Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (250)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Stenoien, D. L.
Right arrow Articles by Mancini, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stenoien, D. L.
Right arrow Articles by Mancini, M. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics Pages 731-741  

Polyglutamine-expanded androgen receptors form aggregates that sequester heat shock proteins, proteasome components and SRC-1, and are suppressed by the HDJ-2 chaperone
Introduction
Results
   ARQ48 forms hormone-dependent aggregates
   Dynamics of aggregate formation
   ARQ48 aggregates co-localize with heat shock proteins
   Co-expression of HDJ-2/HSDJ reduces aggregate formation
   ARQ48 aggregates co-localize with NEDD8
   ARQ48 aggregates co-localize with PA700, but not 20S proteasome subunits
   ARQ48 aggregates sequester SRC1
Discussion
Materials And Methods
   Mammalian expression plasmids
   Cell labeling
   Fluorescent and deconvolution microscopy
   Western blots
   Immunogold labeling and EM
Acknowledgements
References

Polyglutamine-expanded androgen receptors form aggregates that sequester heat shock proteins, proteasome components and SRC-1, and are suppressed by the HDJ-2 chaperone

Polyglutamine-expanded androgen receptors form aggregates that sequester heat shock proteins, proteasome components and SRC-1, and are suppressed by the HDJ-2 chaperone

David L. Stenoien, Chris J. Cummings1, Henry P. Adams, Maureen G. Mancini, Kavita Patel, George N. DeMartino3, Marco Marcelli2, Nancy L. Weigel and Michael A. Mancini*

Department of Cell Biology, 1Department of Pediatrics, Program in Cell and Molecular Biology and 2Department of Medicine, Baylor College of Medicine and VA Medical Center, One Baylor Plaza, Houston, TX 77030, USA and 3Department of Physiology, University of Texas Southwestern Medical School, Dallas, TX, USA

Received November 20, 1998; Revised and Accepted February 2, 1999

Spinal bulbar muscular atrophy is a neurodegenerative disorder caused by a polyglutamine expansion in the androgen receptor (AR). We show in transiently transfected HeLa cells that an AR containing 48 glutamines (ARQ48) accumulates in a hormone-dependent manner in both cytoplasmic and nuclear aggregates. Electron microscopy reveals both types of aggregates to have a similar ultrastructure. ARQ48 aggregates sequester mitochondria and steroid receptor coactivator 1 and stain positively for NEDD8, Hsp70, Hsp90 and HDJ-2/HSDJ. Co-expression of HDJ-2/HSDJ significantly represses aggregate formation. ARQ48 aggregates also label with antibodies recognizing the PA700 proteasome caps but not 20S core particles. These results suggest that ARQ48 accumulates due to protein misfolding and a breakdown in proteolytic processing. Furthermore, the homeostatic disturbances associated with aggregate formation may affect normal cell function.

INTRODUCTION

Spinal bulbar muscular atrophy (SBMA) is a rare X-linked hereditary disease characterized by progressive muscle atrophy and weakness in patients beginning at ~30-50 years of age and is caused by degeneration of motor neurons (1,2). Mapping studies (3,4) and the finding that SBMA patients show partial androgen insensitivity (5) have implicated the AR gene in this disease. Expansion of a trinucleotide CAG repeat in the first exon of AR has been identified in SBMA patients (6) and produces a large polyglutamine (polyQ) tract. The length of the polyQ tract is polymorphic in the population ranging in size from 10 to 36 repeat units in normal individuals and from 40 to 62 repeat units in SBMA patients. PolyQ expansion is also associated with several other neurodegenerative diseases, including Huntington's disease (HD), dentatorubral and pallidoluysian atrophy (DRPLA) and spinocerebellar ataxia (SCA) 1, 2, 3, 6 and 7 (7-13). Many of these diseases are characterized by atrophy and loss of selected populations of neurons and development of inclusions containing mutant proteins (14-18). Intranuclear inclusions containing ataxin-1 and huntingtin are also found to be ubiquitin immunopositive and, recently, AR- and ubiquitin-positive cellular structures have been identified in an SBMA patient (14,16-19). Moreover, cellular aggregates of ataxin-1 immunolabel with antibodies specific for inducible Hsp70, HDJ-2/HSDJ and proteasome components (20). These data collectively suggest that abnormal protein folding leads to aggregation and proteasome redistribution and thereby offers a potential mechanism by which toxic polyQ proteins cause neurodegeneration.

An advantage of studying polyQ AR is that a large body of data has accumulated on wild-type AR function, intramolecular domains and interactions with steroid receptor cofactors and molecular chaperones (for reviews see refs 21-24). Unliganded steroid receptors exist in the cytoplasm as a complex containing several molecular chaperones, including Hsp90, Hsp70 and Hsp56 (25,26). Binding of hormone to the C-terminal ligand binding domain of AR results in shedding of heat shock proteins and translocation to the nucleus (27,28). Interactions with steroid receptor coactivators and DNA leads to the expression of specific DNA target sequences (22,29). Several mutations in AR, especially in the DNA binding domain, result in the formation of both cytoplasmic and nuclear aggregates that rapidly form only in the presence of hormone (30; L.V. Nazareth, D.L. Stenoien, W.E. Bingman III, A.J. James, C. Wu, Y. Zhang, D.P. Edwards, M.A. Mancini, M. Marcelli, D.J. Lamb and N.L. Weigel, submitted for publication). This suggests that in the absence of hormone, the association of mutant ARs with cytoplasmic chaperones may play a role in stabilizing AR and preventing aggregate formation. It should be noted, however, that mutations in the DNA binding domain lead to aggregates that are different in terms of the dynamics of their formation, ultrastructure and association with other cellular components than the polyQ aggregates.

Several recent studies have used cell culture models to investigate the properties of polyQ ARs compared with wild-type AR. When transfected into neuroblastoma cells, an AR containing 52 CAG repeats was shown to undergo cleavage of the C-terminal ligand binding domain and accumulate in cytoplasmic aggregates following 1 h of hormone treatment (31). Merry et al. (32) also found that cytoplasmic aggregation and proteolytic processing of AR occurred in a polyQ repeat length-dependent manner and this aberrant metabolism was coupled to cellular toxicity. Collectively, both groups demonstrated that polyQ ARs accumulate in cytoplasmic aggregates visualized by immunofluorescence microscopy. In addition, a recent brief report has shown that polyQ AR accumulates in ubiquitin-positive aggregates in the cell nuclei of patient tissue (19). This suggests that neuronal aggregates may be important for development of SBMA, as in the case of SCA1, SCA3 and HD.

While there appears to be a strong correlation between the occurrence of cellular inclusions and polyQ diseases, two recent reports have suggested that aggregate formation itself is not required for disease initiation. Aggregate formation by mutant huntingtin protein was not correlated with onset of cell death in transfected cells (33). In addition, transgenic mice expressing mutant ataxin-1[77Q] without a self-association domain develop ataxia and Purkinje cell pathology similar to that described for full-length ataxin-1[82Q] without forming detectable ataxin-1-positive aggregates (34). Though this result indicates that formation of aggregates is not required for initiation of SCA1 pathogenesis, aggregates may play a role in disease progression.

We show here that an increased frequency of hormone-induced AR aggregate formation occurs in a polyQ tract length-dependent manner. Using a green fluorescent protein (GFP)-ARQ48 chimera to study the dynamics of aggregate formation in live cells we demonstrate that aggregates can form immediately after hormone addition or during mitosis when nuclear patches of ARQ48 reorganize into cytoplasmic aggregates. Antibodies specific for cell stress proteins label ARQ48 aggregates. Moreover, ARQ48 aggregates differentially sequester proteasome components, mitochondria and the steroid receptor coactivator, SRC1. As shown for intranuclear aggregates containing mutant glucocorticoid receptor (35) and ataxin-1 (20), a compensatory increase in cellular levels of the molecular chaperone HDJ-2/HSDJ significantly reduce the formation of cytoplasmic ARQ48 aggregates. Taken together, these data support the idea that the polyQ expansion of AR leads to misfolding and elicits a cell stress response that disrupts normal protein turnover dynamics. Furthermore, disturbances in the homeostatic balances of chaperones, proteasomes, steroid receptor coactivators and ATP may adversely affect cell function.

RESULTS

ARQ48 forms hormone-dependent aggregates

To test the effects of polyQ tract length on aggregate formation in transfected cells, we used three AR constructs containing 0 (ARQ0), 22 (ARQ22) and 48 (ARQ48) glutamine repeats (Fig. 1A). Western blots of cell lysates from transfected cells revealed a ladder corresponding to the differences in molecular weight and that relatively equal amounts of protein were expressed (Fig. 1B). When transfected cells were analyzed by immunofluorescence, all three proteins were predominantly cytoplasmic in the absence of hormone but adopted a nuclear distribution in the presence of hormone (Fig. 1C). In some cells expressing large amounts of protein, non-distinct cytoplasmic aggregates were observed (Fig. 1C, left, and D, top left). However, these hormone-independent aggregates did not appear to be polyQ-dependent as they were present in cells expressing ARQ0 and ARQ22. In the presence of hormone a distinctly different type of cytoplasmic aggregate occurred that was closely correlated with polyQ tract length (Fig. 1D, top right, and Table 1). Since AR has a tendency to aggregate when overexpressed, we wanted to ensure that the hormone-induced cytoplasmic aggregates were dependent upon polyQ tract length. By transfecting equal amounts of DNA and checking protein expression levels by western blot analysis, a clear correlation was found between the appearance of aggregates and polyQ tract length (Table 1). In cells expressing ARQ48, cytoplasmic aggregates were found in ~25% of transfected cells, while this percentage dropped to 12.2% for ARQ22 and 6.7% for ARQ0. Cells expressing GFP-ARQ48 had a higher propensity to form detectable cytoplasmic aggregates (37% compared with 26%; Table 2). An increase in detectable aggregates was also observed with GFP-ARQ0 and GFP-ARQ22 (12.5 and 23%, respectively, compared with 6.7 and 12.2% for untagged ARQ0 and ARQ48, respectively). It is unclear whether this increased aggregate formation was due to the GFP or if GFP increases the ability to detect aggregates that are relatively impermeable to many antibodies. It is important to note that the dependence of polyglutamine tract length on the frequency of aggregate formation was maintained in the GFP constructs. There appears to be a cell cycle component to the appearance of these aggregates as they reached a peak at ~16 h after hormone addition and they were often found to form during mitosis (see below).


Figure 1. Detection of cytoplasmic ARQ48 aggregates in transfected HeLa cells. (A) Diagram of AR constructs showing location of the polyglutamine region (PolyQs) in relation to the DNA binding domain (DBD) and ligand binding domain (LBD). (B) A western blot shows the expression and size of ARQ48, ARQ22 and ARQ0 in transfected HeLa cells. Immunofluorescence was performed on HeLa cells transfected with each of the three AR constructs in the presence and absence of hormone, using charcoal-stripped serum-supplemented medium. All three ARs were cytoplasmic in the absence of hormone. (C) Some cells that express a relatively higher amount of AR contain non-distinct cytoplasmic aggregates (left). In the presence of hormone all three ARs were found in the nucleus with the exception that large, round cytoplasmic aggregates were frequently observed in cells expressing ARQ48 (right). (D) Higher resolution images show the differences between the non-distinct aggregates that form in the absence of hormone (top left) and those aggregates that form in a hormone and polyglutamine tract length-dependent manner (top right). By DIC (bottom left), ARQ48-positive structures have a solid appearance with the exception that dimples or holes can be seen in some. A high resolution image using a GFP-ARQ48 construct and deconvolution microscopy shows aggregates with a honeycombed appearance (bottom right). Bars, 10 µm.

Immunofluorescent labeling with anti-androgen receptor antibodies revealed a ring-like labeling pattern of the aggregates. This appearance was also observed with some but not all antibodies used for co-localization experiments (see below) and suggests a differential accessibility of epitopes within these structures. In differential interference contrast (DIC) microscopy (Fig. 1D, bottom left) the aggregates appeared solid with the exception that `holes' were sometimes observed. When cells were transfected with a GFP-ARQ48 construct, the bioluminescence appeared throughout in a non-homogeneous pattern indicating that ARQ48 is not confined to the periphery (Fig. 1D, bottom right).

High magnification electron microscopic images revealed a dense granular appearance of the ARQ48 aggregates (Fig. 2A). Immunogold labeling showed that ARQ48 is present throughout the dense fibrogranular regions and is excluded from the electronlucent regions (Fig. 3). Analysis of the nuclei of cells containing ARQ48 cytoplasmic aggregates showed dense nuclear patches of ARQ48 with a similar ultrastructure (Fig. 2B). These nuclear patches were difficult to detect by immunofluorescence microscopy although they were immunogold-positive for AR (Fig. 3). Interestingly, the cytoplasmic ARQ48 structures appeared to recruit mitochondria (Fig. 2A and B); in some cells virtually the entire cellular pool of mitochondria was associated with these structures (Fig. 2C). This observation indicates that large amounts of energy are required for the formation and maintenance of the ARQ48 aggregates. The ultrastructure of the cytoplasmic and nuclear aggregates suggests that they may form by similar mechanisms. Moreover, the cytoplasmic aggregates that we observed may have a nuclear origin since, in most cells, cytoplasmic aggregates appeared following cell division (see below).

Table 1. Effects of glutamine tract length on the formation of cytoplasmic aggregates
Construct Transfected cells counted Cells with cytoplasmic aggregates  
    n %
ARQ48 1022 251 24.5
ARQ22 1052 128 12.2
ARQ0 817 55 6.7
HeLa cells were transfected with equal amounts of ARQ48, ARQ22 or ARQ0 vectors, incubated with R1881 for 16 h and immunolabeled with anti-AR antibody. The total number of transfected cells was determined by counting cells with detectable AR fluorescence and the percentage of these cells containing cytoplasmic aggregates was determined. The numbers represent the combined totals from three experiments. AR protein levels were determined by quantitative immunoblots (data not shown) to ensure that equal amounts of protein were expressed with each construct.

Table 2. Effects of HDJ2/HSDJ wild-type and mutants on ARQ48 aggregate formation
AR construct HDJ construct Average percentage Standard error
ARQ48 Parent vector 25.06 0.83
ARQ48 HDJ2/HSDJwt 12.76 0.37
ARQ48 HDJ2/HSDJ[Delta]450 19 1.02
ARQ48 was co-transfected with empty vector, wild-type HDJ-2/HSDJ or HDJ-2/HSDJ[Delta]450 and the effects on aggregate formation were determined by counting the number of co-transfected cells containing aggregates. Five separate co-transfection studies were performed for each construct. The total number of AR-positive cells and aggregate-containing cells from one coverslip were counted for each transfection experiment and the percentage of cells containing aggregates was determined. The percentages from the five experiments were averaged. The level of repression observed between empty vector and wild-type HDJ2/HSDJ is significant (P < 0.0005).

Dynamics of aggregate formation


Figure 2. Ultrastructure of nuclear and cytoplasmic aggregates. High resolution EM images reveal aggregates in the nucleus and cytoplasm to have a fibrogranular appearance. Cytoplasmic aggregates were better circumscribed and dense and were frequently seen associated with mitochondria (A and B). In many cases, essentially all the mitochondria are found associated with ARQ48 structures (C). Nuclei of cells expressing ARQ48 contained less organized aggregates (NA) (B) compared with those in the cytoplasm (CA). Moreover, the density of the cytoplasmic aggregates varied somewhat, presumably representing different degrees of formation. Bars, 0.5 µm.


Figure 3. Immunogold labeling reveals nuclear and cytoplasmic aggregates of ARQ48 label with AR, p31/PA700, but not 20S antibodies. Immunogold co-labeling using different size gold particles was performed using anti-AR, anti-p31 and anti-20S antibodies to identify cytoplasmic aggregates (A and B) or nuclear patches (C and D) of ARQ48. Consistent with the immunofluorescent results, antibodies to AR (6 nm gold) and p31 (12 nm gold) label throughout the cytoplasmic aggregates (A) whereas little 20S labeling is found in the interior (B). AR and p31 labeling is also seen in the nuclear patches (C) (AR = 12 nm, p31 = 6 nm). Labeling of 20S is observed in the cytoplasm and at the periphery of some aggregates (20S = 12 nm) (B) indicating that the fixation procedure does not inhibit 20S immunogold labeling. The nuclear patches of ARQ48 label with anti-AR (12 nm) and also appear to exclude 20S particles (6 nm) (D). Bars, 200 nm.

To address the issues of the timing and mechanism of aggregate formation, GFP-ARQ48 was used for live cell analysis. In the absence of hormone, GFP-ARQ48 had a similar cytoplasmic distribution to both wild-type AR and untagged ARQ48 (Fig. 4A, left). The addition of hormone resulted in the rapid translocation of GFP-ARQ48 to the nucleus. In most cells, the entire cytoplasmic pool of GFP-ARQ48 translocated to the nucleus within 20 min where it had a similar distribution to ARQ22 and ARQ48 (Fig. 4A, bottom cell). However, in some cells, cytoplasmic aggregates were observed to form rapidly after hormone addition (Fig. 4A, top cell) indicating that GFP-ARQ48 structures can form in the cytoplasm prior to nuclear translocation. Observation of cells for longer periods of time demonstrated that GFP-ARQ48 structures also formed during mitosis. Several cells in various stages of aggregate formation are shown in Figure 4B. Two of the cells that appeared to be twin daughter cells contained very prominent cytoplasmic aggregates. Adjacent to these cells is a prometaphase cell that appears to be in the process of forming aggregates. The inset shows an anaphase cell with aggregates. Interestingly, ARQ48 appeared to coat the chromosomes during mitosis. This association of ARQ48 with mitotic chromosomes was also observed with the wild-type AR (data not shown). Live analysis of the cytoplasmic aggregates revealed that smaller aggregates can move and fuse to form larger aggregates (Fig. 4C). It is unknown at this time whether aggregates move and fuse through random movements or if they undergo some type of directed movement involving motor proteins. Indeed, the varied density of the aggregates by electron microscopy (EM) may reflect different stages of fusion.


Figure 4. Dynamics of ARQ48 aggregate formation. HeLa cells transfected with GFP-ARQ48 were visualized live during the addition of hormone (A). In most cells, the cytoplasmic ARQ48 translocated to the nucleus within 20 min of hormone addition. However, in some cells several cytoplasmic aggregates were observed to form within 10 min of hormone addition (top cell). In addition, cytoplasmic ARQ48 aggregates appear to form during mitosis (B). Note that ARQ48 and wild-type AR (data not shown) appear to coat the chromosomes during mitosis. Two cells just completing mitosis demonstrate numerous cytoplasmic aggregates. A cell just entering mitosis [prometaphase cell at the top left of (B)] also exhibits aggregates distinct from the chromatin-associated GFP-ARQ48. The inset shows an anaphase cell also displaying cytoplasmic aggregates. The cells shown in (B) were fixed and counterstained with DAPI (blue) to label DNA and chromosomes. Live microscopy of ARQ48-expressing cells reveals the cytoplasmic aggregates to be remarkably mobile and demonstrates fusion events (C). Asterisks (*) mark examples of aggregates that fuse over the course of 1 h. All images were generated using deconvolution microscopy. (A), (B) and (C) show 3D reconstructions of a Z series through a majority of the cell. Bars, 10 µm.


ARQ48 aggregates co-localize with heat shock proteins

AR associates with several molecular chaperones including Hsp70, Hsp90 and HDJ-2/HSDJ. These chaperones aid in stabilizing both unliganded and liganded AR and assisting in the conformational changes that occur upon hormone binding and translocation to the nucleus (27,28). To determine whether ARQ48 altered either the expression levels or localization of molecular chaperones, co-localization experiments were performed with relevant antibodies. We first examined if ARQ48 elicited a heat shock response by double labeling cells with antibodies specifically recognizing the inducible form of Hsp70. As shown for wild-type AR (36), we found increased staining of Hsp70 in cells containing ARQ48 in both the nucleus and cytoplasm; moreover, ARQ48 aggregates were intensely Hsp70 positive (Fig. 5A and B). ARQ48-positive structures also stained with antibodies recognizing Hsp90 (Fig. 5C and D) but labeling with antibodies recognizing other Hsps, including Hsp25, Hsp27 and Hsp110, was negative (data not shown). Labeling studies with antibodies recognizing HDJ-2/HSDJ also demonstrated that ARQ48-positive nuclei and aggregates accumulated HDJ-2/HSDJ (Fig. 5E and F). Taken together, these data indicate a direct relationship between expression levels and organization (aggregates) of ARQ48 and several, but not all, chaperones and suggest that a cell stress response is elicited by the presence of ARQ48 aggregates.


Figure 5. Association of ARQ48-positive structures with endogenous Hsp70, Hsp90, HDJ-2/HSDJ and the ubiquitin-like NEDD8. ARQ48-transfected cells were double labeled with mouse anti-AR and a rabbit antibody specifically recognizing the cell stress-inducible form of Hsp70 (A and B). Inducible Hsp70 redistributes to ARQ48 structures in cells expressing ARQ48. To detect co-localization of ARQ48 and Hsp90, cells were transfected with GFP-ARQ48 and labeled with mouse anti-Hsp90 (C and D). Association of endogenous HDJ-2/HSDJ was performed by labeling cells with mouse anti-HDJ-2/HSDJ and identifying ARQ48 structures easily by DIC (E and F). ARQ48-transfected cells were co-labeled with mouse anti-AR and rabbit anti-NEDD8 (G and H). In ARQ48-positive cells, NEDD8 redistributes with both nuclear and cytoplasmic ARQ48 aggregates. In untransfected cells, NEDD8 has a very distinct, punctate distribution in the nucleus but redistributes into a much more homogeneous pattern in nuclei containing ARQ48 (I and J). The higher resolution images in (A)-(D), (I) and (J) were generated using deconvolution microscopy. Bars, 10 µm.


Co-expression of HDJ-2/HSDJ reduces aggregate formation

The finding that cellular ARQ48 is associated with molecular chaperones and elicits a heat shock response suggests that protein misfolding leads to aggregate formation. Bacterial and eukaryotic DnaJ proteins have been shown to play important functional roles in protein folding and aggregation suppression (37,38). Moreover, Tang et al. (35) and Cummings et al. (20) have reported that overexpression of HDJ-2/HSDJ significantly suppresses the formation of nuclear aggregates containing mutant glucocorticoid receptor and polyQ-expanded ataxin-1, respectively. Suppression of protein aggregation by DnaJ proteins in vitro requires a large molar excess of DnaJ protein (39); therefore, the endogenous levels of HDJ-2/HSDJ may not be sufficient to suppress aggregate formation by exogenously expressed ARQ48. To examine this issue further, HDJ-2/HSDJ was co-expressed with ARQ48. When HeLa cells were co-transfected with ARQ48 and HDJ-2/HSDJ, the number of ARQ48-positive cells containing aggregates was reduced ~50% compared with cells transfected with empty vector (Table 2). This level of ARQ48 aggregate suppression by HDJ-2/HSDJ co-expression is very similar to that observed with mutant glucocorticoid receptor and mutant ataxin-1. Mutating the J domain of HDJ-2/HSDJ by deletion of amino acids 9-107 (HDJ-2/HSDJ[Delta]450) eliminated HDJ-2/HSDJ-mediated aggregate suppression of mutant glucocorticoid receptor (35) and mutant ataxin-1 (20). In the case of ARQ48, HDJ-2/HSDJ[Delta]450 had intermediate effects, with 19% of co-transfected cells containing aggregates (Table 2). When GFP-ARQ48 was used, the effect on aggregate formation by HDJ-2/HSDJ was more striking. Co-transfection of GFP-ARQ48 and HDJ-2/HSDJ constructs revealed a greater effect on HDJ-2/HSDJ-mediated aggregate suppression. In the presence of exogenous HDJ-2/HSDJ, the percentage of cells containing aggregates dropped from 37 to 15%. The HDJ-2/HSDJ[Delta]450 deletion construct was more similar to the empty parent vector with aggregates in 32% of cells.

ARQ48 aggregates co-localize with NEDD8

Since intranuclear SBMA AR, ataxin-1 and huntingtin aggregates co-localize with ubiquitin in patient tissue, we examined whether ARQ48 cytoplasmic aggregates were ubiquitin positive. In repeated experiments using several different ubiquitin antibodies and in parallel using ataxin-1 transfected cells that were ubiquitin positive, we have been unable to detect significant ubiquitin labeling of ARQ48 aggregates. However, ARQ48 aggregates labeled positively with NEDD8 (Fig. 5G and H), a protein that is 60% identical and 80% similar to ubiquitin (40,41). In untransfected HeLa cells, NEDD8 was very predominantly nuclear with a distinct punctate pattern (Fig. 5I). In cells expressing nuclear ARQ48, NEDD8 specifically redistributed with the receptor throughout the nucleus (Fig. 5J). This nuclear reorganization of NEDD8 was not restricted to ARQ48 but also occurred with ARQ22 and ARQ0 (data not shown), suggesting that under normal circumstances NEDD8 or a NEDD8-modified protein associates with AR. Recently, the ubiquitin conjugating enzyme E6AP has been shown to act as a steroid receptor coactivator (42), suggesting that modifications by ubiquitin-related proteins may play an important role in steroid receptor activity, and perhaps in SBMA pathology.

ARQ48 aggregates co-localize with PA700, but not 20S proteasome subunits

While little is known about the cellular function of NEDD8, it may play a similar role to ubiquitin in targeting proteins for degradation by proteasomes. One of the functions of ubiquitin modification is to target proteins for degradation by the multisubunit proteinase called the 26S proteasome (43-45). The 26S proteasome is a complex supermacromolecular structure consisting of a proteolytic 20S core particle and two PA700 `cap' structures that form a 700 kDa multisubunit complex (46-49). The PA700 caps are involved in recognizing ubiquitin-modified substrates and targeting them for degradation in an ATP-dependent manner (48). To test whether ARQ48 aggregates associate with any components of the proteasome, co-localization experiments were performed with antibodies recognizing the 20S core particle and the p31 protein subunit of the PA700 cap. In untransfected cells, the staining patterns of 20S and p31 antisera were very similar; both showing cytoplasmic and nucleoplasmic staining with a stronger signal in the nucleus (Fig. 6A and C). In ARQ48-transfected cells containing cytoplasmic aggregates, the distribution of the 20S subunit was largely unaffected (Fig. 6C and D). In contrast, immunostaining with the p31 antibody showed ARQ48 structures to be PA700 positive (Fig. 6A and B). This result was confirmed by using a second PA700 antibody that recognizes additional PA700 protein subunits (data not shown). Higher resolution images using deconvolution microscopy clearly showed that p31/PA700 (Fig. 6E and F), but not 20S, accumulated in cytoplasmic ARQ48 aggregates (Fig. 6G and H).


Figure 6. Preferential association of ARQ48 with PA700 proteasome activator caps versus 20S core particles. To detect association of ARQ48 aggregates with PA700 proteasome caps, cells were co-labeled with mouse anti-AR and rabbit anti-p31 (a protein subunit of PA700) (A and B). Note that much of the cellular PA700 is found associated with ARQ48 structures. To determine if 20S proteasome core particles associate with ARQ48, cells were co-labeled with mouse anti-AR and rabbit anti-20S. Interestingly, very little 20S staining was found associated with ARQ48 structures (C and D) indicating that functional 26S proteasomes are not likely within these structures. Higher resolution images using deconvolution microscopy confirms that ARQ48 aggregates are immunopositive for p31/PA700 (E and F), but not for 20S (G and H). Bars, 10 µm.

The ring-like staining pattern observed with anti-AR and other antibodies suggests that epitope accessibility in the interior of the aggregates is diminished. This raised the possibility that the diminished 20S staining observed in Figure 6 was due to poor anti-20S antibody penetration. To address this issue, immunogold labeling of ultrathin sections was performed using antibodies recognizing AR, p31 and 20S. Co-localization experiments were performed using different-sized gold particles to detect AR and proteasome subunits. ARQ48 and p31 were found to label throughout the cytoplasmic aggregates, save for the electronlucent holes (Fig. 3A), which is consistent with the immunofluorescent results presented in Figures 1 and 6. When co-labeling was performed with ARQ48 and 20S, the 20S labeling was diminished in comparison with ARQ48 and p31 (Fig. 3B). Scant labeling of 20S was observed in the interior of some aggregates but was not enriched compared with the normal cytoplasmic distribution of 20S. These data indicate that ARQ48-positive structures have altered ratios of proteasome subunits and may lack the components necessary for a functional 26S proteasome. To address whether the altered distribution of proteasomes also occurred in nuclear ARQ48 patches, immunogold labeling was carried out in nuclei. The nuclear patches were found to stain positively for both AR and p31/PA700 (Fig. 3C) but had reduced 20S staining (Fig. 3D). These results indicate that both nuclear and cytoplasmic ARQ48 aggregates have altered stoichiometries of proteasome subunits that could lead to defects in proteolytic processing of misfolded ARQ48 in both the cytoplasm and nucleus.

ARQ48 aggregates sequester SRC1

ARs containing expanded polyQ repeats have lower transcriptional activity than wild-type ARs (50-53). This reduced activity could be directly due to the formation of protein aggregates that would reduce the amount of receptor available in the nucleus for transcription. Alternatively, expanded glutamine tracts could have a more direct impact on transcription by affecting the way in which AR interacts with other transcriptional components. Steroid receptor coactivator 1 (SRC1) has been well studied in terms of its ability to interact with AR and other steroid receptors and enhance transcriptional activity (22,29). To test whether ARQ48 alters the cellular distribution of SRC1, we co-transfected ARQ48 and a functional GFP-SRC1 construct (S.A. Onate and M.A. Mancini, unpublished data) and examined the localization pattern of both proteins. ARQ48 co-localized with GFP-SRC1 in the nucleus in a hormone-dependent manner, as did wild-type AR. Interestingly, GFP-SRC1 was also found associated with ARQ48 cytoplasmic aggregates (Fig. 7). These aggregates sequester a large proportion of the available GFP-SRC1, suggesting that polyQ AR retains the ability to interact with SRC1, presumably through its ligand binding domain.


Figure 7. Association of ARQ48 aggregates and SRC1. To determine the spatial relationship between ARQ48 and the functionally important coactivator SRC1, HeLa cells were co-transfected with ARQ48 and GFP-SRC1 vectors. ARQ48 was detected with anti-AR followed by Texas Red-conjugated secondary antibodies. A functional GFP-SRC1 (A) (S.A. Onate and M.A. Mancini, unpublished data) associates with ARQ48 (B) and redistributes to ARQ48 aggregates. Images were generated using deconvolution microscopy. Bars, 10 µm.

DISCUSSION

The data presented here implicate failure to disperse and proteolyze misfolded protein as being responsible for the accumulation of ARQ48 aggregates. In our cell culture model, ARQ48 can accumulate in patches within the nucleus or in cytoplasmic aggregates. Many of the cytoplasmic aggregates containing nuclear proteins (NEDD8 and SRC1) likely form from a redistribution of the nuclear patches during cell division. ARQ48 aggregates accumulate molecular chaperones, specific proteasome components and mitochondria in what may be an attempt to refold or hydrolyze the misfolded protein. By co-expressing one of these required resources, namely HDJ-2/HSDJ, we assist the cellular response to these misfolded proteins and prevent aggregate formation in a large proportion of affected cells.

A complicating issue in these studies is that AR has a tendency to aggregate when overexpressed, as evidenced by the finding that even ARQ0 will form aggregates in some cells. It is important to note that there is a clear dependence upon polyglutamine tract length of the frequency of aggregate formation when ARs containing variable polyQs are expressed at similar levels (Table 1). This increased frequency of aggregate formation by polyQ ARs could possibly lead to the formation of aggregates over the course of 30-50 years in SBMA patients when a polyQ AR is expressed at physiological levels. We have examined the few cells that contain aggregates with ARQ0 and ARQ22 and find that they contain similar cellular components to the ARQ48 aggregates (data not shown). For this reason we feel that polyglutamines affect the frequency of aggregate formation by AR rather than resulting in AR aggregates that are substantially different in composition.

An emerging theme from disparate data is that several neurodegenerative diseases, including SBMA, SCAs, DRPLA and HD, as well as Alzheimer's disease, Parkinson's disease and prion-generated disease, result from accumulation of misfolded protein and associated cytoxicity (54). Evidence suggests that altered distributions of molecular chaperones and proteasome components are associated with disease pathology. In some cases, addition of excess molecular chaperones can prevent formation of protein aggregates in vitro or in vivo. Recently, prion protein has been shown to interact with yeast hsp104 and GroEL chaperones in vitro, suggesting that this interaction may play a role in aggregate formation in vivo (55). We demonstrate that ARQ48 aggregates accumulate the molecular chaperones Hsp70, Hsp90 and HDJ-2/HSDJ.

Co-expression of HDJ-2/HSDJ partially abrogates ARQ48 cytoplasmic aggregate formation as well as nuclear aggregate formation in two other proteins, a mutant glucocorticoid receptor (35) and ataxin-1[82Q] (20). HDJ-2/HSDJ is a member of the Hsp40 family of molecular chaperones that function in concert with Hsp70 family members to assist in protein folding and prevention of protein misfolding (37,38). The finding that Hsp70 is induced and associated with aggregates of ARQ48 (Fig. 5) and ataxin-1 suggests that overexpression of HDJ-2/HSDJ suppresses aggregate formation by enhancing endogenous Hsp70 activity. In the case of ataxin-1, the N-terminal DnaJ domain, which interacts with Hsp70 and regulates its ATPase activity (56), was shown to be important for this suppressive effect. Our results indicate that other regions of HDJ-2/HSDJ contribute to suppression of ARQ48 aggregate formation, since the DnaJ domain deletion has intermediate suppressive effects (Table 2).

An advantage of studying the effects of polyQ expansion in the AR as opposed to other glutamine repeat proteins is the wealth of data concerning its known transactivator function and associations with cofactors. The interaction of ARQ48, HDJ-2/HSDJ, Hsp70 and Hsp90 is not surprising given that these molecular chaperones interact with wild-type AR and regulate hormone-dependent transactivation (27,28). Unliganded AR is predominantly cytoplasmic (30) and exists as a complex with molecular chaperones, including constitutive Hsp70, Hsp90 and HDJ2/HSDJ (24). Addition of hormone results in shedding of cytoplasmic chaperones, conformational changes in the receptor and translocation to the nucleus where ligand bound receptor interacts with nuclear chaperones and components of the transcriptional apparatus (25). Our live imaging results indicate that cytoplasmic aggregate formation can occur immediately after hormone addition and, probably, more prevalently during cell division. This suggests that a protective effect exists for the unliganded cytoplasmic receptor through interactions with endogenous chaperones. The cytoplasmic formation of GFP-ARQ48 aggregates observed immediately following hormone addition (and chaperone shedding) supports this notion.

The aggregates associated with SCA1, SCA3, HD and SBMA contain ubiquitin (14,16,17,19), suggesting that ubiquitination pathways are involved in disease formation and imply proteasome involvement as well. Direct interaction of proteasomes with nuclear aggregates has been demonstrated for ataxin-1 (20) and here we demonstrate an altered distribution of cellular PA700, a major component of the 26S proteasome, in both intranuclear accumulations of ARQ48 and in the cytoplasmic aggregates. Moreover, immunolabeling for the 20S core proteasome is greatly reduced both in cytoplasmic aggregates and intranuclear patches of ARQ48. Our finding that a significant portion of the PA700 activating cap complex is sequestered in ARQ48 aggregates, combined with the diminished levels of 20S core particle, strongly supports the idea that these aggregates contain low amounts of functional 26S proteasomes. This could prevent the cell from adequately processing the misfolded protein and lead to an accumulation of large aggregates that may be toxic to the cell. Perhaps as important, depletion or changes in the cellular pool of proteasome components would presumably distort the dynamics of proteasome assembly/disassembly and normal protein turnover. This could disrupt other cellular functions that require proteasomes, leading to toxic effects on the cell. It may also be important to note that in cells with numerous ARQ48 aggregates, mitochondria appear to be sequestered, suggesting that formation and/or maintenance of the aggregates are energy dependent. In this regard, it is interesting that many of the proteins that comprise the proteasome cap have ATPase activities (47,57).

The hormonal requirement for ARQ48 aggregate formation in tissue culture cells suggests that hormone is required for the formation of aggregates in patients affected with SBMA. Since the cause of SBMA is due to a gain of a toxic function by AR, this may help to explain why heterozygote female carriers, who have low levels of androgens compared with males, display few or no abnormalities (58). Based on this, one would expect that anti-androgens would have a beneficial result in patients. However the available data, which are scant, indicate that hormonal treatments have little effect, either positive or negative, on patient condition. By the time SBMA is diagnosed, the accumulation of misfolded AR and the toxic effects this may have on motor neurons may be too great to overcome by the simple addition or removal of hormone. Moreover, testosterone has a trophic effect on motor neurons in vitro (59), so removal of hormone or addition of anti-androgens could have an adverse affect. In our tissue culture model, we demonstrate that a number of cellular components, including proteasomes and molecular chaperones, are disrupted by mutant AR, thus providing more potential therapeutic targets.

In the case of ataxin-1, HDJ-2/HSDJ and proteasomes are found associated with nuclear ataxin-1 aggregates in transfected tissue culture cells, transgenic mice and SCA1 patient tissue (20). This suggests that tissue culture cells can serve as a valid model to study the interactions of aggregates with chaperones and proteasomes. A recent report has shown that SBMA patients have nuclear aggregates that are very similar to the nuclear aggregates found in SCA and HD patients (19). These nuclear aggregates only label with antibodies recognizing the N-terminus of AR but not with antibodies to other regions of AR. One of the antibodies used that did not label the aggregates corresponds to roughly the same epitope we use here in our experiments. Our attempts to identify AR aggregates in patient tissue have been equivocal, which may be due in part to poor preservation of tissue as well as epitope inaccessibility of our antibody. We identify here both cytoplasmic and nuclear aggregates that are revealed to have similar ultrastructure by electron microscopy. In most cases, cytoplasmic aggregates arise following mitosis, indicating that they form first in the nucleus. Also, the predominantly nuclear NEDD8 and SRC1 are found to redistribute to cytoplasmic aggregates, implying that the ARQ48 found in these aggregates has a nuclear origin. The occurrence of cytoplasmic aggregates could result from the tissue culture cells used in this experiment being capable of dividing, unlike the affected neurons in SBMA patients. Regardless, the similarity between the nuclear and cytoplasmic aggregates we observe in terms of ultrastructure and association with proteasome subunits suggests that nuclear aggregates would also perturb many of the same cellular functions that we hypothesize for the cytoplasmic aggregates.

We present here a number of factors associated with ARQ48 aggregates that by themselves, or together, could affect normal cell metabolism. First, the association of ARQ48 with molecular chaperones could directly disrupt the cell's ability to deal with other misfolded proteins and activate the stress response. Secondly, disruption of the proteasome pathway could affect the dynamics of protein turnover and lead to defects in other cellular functions requiring proteasomes. Thirdly, the association of mitochondria with cytoplasmic aggregates indicates that these aggregates place a large energy demand on the cell. This energy is likely being used by the chaperones and proteasomes in an attempt to refold or proteolyze misfolded ARQ48. Finally, we demonstrate that ARQ48 alters the distribution of SRC1, suggesting that ARQ48 aggregates could have a global effect on transcription pathways involving this coactivator in addition to affecting androgen-mediated transcription. These results indicate that a number of cellular pathways are disrupted in cells containing misfolded protein aggregates and provide several targets for therapeutic approaches. We demonstrate that overexpression of a molecular chaperone can partially prevent aggregate formation in tissue culture cells; however, finding a way to apply this observation to patients will be a challenge. Factors that affect proteasome or transcription pathways may also be likely candidates for disease treatment and should be further explored.

MATERIALS AND METHODS

Mammalian expression plasmids

The original AR cDNA (60) was subcloned in the CMV3 vector (CMV-AR) and contains 22 glutamines. AR receptor constructs containing 0 or 48 repeats were obtained by site-directed mutagenesis utilizing the unique restriction sites NarI and AflII, which surround the polyQ repeat (61). The Q48 fragment was PCR amplified from the genomic DNA of an SBMA patient and subcloned in a CMV-AR plasmid previously digested with NarI and AflII. To generate GFP-AR constructs, PCR was used to amplify the AR DNA spanning amino acids 1-108 with a 5[prime] KpnI (5[prime]GFP-AR, AGCTGGTACCATGGAAGTGCAGTTAGGGCTG) site and a 3[prime] BamHI site (3[prime]GFP-AR, AGCTGGATCCTTGGGGAGAACCATCCTCAC). This PCR fragment was subcloned into the pEGFP-C1 vector (Clontech, Palo Alto, CA) using the KpnI and BamHI sites. The AR DNAs containing 0, 22 and 48 glutamine repeats were cut out of the original AR vectors using XmaI (located 5[prime] to the repeats) and BglII. These segments were subcloned into the pEGFP-C1-AR(amino acids 1-108) vector using the XmaI and BamHI sites to generate the vectors GFP-ARQ0, GFP-ARQ22 (wt) and GFP-ARQ48. Full-length human HDJ-2/HSDJ and [Delta]450 (deletion of amino acids 9-107) (35) were subcloned into the pFlag-CMV-2 vector (Sigma, St Louis, MO) as described previously (20). GFP-SRC1 was generated by PCR amplification of the GFP sequence from pEGFP-C1 (Clontech) using the primers 5[prime]EGFP (CATGGTACCATGGTGAGCAAGGGCGAGGA) and 3[prime]EGFP (CTGCAGAACCACCACACTGGACTTGTACAGCTCGTCCATGC) to create a GFP fragment with a 5[prime] KpnI site and a 3[prime] BstXI site used for subcloning into the pCR3.1-hSCR1a vector encoding human SRC1 (29).

Cell labeling

Twenty-four hours prior to transfection, HeLa cells were plated onto poly-d-lysine-coated coverslips in 35 mm wells at a concentration of 105 cells/well. Transient expression of AR, HDJ-2/HSDJ and GFP-SRC1 vectors was accomplished using a calcium phosphate transfection kit (5[prime]-3[prime], Boulder, CO). Twelve hours after transfection, cells were shocked with 10% DMSO and allowed to recover for 6 h prior to addition of hormone. In some cases, cells were synchronized following transfection by addition of 0.1 mg/ml colcemid for 4 h, after which mitotic cells were harvested and replated for 2 h before hormone addition. Cells were incubated for 16 h with 10-9 R1881 and fixed in 4% formaldehyde in PEM (80 mM K-PIPES, 5 mM EGTA, 2 mM MgCl2, pH 6.8) for 30 min at 4°C, quenched in 1 mg/ml NaBH4 in PEM and permeabilized for 30 min in 0.5% Triton X-100 in PEM. Coverslips were blocked for 1 h at room temperature in 5% dry milk in TBST (20 mM Tris-HCl, 150 mM NaCl, 0.1% Tween 20, pH 7.4) and incubated for 2 h at room temperature with primary mouse monoclonal anti-AR (generated against the peptide CSTEDTAEYSPFKGGYTK corresponding to amino acids 299-315 of human AR; L.V. Nazareth, D.L. Stenoien, W.E. Bingman III, A.J. James, C. Wu, Y. Zhang, D.P. Edwards, M.A. Mancini, M. Marcelli, D.J. Lamb and N.L. Weigel, submitted for publication) at a concentration of 0.5 µg/ml diluted in blocking buffer. Hsp70 was detected with a rabbit polyclonal anti-Hsp70 antibody (1:500; StressGen, Victoria, British Columbia, Canada). Hsp90 was detected with a mouse monoclonal anti-Hsp90 antibody (1:500; StressGen). Endogenous HDJ-2/HSDJ was detected using mouse monoclonal anti-HDJ-2/DNAJ (1:200; Neomarker, Fremont, CA). Proteasome subunits were detected with rabbit polyclonal anti-20S antibody, rabbit polyclonal anti-p31 antibody, rabbit polyclonal anti-p28 antibody or chicken anti-PA700 antibody all diluted 1:500 (62,63). NEDD8 was detected using a rabbit polyclonal anti-NEDD8 antibody [1:500; a gift from E. Yeh (41)]. The FLAG epitope in expressed HDJ-2/HSDJ was detected using the mouse monoclonal antibody M2 (1:2000; Sigma). Primary antibodies were detected using the appropriate Texas Red- or FITC-conjugated secondary antibodies (1:600; Southern Biotechnologies, Birmingham, AL) recognizing mouse, rabbit or chicken primary antibodies. In some cases (Hsp90 and HDJ-2/HSDJ), co-localization was performed using GFP-labeled AR instead of AR antibody since both primary antibodies were made in mouse. Cells were counterstained for 1 min in DAPI (1 µg/ml) in TBST and mounted in Slow Fade reagent (Molecular Probes, Eugene, OR).

Fluorescent and deconvolution microscopy

Conventional immunofluorescence microscopy and DIC were performed using a Zeiss Axiophot microscope. Deconvolution microscopy was performed on a Zeiss Axiovert S100 TV microscope and a DeltaVision Restoration Microscopy System (Applied Precision, Issaquah, WA). A Z series of focal planes was digitally imaged and deconvolved with the DeltaVision constrained iterative algorithm (64) to generate high resolution images. All image files were digitally processed for presentation using Adobe Photoshop and printed at 300 d.p.i. using a Codonics NP 1600 dye diffusion printer.

Western blots

Following transfection and hormone addition, cells were lysed in 1× Laemmli sample buffer and samples (~105 cells/well) were electrophoresed on a 4-16% SDS-PAGE gel and transferred to Immobilon (Millipore, Bedford, MA) using a liquid transfer apparatus (Bio-Rad, Hercules, CA). The membrane was blocked for 1 h in 5% dry milk in TBST, incubated with anti-AR mouse monoclonal antibody (0.1 µg/ml) for 2 h, washed in TBST, incubated with horseradish peroxidase-conjugated secondary antibody (1:2000; Pierce, Rockford, IL) for 1 h and washed in TBST. Signal was detected using the ECL kit (Amersham, Arlington Heights, IL).

Immunogold labeling and EM

Transfected cells were fixed for 1 h in 0.1 M sodium cacodylate buffer, pH 7. 3, containing either 4% paraformaldehyde and 0.1% glutaraldehyde (immunogold labeling studies) or 2% paraformaldehyde and 2% glutaraldehyde, followed by post-fixation for 1 h in 1.0% osmium tetroxide in the same buffer (ultrastructural studies). Fixed cells were gradually dehydrated in ethanol to a final concentration of 100% and embedded in LR White (EM Sciences, Fort Washington, PA) for imunolabelling or in Spurr's (EM Sciences). Ultrathin sections were cut on an RMC MT6000-XL and stained with lead citrate and ethanolic uranyl acetate for ultrastructural studies and examined at 75 kV with a Hitachi H7000 TEM.

For immunogold labeling, sections on nickel grids were incubated for 15 min in 10% normal goat serum (Sigma) in 0.05 M Tris containing 150 mM NaCl, 0.1% Tween 20 and 1.0% bovine serum albumin (TBST-BSA). Grids were transferred directly to mouse anti-AR diluted 1:75 in TBST-BSA for 1 h, washed in TBST and incubated in 12 nm gold-labeled goat anti-mouse antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) diluted 1:30 in TBST-BSA, followed by extensive washing in TBST. The sections were then incubated for 1 h in one of the following rabbit antibodies diluted in TBST-BSA: P31, 1:75; 20S, 1:50; PA700, 1:50. This was followed by washing in TBST. The sections were incubated for 1 h in 6 nm gold-labeled goat anti-rabbit antibody diluted 1:30, then washed in TBST followed by distilled water. The grids were stained for 3-5 s in ethanolic uranyl acetate and examined at 75 kV with a Hitachi H7000 TEM.

ACKNOWLEDGEMENTS

The authors wish to thank Huda Zoghbi, Guido Jenster, Don DeFranco, Angelo Poletti and Walter Ward for many helpful discussions and critical evaluation of experimental data. Ed Yeh is thanked for sharing the NEDD8 antibody. The microscopy in this study was performed in the Integrated Microscopy Core, Center for Reproductive Biology, Department of Cell Biology (NIH HD-07165). These studies were supported in part by a Scientist Development Grant from the National American Heart Association (M.A.M.), a post-doctoral fellowship to D.L.S. (NIH 1F32DK09787-01), NIH grant CA68615 (N.L.W. and M.A.M.), NIH grant DK46181 (G.N.D.) and NIH grant CA68615 (M.M.).

REFERENCES

1. Kennedy, W.R., Alter, M. and Sung, J.H. (1968) Progressive proximal spinal and bulbar muscular atrophy of late onset. A sex-linked recessive trait. Neurology, 18, 671-680.

2. Sobue, G., Hashizume, Y., Mukai, E., Hirayama, M., Mitsuma, T. and Takahashi, A. (1989) X-linked recessive bulbospinal neuronopathy. A clinicopathological study. Brain, 112, 209-232. MEDLINE Abstract

3. Fischbeck, K.H., Ionasescu, V., Ritter, A.W., Ionasescu, R., Davies, K., Ball, S., Bosch, P., Burns, T., Hausmanowa-Petrusewicz, I., Borkowska, J., Ringel, S.P. and Stern, L.Z. (1986) Localization of the gene for X-linked spinal muscular atrophy. Neurology, 36, 1595-1598. MEDLINE Abstract

4. Brown, C.J., Goss, S.J., Lubahn, D.B., Joseph, D.R., Wilson, E.M., French, F.S. and Willard, H.F. (1989) Androgen receptor locus on the human X chromosome: regional localization to Xq11-12 and description of a DNA polymorphism. Am. J. Hum. Genet., 44, 264-269. MEDLINE Abstract

5. Fischbeck, K.H., Souders, D. and La Spada, A. (1991) A candidate gene for X-linked spinal muscular atrophy. Adv. Neurol., 56, 209-213. MEDLINE Abstract

6. La Spada, A.R., Wilson, E.M., Lubahn, D.B., Harding, A.E. and Fischbeck, K.H. (1991) Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature, 352, 77-79. MEDLINE Abstract

7. Orr, H.T., Chung, M.Y., Banfi, S., Kwiatkowski, T.J., Servadio, A., Beaudet, A.L., McCall, A.E., Duvick, L.A., Ranum, L.P. and Zoghbi, H.Y. (1993) Expansion of an unstable trinucleotide CAG repeat in spinocerebellar ataxia 1. Nature Genet., 4, 221-226. MEDLINE Abstract

8. Kawaguchi, Y., Okamoto, T., Taniwaki, M., Aizawa, M., Inoue, M., Katayama, S., Kawagami, H., Nakamura, S., Nishimura, M., Akiguchi, I. et al.) (1994) CAG expansions in a novel gene for Machado-Joseph disease at chromosome 14q32.1. Nature Genet., 6, 9-13. MEDLINE Abstract

9. Imbert, G., Saudou, F., Yvert, G., Devys, D., Trottier, Y., Garnier, J.M., Weber, C., Mandel, J.L., Cancel, G., Abbas, N., Durr, A., Didierjean, O., Stevanin, G., Agid, Y. and Brice, A. (1996) Cloning of the gene for spinocerebellar ataxia 2 reveals a locus with high sensitivity to expanded CAG/glutamine repeats. Nature Genet., 14, 285-291.

10. Becher, M.W., Rubinsztein, D.C., Leggo, J., Wagster, M.V., Stine, O.C., Ranen, N.G., Franz, M.L., Abbott, M.H., Sherr, M., MacMillan, J.C., Barron, L., Porteous, M., Harper, P.S. and Ross, C.A. (1997) Dentatorubral and pallidoluysian atrophy (DRPLA). Clinical and neuropathological findings in genetically confirmed North American and European pedigrees. Mov. Disord., 12, 519-530.

11. David, G., Abbas, N., Stevanin, G., Durr, A., Yvert, G., Cancel, G., Weber, C., Imbert, G., Saudou, F., Antoniou, E., Drabkin, H., Gemmill, R., Giunti, P., Benomar, A., Wood, N., Ruberg, M., Agid, Y., Mandel, J.L. and Brice, A. (1997) Cloning of the SCA7 gene reveals a highly unstable CAG repeat expansion. Nature Genet., 17, 65-70.

12. Zoghbi, H.Y. and Orr, H.T. (1995) Spinocerebellar ataxia type 1. Semin. Cell Biol., 6, 29-35. MEDLINE Abstract

13. Pulst, S.M., Nechiporuk, A., Nechiporuk, T., Gispert, S., Chen, X.N., Lopes-Cendes, I., Pearlman, S., Starkman, S., Orozco-Diaz, G., Lunkes, A., DeJong, P., Rouleau, G.A., Auburger, G., Korenberg, J.R., Figueroa, C. and Sahba, S. (1996) Moderate expansion of a normally biallelic trinucleotide repeat in spinocerebellar ataxia type 2. Nature Genet., 14, 269-276.

14. Skinner, P.J., Koshy, B.T., Cummings, C.J., Klement, I.A., Helin, K., Servadio, A., Zoghbi, H.Y. and Orr, H.T. (1997) Ataxin-1 with an expanded glutamine tract alters nuclear matrix-associated structures. Nature, 389, 971-974.

15. Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H., Davies, S.W. and Bates, G.P. (1997) Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Nature Genet., 15, 197-200. MEDLINE Abstract

16. Davies, S.W., Turmaine, M., Cozens, B.A., DiFiglia, M., Sharp, A.H., Ross, C.A., Scherzinger, E., Wanker, E.E., Mangiarini, L. and Bates, G.P. (1997) Formation of neuronal intranuclear inclusions underlies the neurological dysfunction in mice transgenic for the HD mutation. Cell, 90, 537-548. MEDLINE Abstract

17. DiFiglia, M., Sapp, E., Chase, K.O., Davies, S.W., Bates, G.P., Vonsattel, J.P., Aronin, N. (1997) Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neurites in brain. Science, 277, 1990-1993. MEDLINE Abstract

18. Paulson, H.L., Perez, M.K., Trottier, Y., Trojanowski, J.Q., Subramony, S.H., Das, S.S., Vig, P., Mandel, J.L., Fischbeck, K.H. and Pittman, R.N. (1997) Intranuclear inclusions of expanded polyQ protein in spinocerebellar ataxia type 3. Neuron, 19, 333-344. MEDLINE Abstract

19. Li, M., Miwa, S., Kobayashi, Y., Merry, D.E., Yamamoto, M., Tanaka, F., Doyu, M., Hashizume, Y., Fischbeck, K.H. and Sobue, G. (1998) Nuclear inclusions of the androgen receptor protein in spinal and bulbar muscular atrophy. Ann. Neurol., 44, 249-254. MEDLINE Abstract

20. Cummings, C.J., Mancini, M.A., Antalffy, B., DeFranco, D.B., Orr, H.T. and Zoghbi, H.Y. (1998) Chaperone suppression of aggregation and altered subcellular proteasome localization imply protein misfolding in SCA1. Nature Genet., 19, 148-154. MEDLINE Abstract

21. Tsai, M.J. and O'Malley, B.W. (1994) Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu. Rev. Biochem., 63, 451-486. MEDLINE Abstract

22. Shibata, H., Spencer, T.E., Onate, S.A., Jenster, G., Tsai, S.Y., Tsai, M.J. and O'Malley, B.W. (1997) Role of co-activators and co-repressors in the mechanism of steroid/thyroid receptor action. Rec. Prog. Hormone Res., 52, 141-164.

23. MacLean, H.E., Warne, G.L. and Zajac, J.D. (1997) Localization of functional domains in the androgen receptor. J. Steroid Biochem. Mol. Biol., 62, 233-242. MEDLINE Abstract

24. DeFranco, D.B., Ramakrishnan, C. and Tang, Y. (1998) Molecular chaperones and subcellular trafficking of steroid receptors. J. Steroid Biochem. Mol. Biol., 65, 51-58. MEDLINE Abstract

25. Pratt, W.B. (1993) The role of heat shock proteins in regulating the function, folding and trafficking of the glucocorticoid receptor. J. Biol. Chem., 268, 21455-21458. MEDLINE Abstract

26. Veldscholte, J., Berrevoets, C.A., Zegers, N.D., van der Kwast, T.H., Grootegoed, J.A. and Mulder, E. (1992) Hormone induced dissociation of the androgen receptor-heat shock protein complex: use of a new monoclonal antibody to distinguish transformed and nontransformed receptors. Biochemistry, 31, 7422-7430. MEDLINE Abstract

27. Caplan, A.J., Langley, E., Wilson, E.M. and Vidal, J. (1995) Hormone-dependent transactivation by the human androgen receptor is regulated by a dnaJ protein. J. Biol. Chem., 270, 5251-5257. MEDLINE Abstract

28. Bohen, S.P., Kralli, A. and Yamamoto, K.R. (1995) Hold 'em and fold 'em: chaperones and signal transduction. Science, 268, 1303-1304. MEDLINE Abstract

29. Onate, S.A., Tsai, S.Y., Tsai, M.J. and O'Malley, B.W. (1995) Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science, 270, 1354-1357.

30. Jenster, G., Trapman, J. and Brinkmann, A.O. (1993) Nuclear import of the human androgen receptor. Biochem. J., 293, 761-768.

31. Butler, R., Leigh, P.N., McPhaul, M.J. and Gallo, J.M. (1998) Truncated forms of the androgen receptor are associated with polyQ expansion in X-linked spinal and bulbar muscular atrophy. Hum. Mol. Genet., 7, 121-127. MEDLINE Abstract

32. Merry, D.E., Kobayashi, Y., Bailey, C.K., Taye, A.A. and Fischbeck, K.H. (1998) Cleavage, aggregation and toxicity of the expanded androgen receptor in spinal and bulbar muscular atrophy. Hum. Mol. Genet., 7, 693-701. MEDLINE Abstract

33. Saudou, F., Finkbeiner, S., Devys, D. and Greenberg, M.E. (1998) Huntingtin acts in the nucleus to induce apoptosis but death does not correlate with the formation of intranuclear inclusions. Cell, 95, 55-66. MEDLINE Abstract

34. Klement, I.A., Skinner, P.J., Kaytor, M.D., Hong, Y., Hersch, S.M., Clark, H.B., Zoghbi, H.Y. and Orr, H.T. (1998) Ataxin-1 nuclear localization and aggregation: role in polyQ-induced disease in SCA1 transgenic mice. Cell, 95, 41-53. MEDLINE Abstract

35. Tang, Y., Ramakrishnan, C., Thomas, J. and DeFranco, D.B. (1997) A role for HDJ-2/HSDJ in correcting subnuclear trafficking, transactivation and transrepression defects of a glucocorticoid receptor zinc finger mutant. Mol. Biol. Cell, 8, 795-809. MEDLINE Abstract

36. Xiao, N. and DeFranco, D.B.(1997) Overexpression of unliganded steroid receptors activates endogenous heat shock factor. Mol. Endocrinol., 11, 1365-1374. MEDLINE Abstract

37. Hendrick, J.P. and Hartl, F.U. (1995) The role of molecular chaperones in protein folding. FASEB J., 9, 1559-1569. MEDLINE Abstract

38. Hartl, F.U. (1996) Molecular chaperones in cellular protein folding. Nature, 381, 571-579. MEDLINE Abstract

39. Lu, Z. and Cyr, D.M. (1998) The conserved carboxyl terminus and zinc finger-like domain of the co-chaperone Ydj1 assist Hsp70 in protein folding. J. Biol. Chem., 273, 5970-5978. MEDLINE Abstract

40. Kumar, S., Yoshida, Y. and Noda, M. (1993) Cloning of a cDNA which encodes a novel ubiquitin-like protein. Biochem. Biophys. Res. Commun., 195, 393-399.

41. Kamitani, T., Kito, K., Nguyen, H.P. and Yeh, E.T. (1997) Characterization of NEDD8, a developmentally down-regulated ubiquitin-like protein. J. Biol. Chem., 272, 28557-28562. MEDLINE Abstract

42. Nawaz, Z., Lonard, D.M., Smith, C.L., Lev-Lehman, E., Tsai, S.Y., Tsai, M.J. and O'Malley, B.W. (1999) The Angelman syndrome-associated protein, E6-AP, is a coactivator for the nuclear hormone receptor superfamily. Mol. Cell Biol., 19, 1182-1189. MEDLINE Abstract

43. Hershko, A. and Ciechanover, A. (1992) The ubiquitin system for protein degradation. Annu. Rev. Biochem., 61, 761-807. MEDLINE Abstract

44. Hochstrasser, M. (1995) Ubiquitin, proteasomes and the regulation of intracellular protein degradation. Curr. Opin. Cell Biol., 7, 215-223. MEDLINE Abstract

45. Hochstrasser, M. (1996) Ubiquitin-dependent protein degradation. Annu. Rev. Genet., 30, 405-439. MEDLINE Abstract

46. Yoshimura, T., Kameyama, K., Takagi, T., Ikai, A., Tokunaga, F., Koide, T., Tanahashi, N., Tamura, T., Cejka, Z., Baumeister, W., Tanaka, K. and Ichihara, A. (1993) Molecular characterization of the `26S' proteasome complex from rat liver. J. Struct. Biol., 111, 200-211. MEDLINE Abstract

47. Peters, J.M. (1994) Proteasomes: protein degradation machines of the cell. Trends Biochem. Sci., 19, 377-382. MEDLINE Abstract

48. Coux, O., Tanaka, K. and Goldberg, A.L. (1996) Structure and function of the 20S and 26S proteasomes. Annu. Rev. Biochem., 65, 801-847. MEDLINE Abstract

49. Adams, G.M., Falke, S., Goldberg, A.L., Slaughter, C.A., DeMartino, G.N. and Gogol, E.P. (1997) Structural and functional effects of PA700 and modulator protein on proteasomes. J. Mol. Biol., 273, 646-657. MEDLINE Abstract

50. Mhatre, A.N., Trifiro, M.A., Kaufman, M., Kazemi-Esfarjani, P., Figlewicz, D., Rouleau, G. and Pinsky, L. (1993) Reduced transcriptional regulatory competence of the androgen receptor in X-linked spinal and bulbar muscular atrophy. Nature Genet., 5, 184-188.

51. Jenster, G., de Ruiter, P.E., van der Korput, H.A., Kuiper, G.G., Trapman, J. and Brinkmann, A.O. (1994) Changes in the abundance of androgen receptor isotypes: effects of ligand treatment, glutamine-stretch variation and mutation of putative phosphorylation sites. Biochemistry, 33, 14064-14072.

52. Kazemi-Esfarjani, P., Trifiro, M.A. and Pinsky, L. (1995) Evidence for a repressive function of the long polyQ tract in the human androgen receptor: possible pathogenetic relevance for the (CAG)n-expanded neuronopathies. Hum. Mol. Genet., 4, 523-527.

53. Nakajima, H., Kimura, F., Nakagawa, T., Furutama, D., Shinoda, K., Shimizu, A. and Ohsawa, N. (1996) Transcriptional activation by the androgen receptor in X-linked spinal and bulbar muscular atrophy. J. Neurosci., 142, 12-16.

54. Welch, W.J. and Gambetti, P. (1998) Chaperoning brain diseases. Nature, 392, 23-24. MEDLINE Abstract

55. DebBurman, S.K., Raymond, G.J., Caughey, B. and Lindquist, S. (1997) Chaperone-supervised conversion of prion protein to its protease-resistant form. Proc. Natl Acad. Sci. USA, 94, 13938-13943. MEDLINE Abstract

56. Cyr, D.M., Langer, T. and Douglas, M.G. (1994) DnaJ-like proteins: molecular chaperones and specific regulators of Hsp70. Trends Biochem. Sci., 19, 176-181. MEDLINE Abstract

57. DeMartino, G.N., Moomaw, C.R., Zagnitko, O.P., Proske, R.J., Ma, C.P., Afendis, S.J., Swaffield, J.C. and Slaughter, C.A. (1994) PA700, an ATP-dependent activator of the 20S proteasome, is an ATPase containing multiple members of a nucleotide-binding protein family. J. Biol. Chem., 269, 20878-20884. MEDLINE Abstract

58. Zajac, J.D. and MacLean, H.E. (1998) Kennedy's disease: clinical aspects. In Wells, R.D. and Warren, S.T. (eds), Genetic Instabilities and Hereditary Neurological Diseases. Academic Press, San Diego, CA, pp. 87-100.

59. Brooks, B.P., Merry, D.E., Paulson, H.L., Lieberman, A.P., Kolson, D.L. and Fischbeck, K.H. (1998) A cell culture model for androgen effects in motor neurons. J. Neurochem., 70, 1054-1060.

60. Tilley, W.D., Marcelli, M., Wilson, J.D. and McPhaul, J.M. (1989) Characterization and cloning of a cDNA encoding the human androgen receptor. Proc. Natl Acad. Sci. USA, 86, 327-331. MEDLINE Abstract

61. Gao, T., Marcelli, M. and McPhaul, M. (1996) Transcriptional activation and transient expression of the human androgen receptor. J. Steroid Biochem. Mol. Biol., 59, 9-20. MEDLINE Abstract

62. McGuire, M.J., Croall, D.E. and DeMartino, G.N. (1988) ATP-stimulated proteolysis in soluble extracts of BHK 21/C13 cells. Evidence for multiple pathways and a role for an enzyme related to the high-molecular weight protease, macropain. Arch. Biochem. Biophys., 262, 273-285. MEDLINE Abstract

63. Ma, C.P., Willy, P.J., Slaughter, C.A. and DeMartino, G.N. (1993) PA28, an activator of the 20S proteasome, is inactivated by proteolytic modification at its carboxyl terminus. J. Biol. Chem., 268, 22514-22519. MEDLINE Abstract

64. Agard, D.A. (1984) Optical sectioning microscopy: cellular architecture in three dimensions. Annu. Rev. Biophys. Bioeng., 13, 191-219. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +1 713 798 8952; Fax: +1 713 790 0545; Email: mancini@bcm.tmc.edu

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification: 8 Apr 1999
Copyright©Oxford University Press, 1999.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
T. Fishman-Jacob, L. Reznichenko, M. B. H. Youdim, and S. A. Mandel
A Sporadic Parkinson Disease Model via Silencing of the Ubiquitin-Proteasome/E3 Ligase Component SKP1A
J. Biol. Chem., November 20, 2009; 284(47): 32835 - 32845.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
H. L. Montie, M. S. Cho, L. Holder, Y. Liu, A. S. Tsvetkov, S. Finkbeiner, and D. E. Merry
Cytoplasmic retention of polyglutamine-expanded androgen receptor ameliorates disease via autophagy in a mouse model of spinal and bulbar muscular atrophy
Hum. Mol. Genet., June 1, 2009; 18(11): 1937 - 1950.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M.-J. Miron, P. Blanchette, P. Groitl, F. Dallaire, J. G. Teodoro, S. Li, T. Dobner, and P. E. Branton
Localization and Importance of the Adenovirus E4orf4 Protein during Lytic Infection
J. Virol., February 15, 2009; 83(4): 1689 - 1699.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
F. Yang, D. G. Camp II, M. A. Gritsenko, Q. Luo, R. T. Kelly, T. R. W. Clauss, W. R. Brinkley, R. D. Smith, and D. L. Stenoien
Identification of a novel mitotic phosphorylation motif associated with protein localization to the mitotic apparatus
J. Cell Sci., November 15, 2007; 120(22): 4060 - 4070.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
D. L. Stenoien, T. V. Knyushko, M. P. Londono, L. K. Opresko, M. U. Mayer, S. T. Brady, T. C. Squier, and D. J. Bigelow
Cellular trafficking of phospholamban and formation of functional sarcoplasmic reticulum during myocyte differentiation
Am J Physiol Cell Physiol, June 1, 2007; 292(6): C2084 - C2094.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
H. Adachi, M. Waza, K. Tokui, M. Katsuno, M. Minamiyama, F. Tanaka, M. Doyu, and G. Sobue
CHIP Overexpression Reduces Mutant Androgen Receptor Protein and Ameliorates Phenotypes of the Spinal and Bulbar Muscular Atrophy Transgenic Mouse Model
J. Neurosci., May 9, 2007; 27(19): 5115 - 5126.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. L. H. Miller, E. L. Scappini, and J. O'Bryan
Ubiquitin-interacting Motifs Inhibit Aggregation of PolyQ-expanded Huntingtin
J. Biol. Chem., March 30, 2007; 282(13): 10096 - 10103.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Goswami, P. Dikshit, A. Mishra, N. Nukina, and N. R. Jana
Expression of Expanded Polyglutamine Proteins Suppresses the Activation of Transcription Factor NF{kappa}B
J. Biol. Chem., December 1, 2006; 281(48): 37017 - 37024.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. J. Chia, E. Subbian, T. M. Buck, V. Hwa, R. G. Rosenfeld, W. R. Skach, U. Shinde, and P. Rotwein
Aberrant Folding of a Mutant Stat5b Causes Growth Hormone Insensitivity and Proteasomal Dysfunction
J. Biol. Chem., March 10, 2006; 281(10): 6552 - 6558.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
D. Gioeli, B. E. Black, V. Gordon, A. Spencer, C. T. Kesler, S. T. Eblen, B. M. Paschal, and M. J. Weber
Stress Kinase Signaling Regulates Androgen Receptor Phosphorylation, Transcription, and Localization
Mol. Endocrinol., March 1, 2006; 20(3): 503 - 515.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Matsumoto, S. Kim, and R. I. Morimoto
Huntingtin and Mutant SOD1 Form Aggregate Structures with Distinct Molecular Properties in Human Cells
J. Biol. Chem., February 17, 2006; 281(7): 4477 - 4485.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
Z. Berger, J. E. Davies, S. Luo, M. Y. Pasco, I. Majoul, C. J. O'Kane, and D. C. Rubinsztein
Deleterious and protective properties of an aggregate-prone protein with a polyalanine expansion
Hum. Mol. Genet., February 1, 2006; 15(3): 453 - 465.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
Z. Yu, N. Dadgar, M. Albertelli, A. Scheller, R. L. Albin, D. M. Robins, and A. P. Lieberman
Abnormalities of Germ Cell Maturation and Sertoli Cell Cytoskeleton in Androgen Receptor 113 CAG Knock-In Mice Reveal Toxic Effects of the Mutant Protein
Am. J. Pathol., January 1, 2006; 168(1): 195 - 204.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
H. Kawate, Y. Wu, K. Ohnaka, R.-H. Tao, K.-i. Nakamura, T. Okabe, T. Yanase, H. Nawata, and R. Takayanagi
Impaired Nuclear Translocation, Nuclear Matrix Targeting, and Intranuclear Mobility of Mutant Androgen Receptors Carrying Amino Acid Substitutions in the Deoxyribonucleic Acid-Binding Domain Derived from Androgen Insensitivity Syndrome Patients
J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6162 - 6169.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Fujimoto, E. Takaki, T. Hayashi, Y. Kitaura, Y. Tanaka, S. Inouye, and A. Nakai
Active HSF1 Significantly Suppresses Polyglutamine Aggregate Formation in Cellular and Mouse Models
J. Biol. Chem., October 14, 2005; 280(41): 34908 - 34916.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
L. Fu, Y.-s. Gao, A. Tousson, A. Shah, T.-L. L. Chen, B. M. Vertel, and E. Sztul
Nuclear Aggresomes Form by Fusion of PML-associated Aggregates
Mol. Biol. Cell, October 1, 2005; 16(10): 4905 - 4917.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
P. Farla, R. Hersmus, J. Trapman, and A. B. Houtsmuller
Antiandrogens prevent stable DNA-binding of the androgen receptor
J. Cell Sci., September 15, 2005; 118(18): 4187 - 4198.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
K. Iijima-Ando, P. Wu, E. A. Drier, K. Iijima, and J. C. P. Yin
cAMP-response element-binding protein and heat-shock protein 70 additively suppress polyglutamine-mediated toxicity in Drosophila
PNAS, July 19, 2005; 102(29): 10261 - 10266.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
S. Carra, M. Sivilotti, A. T. Chavez Zobel, H. Lambert, and J. Landry
HspB8, a small heat shock protein mutated in human neuromuscular disorders, has in vivo chaperone activity in cultured cells
Hum. Mol. Genet., June 15, 2005; 14(12): 1659 - 1669.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. R. Jana, P. Dikshit, A. Goswami, S. Kotliarova, S. Murata, K. Tanaka, and N. Nukina
Co-chaperone CHIP Associates with Expanded Polyglutamine Protein and Promotes Their Degradation by Proteasomes
J. Biol. Chem., March 25, 2005; 280(12): 11635 - 11640.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
B. G. Burnett and R. N. Pittman
The polyglutamine neurodegenerative protein ataxin 3 regulates aggresome formation
PNAS, March 22, 2005; 102(12): 4330 - 4335.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. B. Bowman, S.-Y. Yoo, N. P. Dantuma, and H. Y. Zoghbi
Neuronal dysfunction in a polyglutamine disease model occurs in the absence of ubiquitin-proteasome system impairment and inversely correlates with the degree of nuclear inclusion formation
Hum. Mol. Genet., March 1, 2005; 14(5): 679 - 691.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Helmlinger, J. Bonnet, J.-L. Mandel, Y. Trottier, and D. Devys
Hsp70 and Hsp40 Chaperones Do Not Modulate Retinal Phenotype in SCA7 Mice
J. Biol. Chem., December 31, 2004; 279(53): 55969 - 55977.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
I. M. Nasrallah, J. C. Minarcik, and J. A. Golden
A polyalanine tract expansion in Arx forms intranuclear inclusions and results in increased cell death
J. Cell Biol., November 8, 2004; 167(3): 411 - 416.
[Abstract] [Full Text] [PDF]

Home page
 BrainHome page
C. M. Everett and N. W. Wood
Trinucleotide repeats and neurodegenerative disease
Brain, November 1, 2004; 127(11): 2385 - 2405.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S. Verma, A. Ismail, X. Gao, G. Fu, X. Li, B. W. O'Malley, and Z. Nawaz
The Ubiquitin-Conjugating Enzyme UBCH7 Acts as a Coactivator for Steroid Hormone Receptors
Mol. Cell. Biol., October 1, 2004; 24(19): 8716 - 8726.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
G. Buchanan, M. Yang, A. Cheong, J. M. Harris, R. A. Irvine, P. F. Lambert, N. L. Moore, M. Raynor, P. J. Neufing, G. A. Coetzee, et al.
Structural and functional consequences of glutamine tract variation in the androgen receptor
Hum. Mol. Genet., August 15, 2004; 13(16): 1677 - 1692.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Biol.Home page
R. G. Giffard, L. Xu, H. Zhao, W. Carrico, Y. Ouyang, Y. Qiao, R. Sapolsky, G. Steinberg, B. Hu, and M. A. Yenari
Chaperones, protein aggregation, and brain protection from hypoxic/ischemic injury
J. Exp. Biol., August 15, 2004; 207(18): 3213 - 3220.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
D. G. Hay, K. Sathasivam, S. Tobaben, B. Stahl, M. Marber, R. Mestril, A. Mahal, D. L. Smith, B. Woodman, and G. P. Bates
Progressive decrease in chaperone protein levels in a mouse model of Huntington's disease and induction of stress proteins as a therapeutic approach
Hum. Mol. Genet., July 1, 2004; 13(13): 1389 - 1405.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
E. S. Chevalier-Larsen, C. J. O'Brien, H. Wang, S. C. Jenkins, L. Holder, A. P. Lieberman, and D. E. Merry
Castration Restores Function and Neurofilament Alterations of Aged Symptomatic Males in a Transgenic Mouse Model of Spinal and Bulbar Muscular Atrophy
J. Neurosci., May 19, 2004; 24(20): 4778 - 4786.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S. Dong, D. L. Stenoien, J. Qiu, M. A. Mancini, and D. J. Tweardy
Reduced Intranuclear Mobility of APL Fusion Proteins Accompanies Their Mislocalization and Results in Sequestration and Decreased Mobility of Retinoid X Receptor {alpha}
Mol. Cell. Biol., May 15, 2004; 24(10): 4465 - 4475.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
Z. Nawaz and B. W. O'Malley
Urban Renewal in the Nucleus: Is Protein Turnover by Proteasomes Absolutely Required for Nuclear Receptor-Regulated Transcription?
Mol. Endocrinol., March 1, 2004; 18(3): 493 - 499.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. L. Sugars, R. Brown, L. J. Cook, J. Swartz, and D. C. Rubinsztein
Decreased cAMP Response Element-mediated Transcription: AN EARLY EVENT IN EXON 1 AND FULL-LENGTH CELL MODELS OF HUNTINGTON'S DISEASE THAT CONTRIBUTES TO POLYGLUTAMINE PATHOGENESIS
J. Biol. Chem., February 6, 2004; 279(6): 4988 - 4999.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
Y P Bao, S Sarkar, E Uyama, and D C Rubinsztein
Congo red, doxycycline, and HSP70 overexpression reduce aggregate formation and cell death in cell models of oculopharyngeal muscular dystrophy
J. Med. Genet., January 1, 2004; 41(1): 47 - 51.
[Full Text] [PDF]

Home page
 J. Neurosci.Home page
M. Diaz-Hernandez, F. Hernandez, E. Martin-Aparicio, P. Gomez-Ramos, M. A. Moran, J. G. Castano, I. Ferrer, J. Avila, and J. J. Lucas
Neuronal Induction of the Immunoproteasome in Huntington's Disease
J. Neurosci., December 17, 2003; 23(37): 11653 - 11661.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. F. Winklhofer, I. H. Henn, P. C. Kay-Jackson, U. Heller, and J. Tatzelt
Inactivation of Parkin by Oxidative Stress and C-terminal Truncations: A PROTECTIVE ROLE OF MOLECULAR CHAPERONES
J. Biol. Chem., November 21, 2003; 278(47): 47199 - 47208.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. Abu-Baker, C. Messaed, J. Laganiere, C. Gaspar, B. Brais, and G. A. Rouleau
Involvement of the ubiquitin-proteasome pathway and molecular chaperones in oculopharyngeal muscular dystrophy
Hum. Mol. Genet., October 16, 2003; 12(20): 2609 - 2623.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. Michalik and C. Van Broeckhoven
Pathogenesis of polyglutamine disorders: aggregation revisited
Hum. Mol. Genet., October 15, 2003; 12(90002): R173 - 186.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C. E. Petre-Draviam, S. L. Cook, C. J. Burd, T. W. Marshall, Y. B. Wetherill, and K. E. Knudsen
Specificity of Cyclin D1 for Androgen Receptor Regulation
Cancer Res., August 15, 2003; 63(16): 4903 - 4913.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
D. P. Huynh, H.-T. Yang, H. Vakharia, D. Nguyen, and S. M. Pulst
Expansion of the polyQ repeat in ataxin-2 alters its Golgi localization, disrupts the Golgi complex and causes cell death
Hum. Mol. Genet., July 1, 2003; 12(13): 1485 - 1496.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
L. M. Mandrusiak, L. K. Beitel, X. Wang, T. C. Scanlon, E. Chevalier-Larsen, D. E. Merry, and M. A. Trifiro
Transglutaminase potentiates ligand-dependent proteasome dysfunction induced by polyglutamine-expanded androgen receptor
Hum. Mol. Genet., July 1, 2003; 12(13): 1497 - 1506.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
F. Yan, X. Gao, D. M. Lonard, and Z. Nawaz
Specific Ubiquitin-Conjugating Enzymes Promote Degradation of Specific Nuclear Receptor Coactivators
Mol. Endocrinol., July 1, 2003; 17(7): 1315 - 1331.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Ishihara, N. Yamagishi, Y. Saito, H. Adachi, Y. Kobayashi, G. Sobue, K. Ohtsuka, and T. Hatayama
Hsp105{alpha} Suppresses the Aggregation of Truncated Androgen Receptor with Expanded CAG Repeats and Cell Toxicity
J. Biol. Chem., June 27, 2003; 278(27): 25143 - 25150.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
K.J. Cowan, M.I. Diamond, and W.J. Welch
Polyglutamine protein aggregation and toxicity are linked to the cellular stress response
Hum. Mol. Genet., June 15, 2003; 12(12): 1377 - 1391.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
T. Okuda, H. Hattori, S. Takeuchi, J. Shimizu, H. Ueda, J. J. Palvimo, I. Kanazawa, H. Kawano, M. Nakagawa, and H. Okazawa
PQBP-1 transgenic mice show a late-onset motor neuron disease-like phenotype
Hum. Mol. Genet., April 1, 2003; 12(7): 711 - 725.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
H. Adachi, M. Katsuno, M. Minamiyama, C. Sang, G. Pagoulatos, C. Angelidis, M. Kusakabe, A. Yoshiki, Y. Kobayashi, M. Doyu, et al.
Heat Shock Protein 70 Chaperone Overexpression Ameliorates Phenotypes of the Spinal and Bulbar Muscular Atrophy Transgenic Mouse Model by Reducing Nuclear-Localized Mutant Androgen Receptor Protein
J. Neurosci., March 15, 2003; 23(6): 2203 - 2211.
[Abstract] [Full Text] [PDF]

Home page
 J AndrolHome page
D. J. Lamb, E. Puxeddu, N. Malik, D. L. Stenoien, R. Nigam, G. Y. Saleh, M. Mancini, N. L. Weigel, and M. Marcelli
Molecular Analysis of the Androgen Receptor in Ten Prostate Cancer Specimens Obtained Before and After Androgen Ablation
J Androl, March 1, 2003; 24(2): 215 - 225.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
M. Fan, R. M. Bigsby, and K. P. Nephew
The NEDD8 Pathway Is Required for Proteasome-Mediated Degradation of Human Estrogen Receptor (ER)-{alpha} and Essential for the Antiproliferative Activity of ICI 182,780 in ER{alpha}-Positive Breast Cancer Cells
Mol. Endocrinol., March 1, 2003; 17(3): 356 - 365.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
H. Jiang, F. C. Nucifora Jr, C. A. Ross, and D. B. DeFranco
Cell death triggered by polyglutamine-expanded huntingtin in a neuronal cell line is associated with degradation of CREB-binding protein
Hum. Mol. Genet., January 1, 2003; 12(1): 1 - 12.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
P. W. Faber, C. Voisine, D. C. King, E. A. Bates, and A. C. Hart
Glutamine/proline-rich PQE-1 proteins protect Caenorhabditis elegans neurons from huntingtin polyglutamine neurotoxicity
PNAS, December 24, 2002; 99(26): 17131 - 17136.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. L. Walcott and D. E. Merry
Ligand Promotes Intranuclear Inclusions in a Novel Cell Model of Spinal and Bulbar Muscular Atrophy
J. Biol. Chem., December 20, 2002; 277(52): 50855 - 50859.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
H.Y. E. Chan, J. M. Warrick, I. Andriola, D. Merry, and N. M. Bonini
Genetic modulation of polyglutamine toxicity by protein conjugation pathways in Drosophila
Hum. Mol. Genet., November 1, 2002; 11(23): 2895 - 2904.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
K. Mitsui, H. Nakayama, T. Akagi, M. Nekooki, K. Ohtawa, K. Takio, T. Hashikawa, and N. Nukina
Purification of Polyglutamine Aggregates and Identification of Elongation Factor-1alpha and Heat Shock Protein 84 as Aggregate-Interacting Proteins
J. Neurosci., November 1, 2002; 22(21): 9267 - 9277.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. I. Milewski, J. E. Mickle, J. K. Forrest, B. A. Stanton, and G. R. Cutting
Aggregation of Misfolded Proteins Can Be a Selective Process Dependent upon Peptide Composition
J. Biol. Chem., September 6, 2002; 277(37): 34462 - 34470.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. P. Lieberman, G. Harmison, A. D. Strand, J. M. Olson, and K. H. Fischbeck
Altered transcriptional regulation in cells expressing the expanded polyglutamine androgen receptor
Hum. Mol. Genet., August 15, 2002; 11(17): 1967 - 1976.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
S. Dejager, H. Bry-Gauillard, E. Bruckert, B. Eymard, F. Salachas, E. LeGuern, S. Tardieu, R. Chadarevian, P. Giral, and G. Turpin
A Comprehensive Endocrine Description of Kennedy's Disease Revealing Androgen Insensitivity Linked to CAG Repeat Length
J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3893 - 3901.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
Y. Chai, J. Shao, V. M. Miller, A. Williams, and H. L. Paulson
Live-cell imaging reveals divergent intracellular dynamics of polyglutamine disease proteins and supports a sequestration model of pathogenesis
PNAS, July 9, 2002; 99(14): 9310 - 9315.
[Abstract] [Full Text] [PDF]

Home page
 BrainHome page
J. Takahashi, H. Fujigasaki, C. Zander, K. H. El Hachimi, G. Stevanin, A. Durr, A.-S. Lebre, G. Yvert, Y. Trottier, H. d. The, et al.
Two populations of neuronal intranuclear inclusions in SCA7 differ in size and promyelocytic leukaemia protein content
Brain, July 1, 2002; 125(7): 1534 - 1543.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
A. B. Meriin, X. Zhang, X. He, G. P. Newnam, Y. O. Chernoff, and M. Y. Sherman
Huntingtin toxicity in yeast model depends on polyglutamine aggregation mediated by a prion-like protein Rnq1
J. Cell Biol., June 10, 2002; 157(6): 997 - 1004.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
Y. L. Giwercman, A. Nordenskjold, E. M. Ritzen, K. O. Nilsson, S.-A. Ivarsson, U. Grandell, and A. Wedell
An Androgen Receptor Gene Mutation (E653K) in a Family with Congenital Adrenal Hyperplasia due to Steroid 21-Hydroxylase Deficiency as well as in Partial Androgen Insensitivity
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2623 - 2628.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. Wyttenbach, O. Sauvageot, J. Carmichael, C. Diaz-Latoud, A.-P. Arrigo, and D. C. Rubinsztein
Heat shock protein 27 prevents cellular polyglutamine toxicity and suppresses the increase of reactive oxygen species caused by huntingtin
Hum. Mol. Genet., May 1, 2002; 11(9): 1137 - 1151.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
Z.-Q. Huang, J. Li, and J. Wong
AR Possesses an Intrinsic Hormone-Independent Transcriptional Activity
Mol. Endocrinol., May 1, 2002; 16(5): 924 - 937.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
M. H. Glickman and A. Ciechanover
The Ubiquitin-Proteasome Proteolytic Pathway: Destruction for the Sake of Construction
Physiol Rev, April 1, 2002; 82(2): 373 - 428.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
C. K. Bailey, I. F. M. Andriola, H. H. Kampinga, and D. E. Merry
Molecular chaperones enhance the degradation of expanded polyglutamine repeat androgen receptor in a cellular model of spinal and bulbar muscular atrophy
Hum. Mol. Genet., March 1, 2002; 11(5): 515 - 523.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
E. Holter, N. Kotaja, S. Makela, L. Strauss, S. Kietz, O. A. Janne, J.-A. Gustafsson, J. J. Palvimo, and E. Treuter
Inhibition of Androgen Receptor (AR) Function by the Reproductive Orphan Nuclear Receptor DAX-1
Mol. Endocrinol., March 1, 2002; 16(3): 515 - 528.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Zhou, S.-H. Li, and X.-J. Li
Chaperone Suppression of Cellular Toxicity of Huntingtin Is Independent of Polyglutamine Aggregation
J. Biol. Chem., December 14, 2001; 276(51): 48417 - 48424.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
W. J. Welch and M. I. Diamond
Glucocorticoid modulation of androgen receptor nuclear aggregation and cellular toxicity is associated with distinct forms of soluble expanded polyglutamine protein
Hum. Mol. Genet., December 1, 2001; 10(26): 3063 - 3074.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
E. Martin-Aparicio, A. Yamamoto, F. Hernandez, R. Hen, J. Avila, and J. J. Lucas
Proteasomal-Dependent Aggregate Reversal and Absence of Cell Death in a Conditional Mouse Model of Huntington's Disease
J. Neurosci., November 15, 2001; 21(22): 8772 - 8781.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. Matilla, C. Gorbea, D. D. Einum, J. Townsend, A. Michalik, C. van Broeckhoven, C. C. Jensen, K. J. Murphy, L. J. Ptacek, and Y.-H. Fu
Association of ataxin-7 with the proteasome subunit S4 of the 19S regulatory complex
Hum. Mol. Genet., November 1, 2001; 10(24): 2821 - 2831.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. Wyttenbach, J. Swartz, H. Kita, T. Thykjaer, J. Carmichael, J. Bradley, R. Brown, M. Maxwell, A. Schapira, T. F. Orntoft, et al.
Polyglutamine expansions cause decreased CRE-mediated transcription and early gene expression changes prior to cell death in an inducible cell model of Huntington's disease
Hum. Mol. Genet., August 1, 2001; 10(17): 1829 - 1845.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Y. Giguere, E. Dewailly, J. Brisson, P. Ayotte, N. Laflamme, A. Demers, V.-I. Forest, S. Dodin, J. Robert, and F. Rousseau
Short Polyglutamine Tracts in the Androgen Receptor Are Protective against Breast Cancer in the General Population
Cancer Res., August 1, 2001; 61(15): 5869 - 5874.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
A. B. Meriin, K. Mabuchi, V. L. Gabai, J. A. Yaglom, A. Kazantsev, and M. Y. Sherman
Intracellular Aggregation of Polypeptides with Expanded Polyglutamine Domain Is Stimulated by Stress-Activated Kinase Mekk1
J. Cell Biol., May 14, 2001; 153(4): 851 - 864.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
H. Adachi, A. Kume, M. Li, Y. Nakagomi, H. Niwa, J. Do, C. Sang, Y. Kobayashi, M. Doyu, and G. Sobue
Transgenic mice with an expanded CAG repeat controlled by the human AR promoter show polyglutamine nuclear inclusions and neuronal dysfunction without neuronal cell death
Hum. Mol. Genet., May 1, 2001; 10(10): 1039 - 1048.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
N. R. Jana, E. A. Zemskov, G.-h. Wang, and N. Nukina
Altered proteasomal function due to the expression of polyglutamine-expanded truncated N-terminal huntingtin induces apoptosis by caspase activation through mitochondrial cytochrome c release
Hum. Mol. Genet., May 1, 2001; 10(10): 1049 - 1059.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A.-S. Lebre, L. Jamot, J. Takahashi, N. Spassky, C. Leprince, N. Ravise, C. Zander, H. Fujigasaki, P. Kussel-Andermann, C. Duyckaerts, et al.
Ataxin-7 interacts with a Cbl-associated protein that it recruits into neuronal intranuclear inclusions
Hum. Mol. Genet., May 1, 2001; 10(11): 1201 - 1213.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
S. Waelter, A. Boeddrich, R. Lurz, E. Scherzinger, G. Lueder, H. Lehrach, and E. E. Wanker
Accumulation of Mutant Huntingtin Fragments in Aggresome-like Inclusion Bodies as a Result of Insufficient Protein Degradation
Mol. Biol. Cell, May 1, 2001; 12(5): 1393 - 1407.
[Abstract] [Full Text]

Home page
 Genes Dev.Home page
H. T. Orr
Beyond the Qs in the polyglutamine diseases
Genes & Dev., April 15, 2001; 15(8): 925 - 932.
[Full Text]

Home page
 Hum Mol GenetHome page
H.Y. E. Chan, J. M. Warrick, G. L. Gray-Board, H. L. Paulson, and N. M. Bonini
Mechanisms of chaperone suppression of polyglutamine disease: selectivity, synergy and modulation of protein solubility in Drosophila
Hum. Mol. Genet., November 1, 2000; 9(19): 2811 - 2820.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
G. Yvert, K. S. Lindenberg, S. Picaud, G. B. Landwehrmeyer, J.-A. Sahel, and J.-L. Mandel
Expanded polyglutamines induce neurodegeneration and trans-neuronal alterations in cerebellum and retina of SCA7 transgenic mice
Hum. Mol. Genet., October 1, 2000; 9(17): 2491 - 2506.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. McCampbell, J. P. Taylor, A. A. Taye, J. Robitschek, M. Li, J. Walcott, D. Merry, Y. Chai, H. Paulson, G. Sobue, et al.
CREB-binding protein sequestration by expanded polyglutamine
Hum. Mol. Genet., September 1, 2000; 9(14): 2197 - 2202.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
A. Calado, F. M.S. Tome, B. Brais, G.A. Rouleau, U. Kuhn, E. Wahle, and M. Carmo-Fonseca
Nuclear inclusions in oculopharyngeal muscular dystrophy consist of poly(A) binding protein 2 aggregates which sequester poly(A) RNA
Hum. Mol. Genet., September 1, 2000; 9(15): 2321 - 2328.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
N. R. Jana, M. Tanaka, G.-h. Wang, and N. Nukina
Polyglutamine length-dependent interaction of Hsp40 and Hsp70 family chaperones with truncated N-terminal huntingtin: their role in suppression of aggregation and cellular toxicity
Hum. Mol. Genet., August 12, 2000; 9(13): 2009 - 2018.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
M. Becker, E. Martin, J. Schneikert, H. F. Krug, and A. C.B. Cato
Cytoplasmic Localization and the Choice of Ligand Determine Aggregate Formation by Androgen Receptor with Amplified Polyglutamine Stretch
J. Cell Biol., April 17, 2000; 149(2): 255 - 262.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
C. J. Cummings and H. Y. Zoghbi
Fourteen and counting: unraveling trinucleotide repeat diseases
Hum. Mol. Genet., April 1, 2000; 9(6): 909 - 916.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
H.N. Lim, H. Chen, S. McBride, A.M. Dunning, R.M. Nixon, I.A. Hughes, and J.R. Hawkins
Longer polyglutamine tracts in the androgen receptor are associated with moderate to severe undermasculinized genitalia in XY males
Hum. Mol. Genet., March 22, 2000; 9(5): 829 - 834.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Kobayashi, A. Kume, M. Li, M. Doyu, M. Hata, K. Ohtsuka, and G. Sobue
Chaperones Hsp70 and Hsp40 Suppress Aggregate Formation and Apoptosis in Cultured Neuronal Cells Expressing Truncated Androgen Receptor Protein with Expanded Polyglutamine Tract
J. Biol. Chem., March 17, 2000; 275(12): 8772 - 8778.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
A. Wyttenbach, J. Carmichael, J. Swartz, R. A. Furlong, Y. Narain, J. Rankin, and D. C. Rubinsztein
Effects of heat shock, heat shock protein 40 (HDJ-2), and proteasome inhibition on protein aggregation in cellular models of Huntington's disease
PNAS, March 14, 2000; 97(6): 2898 - 2903.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
P. Kazemi-Esfarjani and S. Benzer
Genetic Suppression of Polyglutamine Toxicity in Drosophila
Science, March 10, 2000; 287(5459): 1837 - 1840.
[Abstract] [Full Text]

Home page
 J. Appl. Physiol.Home page
G. A. Ordway, P. D. Neufer, E. R. Chin, and G. N. DeMartino
Chronic contractile activity upregulates the proteasome system in rabbit skeletal muscle
J Appl Physiol, March 1, 2000; 88(3): 1134 - 1141.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. Krobitsch and S. Lindquist
Aggregation of huntingtin in yeast varies with the length of the polyglutamine expansion and the expression of chaperone proteins
PNAS, February 15, 2000; 97(4): 1589 - 1594.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
R. A. Irvine, H. Ma, M. C. Yu, R. K. Ross, M. R. Stallcup, and G. A. Coetzee
Inhibition of p160-mediated coactivation with increasing androgen receptor polyglutamine length
Hum. Mol. Genet., January 22, 2000; 9(2): 267 - 274.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
Z Dastoor and J Dreyer
Nuclear translocation and aggregate formation of heat shock cognate protein 70 (Hsc70) in oxidative stress and apoptosis
J. Cell Sci., January 8, 2000; 113(16): 2845 - 2854.
[Abstract] [PDF]

Home page
 Hum Mol GenetHome page
S. Simeoni, M. A. Mancini, D. L. Stenoien, M. Marcelli, N. L. Weigel, M. Zanisi, L. Martini, and A. Poletti
Motoneuronal cell death is not correlated with aggregate formation of androgen receptors containing an elongated polyglutamine tract
Hum. Mol. Genet., January 1, 2000; 9(1): 133 - 144.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. D. Kaytor and S. T. Warren
Aberrant Protein Deposition and Neurological Disease
J. Biol. Chem., December 31, 1999; 274(53): 37507 - 37510.
[Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
L. V. Nazareth, D. L. Stenoien, W. E. Bingman III, A. J. James, C. Wu, Y. Zhang, D. P. Edwards, M. Mancini, M. Marcelli, D. J. Lamb, et al.
A C619Y Mutation in the Human Androgen Receptor Causes Inactivation and Mislocalization of the Receptor with Concomitant Sequestration of SRC-1 (Steroid Receptor Coactivator 1)
Mol. Endocrinol., December 1, 1999; 13(12): 2065 - 2075.
[Abstract] [Full Text]

Home page
 J. Neurosci.Home page
Y. Chai, S. L. Koppenhafer, N. M. Bonini, and H. L. Paulson
Analysis of the Role of Heat Shock Protein (Hsp) Molecular Chaperones in Polyglutamine Disease
J. Neurosci., December 1, 1999; 19(23): 10338 - 10347.
[Abstract] [Full Text] [PDF]

Home page
 Arch NeurolHome page
I. Linfante and T. Ashizawa
Proton Magnetic Resonance Spectroscopy: An In Vivo Window to Study Neurodegenerative Disorders
Arch Neurol, December 1, 1999; 56(12): 1446 - 1447.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Terada and M. Mori
Human DnaJ Homologs dj2 and dj3, and bag-1 Are Positive Cochaperones of hsc70
J. Biol. Chem., August 4, 2000; 275(32): 24728 - 24734.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. A. Shinder, M.-C. Lacourse, S. Minotti, and H. D. Durham
Mutant Cu/Zn-Superoxide Dismutase Proteins Have Altered Solubility and Interact with Heat Shock/Stress Proteins in Models of Amyotrophic Lateral Sclerosis
J. Biol. Chem., April 13, 2001; 276(16): 12791 - 12796.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. H. Satyal, E. Schmidt, K. Kitagawa, N. Sondheimer, S. Lindquist, J. M. Kramer, and R. I. Morimoto
Polyglutamine aggregates alter protein folding homeostasis in Caenorhabditis elegans
PNAS, May 23, 2000; 97(11): 5750 - 5755.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (250)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Stenoien, D. L.
Right arrow Articles by Mancini, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stenoien, D. L.
Right arrow Articles by Mancini, M. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?