCR conditions were as previously described, using primer sequences GGAAGACGTTCTCACTGATCTG (sense) and AGGAGTCTGGCTTCAGTCTCTC (antisense). All samples were genotyped for the intronic dinucleotide repeat polymorphism by PCR using a tet-labeled forward primer, followed by analysis on the ABI377 using Genotyper software (Perkin Elmer). Frequency of polymorphisms are shown in Tables 2 and 3. Linkage disequilibrium between loci was determined by the ‘Estimated Haplotype Frequencies’ program (20).
The authors acknowledge the provision of samples by the Harvard Brain Bank. Dr Eileen McGowan is thanked for helpful discussions of the data. This work was supported by an NINDS RO1 grant (NS37143-01) to M.H., the Mayo Foundation (M.H., J.H. and D.D.), the PSP Society (D.D.), an H.T. Roxel memorial grant to D.D. and by the Smith Scholar Program.
1. Bower, J.H., Maraganore, D.M., McDonnell, S.K. and Rocca, W.A. (1997) Incidence of progressive supranuclear palsy and multiple system atrophy in Olmsted County, Minnesota, 1976 to 1990. Neurology, 49, 1284-1288.
2. Litvan, I., Agid, Y., Calne, D., Campbell, G., Dubois, B., Duvoisin, R.C., Goetz, C.G., Golbe, L.I., Grafman, J., Growdon, J.H., Hallett, M., Jankovic, J., Quinn, N.P., Tolosa, E. and Zee, D.S. (1996) Clinical research criteria for the diagnosis of progressive supranuclear palsy (Steele-Richardson-Olszewski syndrome): report of the NINDS-SPSP international workshop. Neurology, 47, 1-9.
3. Spillantini, M.G. and Goedert, M. (1998) Tau protein pathology in neurodegenerative diseases. Trends Neurosci., 21, 428-433.
4. Spillantini, M.G., Bird, T.D. and Ghetti, B. (1998) Frontotemporal dementia and Parkinsonism linked to chromosome 17: a new group of tauopathies. BrainPathol., 8, 387-402.
5. Goedert, M., Spillantini, M.G., Jakes, R., Rutherford, D. and Crowther, R.A. (1989) Multiple isoforms of human microtubule-associated protein tau: sequence and localization in neurofibrillary tangles of Alzheimer's disease. Neuron, 3, 519-526. MEDLINE Abstract
6. Lee, G., Neve, R.L. and Kosik, K.S. (1989) The microtubule binding domain of tau protein. Neuron, 2, 1615-1624. MEDLINE Abstract
7. Goedert, M., Spillantini, M.G., Potier, M.C., Ulrich, J. and Crowther, R.A. (1989) Cloning and sequencing of the cDNA encoding an isoform of microtubule-associated protein Tau containing four tandem repeats: differential expression of tau protein mRNAs in human brain. EMBO J., 8, 393-399. MEDLINE Abstract
8. Poorkaj, P., Bird, T.D., Wijsman, E., Nemens, E., Garruto, R.M., Anderson, L., Andreadis, A., Wiederholt, W.C., Raskind, M. and Schellenberg, G.D. (1998) tau is a candidate gene for chromosome 17 frontotemporal dementia. Ann. Neurol., 43, 815-825. MEDLINE Abstract
9. Hutton, M., Lendon, C.L., Rizzu, P., Baker, M., Froelich, S., Houlden, H., Pickering-Brown, S., Chakraverty, S., Isaacs, A., Grover, A. et al). (1998) Association of missense and 5[prime]-splice-site mutations in tau with the inherited dementia FTDP-17. Nature, 393, 702-705.
10. Spillantini, M.G., Murrell, J.R., Goedert, M., Farlow, M.R., Klug, A. and Ghetti, B. (1998) Mutation in the tau gene in familial multiple system tauopathy with presenile dementia. Proc. Natl Acad. Sci. USA, 95, 7737-7741. MEDLINE Abstract
11. Hardy, J., Duff, K., Gwinn-Hardy, K., Perez-Tur, J. and Hutton, M. (1998) Genetic dissection of Alzheimer's disease and related dementias: amyloid and its relationship to tau. Nature Neurosci., 1, 355-359.
12. Conrad, C., Andreadis, A., Trojanowski, J.Q., Dickson, D.W., Kang, D., Chen, X., Wiederholt, W., Hansen, L., Masliah, E., Thal, L.J., Katzman, R., Xia, Y. and Saitoh, T. (1997) Genetic evidence for the involvement of tau in progressive supranuclear palsy. Ann. Neurol., 41, 277-281.
13. Oliva, R., Tolosa, E., Ezquerra, M., Molinuevo, J.L., Valldeoriola, F., Burguera, J., Calopa, M., Villa, M. and Ballesta, F. (1998) Significant changes in the tau A0 and A3 alleles in progressive supranuclear palsy and improved genotyping by silver detection. Arch. Neurol., 55, 1122-1124.
14. Higgins, J.J., Litvan, I., Pho, L.T., Li, W. and Nee, L.E. (1998) Progressive supranuclear gaze palsy is in linkage disequilibrium with the tau and not the alpha-synuclein gene. Neurology, 50, 270-273.
15. Bennett, P., Bonifati, V., Bonuccelli, U., Colosimo, C., De Mari, M., Fabbrini, G., Marconi, R., Meco, G., Nicholl, D.J., Stocchi, F., Vanacore, N., Vieregge, P. and Williams, A.C. (1998) Direct genetic evidence for involvement of tau in progressive supranuclear palsy. European Study Group on Atypical Parkinsonism Consortium.Neurology, 51, 982-985. MEDLINE Abstract
16. Morris, H.R., Janssen, J.C., Bandmann, O., Daniel, S.E., Rossor, M.N., Lees, A.J. and Wood, N.W. (1999) The tau gene A0 polymorphism in Progressive Supranuclear Palsy and related neurodegenerative diseases. J. Neurol. Neuropathol. Psychiatr. (in press).
17. Clark, L.N., Poorkaj, P., Wszolek, Z., Geschwind, D.H., Nasreddine, Z.S., Miller, B., Li, D., Payami, H., Awert, F., Markopoulou, K., Andreadis, A., D'Souza, I., Lee, V.M.Y., Reed, L., Trojanowski, J.Q., Zhukareva, V., Bird, T., Schellenberg, G. and Wilhelmsen, K.C. (1998) Pathogenic implications of mutations in the tau gene in pallido-ponto-nigral degeneration and related neurodegenerative disorders linked to chromosome 17. Proc. Natl Acad. Sci. USA,95, 13103-13107.
18. Spillantini, M.G., Crowther, R.A., Kamphorst, W., Heutink, P. and van Swieten, J.C. (1998) Tau pathology in two Dutch families with mutations in the microtubule-binding region of tau. Am. J. Pathol., 153, 1359-1363.
19. Andreadis, A., Brown, W.M. and Kosik, K.S. (1992) Structure and novel exons of the human tau gene. Biochemistry, 31, 10626-10633. MEDLINE Abstract
20. Xie, X. and Ott, J. (1993) Testing linkage disequilibrium between a disease gene and marker loci. Am. J. Hum. Genet., 53, 1107. MEDLINE Abstract
S. J. Adams, R. J.P. Crook, M. DeTure, S. J. Randle, A. E. Innes, X. Z. Yu, W.-L. Lin, B. N. Dugger, M. McBride, M. Hutton, et al. Overexpression of Wild-Type Murine Tau Results in Progressive Tauopathy and Neurodegeneration
Am. J. Pathol.,
October 1, 2009;
175(4):
1598 - 1609.
[Abstract][Full Text][PDF]
B Grisart, L Willatt, A Destree, J-P Fryns, K Rack, T de Ravel, J Rosenfeld, J R Vermeesch, C Verellen-Dumoulin, and R Sandford 17q21.31 microduplication patients are characterised by behavioural problems and poor social interaction
J. Med. Genet.,
August 1, 2009;
46(8):
524 - 530.
[Abstract][Full Text][PDF]
F. Antonacci, J. M. Kidd, T. Marques-Bonet, M. Ventura, P. Siswara, Z. Jiang, and E. E. Eichler Characterization of six human disease-associated inversion polymorphisms
Hum. Mol. Genet.,
July 15, 2009;
18(14):
2555 - 2566.
[Abstract][Full Text][PDF]
A. Webb, B. Miller, S. Bonasera, A. Boxer, A. Karydas, and K. C. Wilhelmsen Role of the Tau Gene Region Chromosome Inversion in Progressive Supranuclear Palsy, Corticobasal Degeneration, and Related Disorders
Arch Neurol,
November 1, 2008;
65(11):
1473 - 1478.
[Abstract][Full Text][PDF]
D A Koolen, A J Sharp, J A Hurst, H V Firth, S J L Knight, A Goldenberg, P Saugier-Veber, R Pfundt, L E L M Vissers, A Destree, et al. Clinical and molecular delineation of the 17q21.31 microdeletion syndrome
J. Med. Genet.,
November 1, 2008;
45(11):
710 - 720.
[Abstract][Full Text][PDF]
J. E. Tobin, J. C. Latourelle, M. F. Lew, C. Klein, O. Suchowersky, H. A. Shill, L. I. Golbe, M. H. Mark, J. H. Growdon, G. F. Wooten, et al. Haplotypes and gene expression implicate the MAPT region for Parkinson disease: The GenePD Study
Neurology,
July 1, 2008;
71(1):
28 - 34.
[Abstract][Full Text][PDF]
S. M. Pickering-Brown, S. Rollinson, D. Du Plessis, K. E. Morrison, A. Varma, A. M. T. Richardson, D. Neary, J. S. Snowden, and D. M. A. Mann Frequency and clinical characteristics of progranulin mutation carriers in the Manchester frontotemporal lobar degeneration cohort: comparison with patients with MAPT and no known mutations
Brain,
March 1, 2008;
131(3):
721 - 731.
[Abstract][Full Text][PDF]
Z. Ahmed, K. A. Josephs, J. Gonzalez, A. DelleDonne, and D. W. Dickson Clinical and neuropathologic features of progressive supranuclear palsy with severe pallido-nigro-luysial degeneration and axonal dystrophy
Brain,
February 1, 2008;
131(2):
460 - 472.
[Abstract][Full Text][PDF]
S. Spina, M. R. Farlow, F. W. Unverzagt, D. A. Kareken, J. R. Murrell, G. Fraser, F. Epperson, R. A. Crowther, M. G. Spillantini, M. Goedert, et al. The tauopathy associated with mutation +3 in intron 10 of Tau: characterization of the MSTD family
Brain,
January 1, 2008;
131(1):
72 - 89.
[Abstract][Full Text][PDF]
G. R Seabrook, W. J. Ray, M. Shearman, and M. Hutton BEYOND AMYLOID: The Next Generation of Alzheimer's Disease Therapeutics
Mol. Interv.,
October 1, 2007;
7(5):
261 - 270.
[Abstract][Full Text][PDF]
S. M. Laws, R. Perneczky, A. Drzezga, J. Diehl-Schmid, B. Ibach, J. Bauml, T. Eisele, H. Forstl, A. Kurz, and M. Riemenschneider Association of the Tau Haplotype H2 With Age at Onset and Functional Alterations of Glucose Utilization in Frontotemporal Dementia
Am J Psychiatry,
October 1, 2007;
164(10):
1577 - 1584.
[Abstract][Full Text][PDF]
H. N. Dawson, V. Cantillana, L. Chen, and M. P. Vitek The Tau N279K Exon 10 Splicing Mutation Recapitulates Frontotemporal Dementia and Parkinsonism Linked to Chromosome 17 Tauopathy in a Mouse Model
J. Neurosci.,
August 22, 2007;
27(34):
9155 - 9168.
[Abstract][Full Text][PDF]
L. D. Kaat, A.J.W. Boon, W. Kamphorst, R. Ravid, H. J. Duivenvoorden, and J. C. van Swieten Frontal presentation in progressive supranuclear palsy
Neurology,
August 21, 2007;
69(8):
723 - 729.
[Abstract][Full Text][PDF]
D. R. Williams, J. L. Holton, C. Strand, A. Pittman, R. de Silva, A. J. Lees, and T. Revesz Pathological tau burden and distribution distinguishes progressive supranuclear palsy-parkinsonism from Richardson's syndrome
Brain,
June 1, 2007;
130(6):
1566 - 1576.
[Abstract][Full Text][PDF]
L. I. Golbe, B. F. Boeve, B. M. Keegan, and J. E. Parisi An 81-year-old man with imbalance and memory impairment
Neurology,
April 3, 2007;
68(14):
1147 - 1152.
[Full Text][PDF]
P. D. Sundar, C.-E. Yu, W. Sieh, E. Steinbart, R. M. Garruto, K. Oyanagi, U.-K. Craig, T. D. Bird, E. M. Wijsman, D. R. Galasko, et al. Two sites in the MAPT region confer genetic risk for Guam ALS/PDC and dementia
Hum. Mol. Genet.,
February 1, 2007;
16(3):
295 - 306.
[Abstract][Full Text][PDF]
T. M. Caffrey, C. Joachim, S. Paracchini, M. M. Esiri, and R. Wade-Martins Haplotype-specific expression of exon 10 at the human MAPT locus
Hum. Mol. Genet.,
December 15, 2006;
15(24):
3529 - 3537.
[Abstract][Full Text][PDF]
M. Goedert and M. G. Spillantini A Century of Alzheimer's Disease
Science,
November 3, 2006;
314(5800):
777 - 781.
[Abstract][Full Text][PDF]
K. Talbot and O. Ansorge Recent advances in the genetics of amyotrophic lateral sclerosis and frontotemporal dementia: common pathways in neurodegenerative disease
Hum. Mol. Genet.,
October 15, 2006;
15(suppl_2):
R182 - R187.
[Abstract][Full Text][PDF]
A. M. Pittman, H.-C. Fung, and R. de Silva Untangling the tau gene association with neurodegenerative disorders
Hum. Mol. Genet.,
October 15, 2006;
15(suppl_2):
R188 - R195.
[Abstract][Full Text][PDF]
J. van der Zee, R. Rademakers, S. Engelborghs, I. Gijselinck, V. Bogaerts, R. Vandenberghe, P. Santens, J. Caekebeke, T. De Pooter, K. Peeters, et al. A Belgian ancestral haplotype harbours a highly prevalent mutation for 17q21-linked tau-negative FTLD
Brain,
April 1, 2006;
129(4):
841 - 852.
[Abstract][Full Text][PDF]
T. H. Bak, D. Yancopoulou, P. J. Nestor, J. H. Xuereb, M. G. Spillantini, F. Pulvermuller, and J. R. Hodges Clinical, imaging and pathological correlates of a hereditary deficit in verb and action processing
Brain,
February 1, 2006;
129(2):
321 - 332.
[Abstract][Full Text][PDF]
R. Rademakers, S. Melquist, M. Cruts, J. Theuns, J. Del-Favero, P. Poorkaj, M. Baker, K. Sleegers, R. Crook, T. De Pooter, et al. High-density SNP haplotyping suggests altered regulation of tau gene expression in progressive supranuclear palsy
Hum. Mol. Genet.,
November 1, 2005;
14(21):
3281 - 3292.
[Abstract][Full Text][PDF]
A M Pittman, A J Myers, P Abou-Sleiman, H C Fung, M Kaleem, L Marlowe, J Duckworth, D Leung, D Williams, L Kilford, et al. Linkage disequilibrium fine mapping and haplotype association analysis of the tau gene in progressive supranuclear palsy and corticobasal degeneration
J. Med. Genet.,
November 1, 2005;
42(11):
837 - 846.
[Abstract][Full Text][PDF]
P. J. Tuite, H. B. Clark, C. Bergeron, M. Bower, P. St George-Hyslop, V. Mateva, J. Anderson, and D. S. Knopman Clinical and Pathologic Evidence of Corticobasal Degeneration and Progressive Supranuclear Palsy in Familial Tauopathy
Arch Neurol,
September 1, 2005;
62(9):
1453 - 1457.
[Abstract][Full Text][PDF]
A.J. Myers, M. Kaleem, L. Marlowe, A.M. Pittman, A.J. Lees, H.C. Fung, J. Duckworth, D. Leung, A. Gibson, C.M. Morris, et al. The H1c haplotype at the MAPT locus is associated with Alzheimer's disease
Hum. Mol. Genet.,
August 15, 2005;
14(16):
2399 - 2404.
[Abstract][Full Text][PDF]
M. Cruts, R. Rademakers, I. Gijselinck, J. van der Zee, B. Dermaut, T. de Pooter, P. de Rijk, J. Del-Favero, and C. van Broeckhoven Genomic architecture of human 17q21 linked to frontotemporal dementia uncovers a highly homologous family of low-copy repeats in the tau region
Hum. Mol. Genet.,
July 1, 2005;
14(13):
1753 - 1762.
[Abstract][Full Text][PDF]
D. R. Williams, R. de Silva, D. C. Paviour, A. Pittman, H. C. Watt, L. Kilford, J. L. Holton, T. Revesz, and A. J. Lees Characteristics of two distinct clinical phenotypes in pathologically proven progressive supranuclear palsy: Richardson's syndrome and PSP-parkinsonism
Brain,
June 1, 2005;
128(6):
1247 - 1258.
[Abstract][Full Text][PDF]
W. J. Broom, M. J. Parton, C. A. Vance, C. Russ, P. M. Andersen, V. Hansen, P. N. Leigh, J. F. Powell, A. Al-Chalabi, and C. E. Shaw No association of the SOD1 locus and disease susceptibility or phenotype in sporadic ALS
Neurology,
December 28, 2004;
63(12):
2419 - 2422.
[Abstract][Full Text][PDF]
D. C. Paviour, A. J. Lees, K. A. Josephs, T. Ozawa, M. Ganguly, C. Strand, A. Godbolt, R. S. Howard, T. Revesz, and J. L. Holton Frontotemporal lobar degeneration with ubiquitin-only-immunoreactive neuronal changes: broadening the clinical picture to include progressive supranuclear palsy
Brain,
November 1, 2004;
127(11):
2441 - 2451.
[Abstract][Full Text][PDF]
D. F. Tang-Wai, N. R. Graff-Radford, B. F. Boeve, D. W. Dickson, J. E. Parisi, R. Crook, R. J. Caselli, D. S. Knopman, and R. C. Petersen Clinical, genetic, and neuropathologic characteristics of posterior cortical atrophy
Neurology,
October 12, 2004;
63(7):
1168 - 1174.
[Abstract][Full Text][PDF]
D G Healy, P M Abou-Sleiman, A J Lees, J P Casas, N Quinn, K Bhatia, A D Hingorani, and N W Wood Tau gene and Parkinson's disease: a case-control study and meta-analysis
J. Neurol. Neurosurg. Psychiatry,
July 1, 2004;
75(7):
962 - 965.
[Abstract][Full Text][PDF]
A. M. Pittman, A. J. Myers, J. Duckworth, L. Bryden, M. Hanson, P. Abou-Sleiman, N. W. Wood, J. Hardy, A. Lees, and R. de Silva The structure of the tau haplotype in controls and in progressive supranuclear palsy
Hum. Mol. Genet.,
June 15, 2004;
13(12):
1267 - 1274.
[Abstract][Full Text][PDF]
J. AVILA, J. J. LUCAS, M. PEREZ, and F. HERNANDEZ Role of Tau Protein in Both Physiological and Pathological Conditions
Physiol Rev,
April 1, 2004;
84(2):
361 - 384.
[Abstract][Full Text][PDF]
C Levecque, A Elbaz, J Clavel, J S Vidal, P Amouyel, A Alperovitch, C Tzourio, and M C Chartier-Harlin Association of polymorphisms in the Tau and Saitohin genes with Parkinson's disease
J. Neurol. Neurosurg. Psychiatry,
March 1, 2004;
75(3):
478 - 480.
[Abstract][Full Text][PDF]
M Ezquerra, J Campdelacreu, E Munoz, R Oliva, and E Tolosa Sequence analysis of tau 3'untranslated region and saitohin gene in sporadic progressive supranuclear palsy
J. Neurol. Neurosurg. Psychiatry,
January 1, 2004;
75(1):
155 - 157.
[Abstract][Full Text][PDF]
C.-B. Lucking, V. Chesneau, E. Lohmann, P. Verpillat, C. Dulac, A.-M. Bonnet, F. Gasparini, Y. Agid, A. Durr, and A. Brice Coding Polymorphisms in the Parkin Gene and Susceptibility to Parkinson Disease
Arch Neurol,
September 1, 2003;
60(9):
1253 - 1256.
[Abstract][Full Text][PDF]
R. de Silva, A. Hope, A. Pittman, M.E. Weale, H.R. Morris, N.W. Wood, and A.J. Lees Strong association of the Saitohin gene Q7 variant with progressive supranuclear palsy
Neurology,
August 12, 2003;
61(3):
407 - 409.
[Abstract][Full Text][PDF]
M.-J. Sobrido, B. L. Miller, N. Havlioglu, V. Zhukareva, Z. Jiang, Z. S. Nasreddine, V. M.-Y. Lee, T. W. Chow, K. C. Wilhelmsen, J. L. Cummings, et al. Novel Tau Polymorphisms, Tau Haplotypes, and Splicing in Familial and Sporadic Frontotemporal Dementia
Arch Neurol,
May 1, 2003;
60(5):
698 - 702.
[Abstract][Full Text][PDF]
K. A. Josephs, T. Ishizawa, Y. Tsuboi, N. Cookson, and D. W. Dickson A Clinicopathological Study of Vascular Progressive Supranuclear Palsy: A Multi-infarct Disorder Presenting as Progressive Supranuclear Palsy
Arch Neurol,
October 1, 2002;
59(10):
1597 - 1601.
[Abstract][Full Text][PDF]
H. R. Morris, M. Baker, K. Yasojima, H. Houlden, M. N. Khan, N. W. Wood, J. Hardy, M. Grossman, J. Trojanowski, T. Revesz, et al. Analysis of tau haplotypes in Pick's disease
Neurology,
August 13, 2002;
59(3):
443 - 445.
[Abstract][Full Text][PDF]
P. Verpillat, A. Camuzat, D. Hannequin, C. Thomas-Anterion, M. Puel, S. Belliard, B. Dubois, M. Didic, B.-F. Michel, L. Lacomblez, et al. Association Between the Extended tau Haplotype and Frontotemporal Dementia
Arch Neurol,
June 1, 2002;
59(6):
935 - 939.
[Abstract][Full Text][PDF]
M. S. Forman, V. Zhukareva, C. Bergeron, S. S.-M. Chin, M. Grossman, C. Clark, V. M.-Y. Lee, and J. Q. Trojanowski Signature Tau Neuropathology in Gray and White Matter of Corticobasal Degeneration
Am. J. Pathol.,
June 1, 2002;
160(6):
2045 - 2053.
[Abstract][Full Text][PDF]
C. Conrad, C. Vianna, M. Freeman, and P. Davies A polymorphic gene nested within an intron of the tau gene: Implications for Alzheimer's disease
PNAS,
May 28, 2002;
99(11):
7751 - 7756.
[Abstract][Full Text][PDF]
C. P. Ponting, M. Hutton, A. Nyborg, M. Baker, K. Jansen, and T. E. Golde Identification of a novel family of presenilin homologues
Hum. Mol. Genet.,
May 1, 2002;
11(9):
1037 - 1044.
[Abstract][Full Text][PDF]
H. R. Morris, G. Gibb, R. Katzenschlager, N. W. Wood, D. P. Hanger, C. Strand, T. Lashley, S. E. Daniel, A. J. Lees, B. H. Anderton, et al. Pathological, clinical and genetic heterogeneity in progressive supranuclear palsy
Brain,
May 1, 2002;
125(5):
969 - 975.
[Abstract][Full Text][PDF]
D. Caparros-Lefebvre, N. Sergeant, A. Lees, A. Camuzat, S. Daniel, A. Lannuzel, A. Brice, E. Tolosa, A. Delacourte, and C. Duyckaerts Guadeloupean parkinsonism: a cluster of progressive supranuclear palsy-like tauopathy
Brain,
April 1, 2002;
125(4):
801 - 811.
[Abstract][Full Text][PDF]
R. A. Short, N. R. Graff-Radford, J. Adamson, M. Baker, and M. Hutton Differences in Tau and Apolipoprotein E Polymorphism Frequencies in Sporadic Frontotemporal Lobar Degeneration Syndromes
Arch Neurol,
April 1, 2002;
59(4):
611 - 615.
[Abstract][Full Text][PDF]
H R Morris, R Katzenschlager, J C Janssen, J M Brown, M Ozansoy, N Quinn, T Revesz, M N Rossor, S E Daniel, N W Wood, et al. Sequence analysis of tau in familial and sporadic progressive supranuclear palsy
J. Neurol. Neurosurg. Psychiatry,
March 1, 2002;
72(3):
388 - 390.
[Abstract][Full Text][PDF]
R. Borghi, L. Giliberto, A. Assini, A. Delacourte, G. Perry, M. A. Smith, P. Strocchi, D. Zaccheo, and M. Tabaton Increase of cdk5 is related to neurofibrillary pathology in progressive supranuclear palsy
Neurology,
February 26, 2002;
58(4):
589 - 592.
[Abstract][Full Text][PDF]
M. Farrer, J. Hardy, M. Hutton, D. Maraganore, Y. Tsuboi, Z. K. Wszolek, M. A. Pericak-Vance, W. K. Scott, E. R. Martin, J. M. Vance, et al. Identifying Genetic Factors in Parkinson Disease
JAMA,
February 13, 2002;
287(6):
715 - 716.
[Full Text][PDF]
S Lovestone and D M McLoughlin Protein aggregates and dementia: is there a common toxicity?
J. Neurol. Neurosurg. Psychiatry,
February 1, 2002;
72(2):
152 - 161.
[Abstract][Full Text][PDF]
K Tawana and D B Ramsden Progressive supranuclear palsy
Mol. Pathol.,
December 1, 2001;
54(6):
427 - 434.
[Abstract][Full Text][PDF]
W. K. Scott, M. A. Nance, R. L. Watts, J. P. Hubble, W. C. Koller, K. Lyons, R. Pahwa, M. B. Stern, A. Colcher, B. C. Hiner, et al. Complete Genomic Screen in Parkinson Disease: Evidence for Multiple Genes
JAMA,
November 14, 2001;
286(18):
2239 - 2244.
[Abstract][Full Text][PDF]
E. R. Martin, W. K. Scott, M. A. Nance, R. L. Watts, J. P. Hubble, W. C. Koller, K. Lyons, R. Pahwa, M. B. Stern, A. Colcher, et al. Association of Single-Nucleotide Polymorphisms of the Tau Gene With Late-Onset Parkinson Disease
JAMA,
November 14, 2001;
286(18):
2245 - 2250.
[Abstract][Full Text][PDF]
M. G. Spillantini and M. Goedert Tau and Parkinson Disease
JAMA,
November 14, 2001;
286(18):
2324 - 2326.
[Full Text][PDF]
M. Farrer, D. M. Maraganore, P. Lockhart, A. Singleton, T.G. Lesnick, M. de Andrade, A. West, R. de Silva, J. Hardy, and D. Hernandez {alpha}-synuclein gene haplotypes are associated with Parkinson's disease
Hum. Mol. Genet.,
August 1, 2001;
10(17):
1847 - 1851.
[Abstract][Full Text][PDF]
Z. K. Wszolek, Y. Tsuboi, R. J. Uitti, L. Reed, M. L. Hutton, D. W. Dickson, P. M. Stanford, G. M. Halliday, W. S. Brooks, J. B.J. Kwok, et al. Progressive supranuclear palsy as a disease phenotype caused by the S305S tau gene mutation
Brain,
August 1, 2001;
124(8):
1666 - 1670.
[Full Text][PDF]
I. Litvan, M. Baker, and M. Hutton Tau genotype: No effect on onset, symptom severity, or survival in progressive supranuclear palsy
Neurology,
July 10, 2001;
57(1):
138 - 140.
[Abstract][Full Text][PDF]
H. Houlden, M. Baker, H.R. Morris, N. MacDonald, S. Pickering-Brown, J. Adamson, A.J. Lees, M.N. Rossor, N.P. Quinn, A. Kertesz, et al. Corticobasal degeneration and progressive supranuclear palsy share a common tau haplotype
Neurology,
June 26, 2001;
56(12):
1702 - 1706.
[Abstract][Full Text][PDF]
M. Hutton Missense and splice site mutations in tau associated with FTDP-17: Multiple pathogenic mechanisms
Neurology,
June 12, 2001;
56(90004):
S21 - 25.
[Abstract][Full Text][PDF]
P. Poorkaj, M. Grossman, E. Steinbart, H. Payami, A. Sadovnick, D. Nochlin, T. Tabira, J. Q. Trojanowski, S. Borson, D. Galasko, et al. Frequency of Tau Gene Mutations in Familial and Sporadic Cases of Non-Alzheimer Dementia
Arch Neurol,
March 1, 2001;
58(3):
383 - 387.
[Abstract][Full Text][PDF]
K. B. Baker and E. B. Montgomery Jr. Performance on the PD test battery by relatives of patients with progressive supranuclear palsy
Neurology,
January 9, 2001;
56(1):
25 - 30.
[Abstract][Full Text][PDF]
H.R. Morris, J.R. Vaughan, S.R. Datta, R. Bandopadhyay, H.A. Rohan de Silva, A. Schrag, N.J. Cairns, D. Burn, U. Nath, P.L. Lantos, et al. Multiple system atrophy/progressive supranuclear palsy: {{alpha}}-Synuclein, synphilin, tau, and APOE
Neurology,
December 26, 2000;
55(12):
1918 - 1920.
[Abstract][Full Text][PDF]
J. J. Higgins, L. I. Golbe, A. D. Biase, J. Jankovic, S. A. Factor, and R. L. Adler An extended 5'-tau susceptibility haplotype in progressive supranuclear palsy
Neurology,
November 14, 2000;
55(9):
1364 - 1367.
[Abstract][Full Text][PDF]
M. G. Spillantini and M. Goedert Tau mutations in familial frontotemporal dementia
Brain,
May 1, 2000;
123(5):
857 - 859.
[Full Text][PDF]
P. M. Stanford, G. M. Halliday, W. S. Brooks, J. B. J. Kwok, C. E. Storey, H. Creasey, J. G. L. Morris, M. J. Fulham, and P. R. Schofield Progressive supranuclear palsy pathology caused by a novel silent mutation in exon 10 of the tau gene: Expansion of the disease phenotype caused by tau gene mutations
Brain,
May 1, 2000;
123(5):
880 - 893.
[Abstract][Full Text][PDF]
P. Heutink Untangling tau-related dementia
Hum. Mol. Genet.,
April 1, 2000;
9(6):
979 - 986.
[Abstract][Full Text][PDF]
J. J. Higgins, R. L. Adler, and J. M. Loveless Mutational analysis of the tau gene in progressive supranuclear palsy
Neurology,
October 22, 1999;
53(7):
1421 - 1421.
[Abstract][Full Text]
M. Farrer, K. Gwinn-Hardy, M. Hutton, and J. Hardy The genetics of disorders withsynuclein pathology and parkinsonism
Hum. Mol. Genet.,
September 1, 1999;
8(10):
1901 - 1905.
[Abstract][Full Text][PDF]
CiteULike 
Connotea 
Del.icio.us What's this?
