Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Inoue, N.
Right arrow Articles by Zinn, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inoue, N.
Right arrow Articles by Zinn, A. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

New gene family defined by MORC, a nuclear protein required for mouse spermatogenesis
Human Molecular Genetics Pages 1201-1207 ©1999 Oxford University Press


New gene family defined by MORC, a nuclear protein required for mouse spermatogenesis
Introduction
Results
   Positional cloning of Morc
   Morc expression is altered in homozygous mutant mice
   Morc defines a novel gene family
   MORC is a nuclear protein
   Morc is expressed in germ cells
Discussion
Materials And Methods
   cDNA cloning and sequencing
   Expression assays
   Protein alignments
   Protein immunolocalization
Acknowledgements
Note Added In Proof
References


New gene family defined by MORC, a nuclear protein required for mouse spermatogenesis

Norimitsu Inoue1, Karl D. Hess2, *, Randall W. Moreadith3, +, Laura L. Richardson4, Mary Ann Handel4, Mark L. Watson1, §, Andrew R. Zinn1, 3, §,, ¶

1Eugene McDermott Center for Human Growth and Development, 2Department of Pathology and 3Department of Internal Medicine, University of Texas Southwestern Medical School, 6000 Harry Hines Boulevard, Dallas, TX 75235, USA and 4Department of Biochemistry and Cellular and Molecular Biology, University of Tennessee, Knoxville, TN 37996, USA

Received January 26, 1999; Revised and Accepted April 9, 1999

DDBJ/EMBL/GenBank accession nos AF084945, AF084946

Mammalian spermatogenesis is a complex developmental process. The analysis of mouse mutations has provided insight into biochemical pathways required for completion of this process. We previously described the autosomal recessive mouse morcTgN(Tyr)1Az (microrchidia) mutation, a serendipitous transgenic insertional mutation which causes arrest of spermatogenesis prior to the pachytene stage of meiosis prophase I. We now report the molecular characterization of the morc locus and positional cloning of a gene disrupted by the morcTgN(Tyr)1Az mutation. This gene, which we term Morc, encodes a 108 kDa protein expressed specifically in male germ cells. The transgene integrated within the first intron of Morc and was accompanied by an intragenic deletion of ~13 kb of genomic sequences, removing exons 2-4 and abrogating expression of the wild-type transcript. Analysis of the MORC protein sequence revealed putative nuclear localization signals, two predicted coiled-coil structural motifs and limited homology to GHL (GyraseB, Hsp90, MutL) ATPase. Epitope-tagged MORC protein expressed in COS7 cells localized to the nucleus. We also cloned the human MORC homolog and show that it too is testis-specific, but closely related human genes are transcribed in multiple somatic tissues. Homologous proteins are also present in zebrafish, nematodes, slime mold and plants. Thus, cloning of Morc defines a novel gene family whose members are likely to serve important biological functions in both meiotic and mitotic cells of multicellular organisms.

INTRODUCTION

Mammalian spermatogenesis is a complex and highly regulated developmental process that can be divided into three phases: mitotic proliferation and renewal of spermatogonia, meiotic reduction division of spermatocytes and cellular differentiation of haploid spermatids into mature sperm. Prophase of the first meiotic division is protracted: the pachytene stage alone lasts 11 days in mice (1). During this time, homologous chromosomes pair and recombine. Attesting to the complexity of this process, a variety of gene products are necessary for its execution, as illustrated by several mutations that arrest spermatogenesis at or before the pachytene stage. These include targeted inactivation of heat shock protein Hsp70-2 (2), DNA mismatch repair enzyme Mlh1 (3,4) and transcription factor A-myb (5).

While mutations induced by homologous recombination have provided important insights into the regulation of spermatogenesis (6), such experiments necessarily involve genes that have been characterized previously. Spontaneous mouse mutations affecting spermatogenesis (1) could implicate unknown or unsuspected genes, but identifying these genes by positional cloning is difficult.

In contrast, transgene-induced insertional mutations are amenable to positional cloning, since the transgenic sequence provides a molecular `handle' for isolating the genomic locus (7). We previously described one such insertional mutation, morcTgN(Tyr)1Az, whose recessive phenotype is characterized by a male-specific sterility. Germ cells in homozygous males appear to reach the gonad and proliferate normally but fail to progress beyond the zygotene stage of meiosis I and instead undergo apoptosis. Adults show progressive loss of spermatogonia, resulting in a Sertoli cell-only phenotype by 6 months of age (8). We now describe the gene disrupted in morc mutant mice. The gene we identified, Morc, encodes a novel ~108 kDa nuclear protein and is expressed specifically in male germ cells. Morc also defines a new eukaryotic gene family with phylogenetically diverse members. Expression of some of these family members is not restricted to testis, suggesting that the function of Morc in spermatogenesis is related to a more general biological process. Further studies of Morc should provide insight into the regulation of mammalian meiosis, with potential implications for human reproductive health.

RESULTS

Positional cloning of Morc

We previously described the morc (microrchidia) transgenic insertional mutation (8). Isolation of P1 genomic clones containing the Morc locus demonstrated that sequences adjacent to the transgene integration site were deleted in mutant mice (8). To better define the deletion and identify potential coding sequences, we constructed a physical map of the region using one P1 clone (Fig. 1A). We then subcloned and partially sequenced restriction fragments encompassing 21 kb of genomic sequence surrounding the transgene integration site. Southern blotting and PCR analyses revealed that the deletion spanned ~13 kb (data not shown). Database searches with the sequence data did not identify any candidate genes.


Figure 1. (A) Physical map of the morc locus. Exons not drawn to scale. Diagonal hatches denote genomic deletion. The gray box indicates region sequenced. The precise structure of the transgene has not been determined. RT-PCR results indicate that it contains sequences integrated in a head-to-head fashion (data not shown). H, HindIII; S, SalI; K, KpnI. (B) Schematic representation of hybridization probes and RT-PCR primers used in Figure 2.

We also performed exon trapping using the entire P1 clone. Nine different products were isolated and sequenced. Three were repetitive and none of the other six single copy sequences showed similarity to any known genes or expressed sequence tags (ESTs) in public databases. However, northern blot hybridization with one putative exon sequence detected an ~3 kb testis transcript. We used this 160 bp exon (Fig. 1A, exon 7) to screen a mouse testis cDNA library and isolated a single clone containing an ~900 bp insert. This clone also contained two other exon-trapping products (Fig. 1A, exons 2 and 3).

A mouse multiple-tissue northern blot probed with this cDNA demonstrated an ~3 kb transcript that was unique to testis (Fig. 2A). The level of expression was very low compared with a [beta]-actin control (a 10-fold shorter exposure of which is shown). Prolonged exposures revealed an additional ~2 kb testis transcript (see also Fig. 2B and E) whose relationship to the ~3 kb transcript has not yet been determined.


Figure 2. Analysis of Morc expression in wild-type (+/+) and heterozygous (+/-) or homozygous (-/-) mutant mice. (A) Multiple tissue northern blot demonstrating that mouse Morc is expressed specifically in testis. (B) Northern blots probed with exons 2-4 or with 3[prime] coding region sequences (Fig. 1B) demonstrated an aberrant transcript in +/- and -/- mice carrying the transgene. (C) The presence of this aberrant transcript and the absence of wild-type Morc mRNA in -/- testes was confirmed by RT-PCR with 5[prime] or 3[prime] primers (Fig. 1B). RT, reverse transcriptase. (D) Multiple tissue northern blots demonstrating that human MORC is also testis-specific. (E) Morc expression in enriched germ cell fractions from wild-type testes or in two mutant strains lacking male germ cells (at/at; XX,Sxr) was analyzed using the 3[prime] hybridization probe (Fig. 1B), demonstrating that Morc is expressed in germ cells but not in somatic cells.

We isolated a full-length mouse cDNA using 5[prime]- and 3[prime]-RACE. Alignment of overlapping products gave a 3050 bp cDNA, consistent with the ~3 kb transcript seen by northern blotting. Construction of a physical map of the Morc locus and inspection of genomic sequence data indicated that the P1 clone contains at least the first seven exons but not the 3[prime] end of this gene, which we termed Morc. We estimate that the complete gene spans >60 kb. Southern blotting and PCR analyses of DNA from homozygous mice revealed that exons 2-4 (Fig. 1A) were deleted by the transgene insertion (data not shown).

Morc expression is altered in homozygous mutant mice

To confirm that the morcTgN(Tyr)1Az mutation affected Morc expression, we examined transcripts in mutant mice by northern blotting. Hybridization with a 158 bp cDNA fragment containing only Morc exons 2-4 (Fig. 1B) indicated that the wild-type transcript was absent from testes of homozygotes (Fig. 2B). However, a 1.2 kb fragment from the 3[prime] region of the Morc cDNA (Fig. 1B) detected a transcript in homozygous testis that was similar in size to the wild-type Morc transcript (Fig. 2B).

RT-PCR experiments were performed to verify these northern blotting results (Figs 1B and 2C). A primer pair with one member from Morc exon 3 failed to amplify any transcript from homozygous testes (Fig. 2C, 5[prime]). In contrast, a primer pair containing sequences 3[prime] to the deleted exons 2-4 gave RT-PCR products with testis RNA from mice of all three genotypes (Fig. 2C, 3[prime]). These data confirmed the absence of the wild-type Morc mRNA and the presence of an aberrant transcript in homozygous testes. Additional RT-PCR experiments (data not shown) indicated that the aberrant Morc transcript was not due to splicing of exon 1 to exons 3[prime] of the deletion. However, we did find RT-PCR products containing transgene promoter and flanking Morc genomic sequences spliced to Morc exon 5 and downstream exons. Although we have not yet completely characterized the mutant transcript, the wild-type Morc exons 1-4 (324 nt) appear to have been replaced by sequences of roughly equal length, since the mutant and wild-type transcripts showed similar sizes on northern blots (Fig. 2B). Interestingly, the total amount of Morc transcript appears to be increased in testes from heterozygotes (Fig. 2B, 3[prime] probe), probably reflecting abundant transcription from the strong transgene promoter in post-mitotic germ cells (8). Consistent with previous transgene expression data (8), the mutant morc transcript is not as abundant in homozygous mutants that retain spermatogonia but lack most of the post-mitotic germ cell population (Fig. 2B, 3[prime] probe).

Morc defines a novel gene family

In order to identify a human Morc homolog, we screened a human testis cDNA library using the 900 bp mouse cDNA as probe. A 2.8 kb cDNA was isolated and sequenced. When used as probe, this cDNA detected an ~4 kb transcript, with expression again limited to testis (Fig. 2D). A full-length human cDNA was cloned by 3[prime]-RACE and sequenced. To confirm that this human cDNA was the mouse Morc homolog, we mapped both mouse and human genes. Mouse Morc mapped to the central part of mouse chromosome 16, while human MORC mapped to the conserved linkage region on 3q13 (N. Inoue, M. Seldin, A. Zinn and M. Watson, manuscript in preparation). The nucleotide sequence, expression and comparative mapping data all indicated that the human cDNA was the bona fide Morc homolog.

Figure 3A shows an alignment of mouse and human MORC proteins. The primary sequence of the mouse Morc cDNA predicts a protein of 950 amino acids, while the human cDNA encodes a protein of 984 amino acids with 66% overall identity to mouse MORC. The identity rises to 76% over the first 590 residues. The peptide sequence encoded by exons 2-4, deleted in the morcTgN(Tyr)1Az mutant, is 94% identical between mouse and human MORC. Two regions of human MORC, residues 669-692 and 955-971, are insertions of 24 and 17 amino acids, respectively, relative to mouse MORC. RT-PCR experiments showed no evidence that these insertions are due to alternative splicing (data not shown).

   A
   B

Figure 3. (A) Alignment of mouse and human MORC proteins. Identical residues are shown as periods and shaded gray. Gaps are indicated by dashes. NLS, putative nuclear localization signals. (B) Conserved motifs identified in mouse MORC (mMORC), human MORC (hMORC), human KIAA0852 (9), human KIAA0136 protein (10), C.elegans predicted protein ZC155.3 (11) and A.thaliana predicted protein (12). Residues differing from mouse or human MORC are shown in bold. Residues in parentheses are not encoded by the published KIAA0852 cDNA (9) but are predicted by genomic sequence from human chromosome 22 (GenBank accession no. AC004542).

Database searches using BLAST and FASTA algorithms revealed a significant match to KIAA0852, a human cDNA of unknown function that is widely expressed, with the highest transcript levels in testis, ovary and brain (9). Other significant matches included a ubiquitously expressed gene, KIAA0136, from a human tumor cell line (10) and genes from the nematode Caenorhabditis elegans (11) and the plant Arabidopsis thaliana (GenBank accession no. AL022141). Each of these protein sequences showed 30-40% overall identity to mouse or human MORC, with local regions of much greater identity to N-terminal portions of MORC (Fig. 3B). The MORC protein also showed low but significant similarity to a zebrafish EST reading frame (GenBank accession no. AA605811) and to Dictyostelium discoideum ZipA, a leucine zipper protein that functions in morphogenesis (GenBank accession no. AF019980) (data not shown). Interestingly, ESTs were identified from mouse early blastocyst (GenBank accession no. C89308) and 16-cell embryos (GenBank accession no. AU044657) encoding potential proteins nearly identical to portions of MORC, suggesting that Morc is also expressed during early development. An EST from 4-week-old mouse thymus (GenBank accession no. AI183160) also matched Morc, but its biological significance is unclear in view of our failure to detect human MORC thymic transcripts by northern blotting (Fig. 2D). Finally, the N-terminus of Morc has limited similarity to the GHL (GyraseB, Hsp90, MutL) family members in the four consensus ATPase domains [MORC residues 33-48, 66-75, 96-104, 194-195 (12)], raising the possibility that Morc may require ATP hydrolysis for function.

We used a variety of computer algorithms to look for clues to the function of the mouse and human MORC proteins. The Paircoil program (13) strongly predicted coiled-coil domains at residues 281-311, 320-350 and 885-917 in mouse MORC and at the corresponding conserved residues 280-354 and 900-935 in the human protein (Fig. 3A). A leucine zipper motif (14) with four heptad repeats at residues 926-947 of human MORC overlaps the predicted coiled-coil domain. The corresponding mouse sequence is quite similar but is interrupted by a proline at the position of the third leucine (Fig. 3A).

MORC is a nuclear protein

Additional analysis using the PSORT II algorithm (15) predicted with high probability that both human and mouse MORC are nuclear proteins, with a putative bipartite nuclear localization signal at residues 256-272 in mouse and residues 257-273 in human (Fig. 3A). Mouse MORC also has a second putative nuclear localization signal at residues 891-894 (Fig. 3A). Of note, neither a transmembrane domain nor an N-terminal signal sequence was identified in either the mouse or human protein.

To test the predicted nuclear localization of MORC protein, we expressed epitope-tagged mouse MORC in COS7 cells and determined its subcellular localization by multicolor immunofluorescence. Most MORC-expressing cells showed strong, punctate nuclear staining (Fig. 4A). Occasional cells showed more diffuse nuclear staining and rare cells showed cytoplasmic staining (data not shown). MORC proteins tagged with the FLAG epitope at either the N-terminus (Fig. 4A) or the C-terminus (data not shown) gave identical results. We conclude that MORC is a predominantly nuclear protein.


Figure 4. (A) Epitope-tagged mouse MORC protein localized to the nucleus in cultured cells. FLAG epitope was detected with FITC (green), nuclei with DAPI (blue) and membranes with DiIC18 (3) (red). (B) Morc expression in germinal epithelium was confirmed by RNA in situ hybridization using antisense probe. (C) Sense control. Bar 20 µM.

Morc is expressed in germ cells

To determine which cell types in testis express Morc, we analyzed fractionated germ cells from wild-type mouse testes by northern blotting (Fig. 2E). The ~3 kb Morc transcript was detected in all germ cell fractions except residual bodies, with the highest level in spermatogonia and the lowest level in post-meiotic round spermatids. Interestingly, the minor ~2 kb Morc transcript was seen only in pachytene spermatocytes. The expression pattern in whole testes from wild-type mice of increasing developmental age was also examined. Morc was expressed in testes from mice aged 7 days to adult (Fig. 2E). The relative abundance of the ~3 kb Morctranscript in whole testis appears to decrease during testicular maturation, consistent with the increasing proportion of meiotic and post-meiotic germ cells that express lower levels of the gene.

To test whether Morc is also expressed in somatic cells of the testis, we examined mice that lacked germ cells due to either the recessive atrichosis (at) mutation (16) or the XX,Sxr sex-reversal mutation (17). In neither case were Morc transcripts detected (Fig. 2E). We also performed RNA in situ hybridization on wild-type mouse testis using a Morc antisense probe. The signal was localized to the germinal epithelium layers containing spermatogonia and spermatocytes with only background over interstitial cells, confirming that Morc is expressed specifically in germ cells (Fig. 4B and C).

DISCUSSION

We have defined the molecular basis of the mouse morcTgN(Tyr)1Az mutation, which causes recessive male sterility with an arrest of spermatogenesis in early meiosis. The mutation is due to integration of a transgene into the Morc gene and concomitant deletion of Morc exons 2-4. The recessive phenotype and the morc deletion are consistent with a loss-of-function mutation. An aberrant morc transcript is present in homozygous mutant mice; however, its translation would produce a truncated protein lacking at least the first 73 residues of the MORC N-terminal region. The strong evolutionary conservation of this region suggests that it is critical to MORC function. The relatively low overall identity between human and mouse MORC proteins (66%) is attributable to the less conserved C-terminal region, but MORC conservation is nevertheless comparable with that of some other nuclear proteins, such as the orphan nuclear receptor DAX1 (65%) (18,19) or the meiosis-specific synaptonemal complex protein 1 (72%) (20,21).

Several lines of evidence indicate that the mutation we have identified is responsible for the arrest of spermatogenesis, previously shown to be linked to the transgene (8). First, the transgene and deletion are wholly contained within the Morc gene. Secondly, we found no other genes expressed in testis within the P1 clone containing the transgene integration site, either by exon trapping or by nucleotide sequencing of ~15 kb flanking the transgene. Finally, the morc mutation affects only spermatogenesis and, thus, Morc expression exclusively in male germ cells of adult mice is highly unlikely to be coincidental.

The fact that the morcTgN(Tyr)1Az mutation affects only spermatogenesis does not in itself demonstrate germ cell-specific expression. For instance, mutations in the widely expressed anti-apoptosis gene Bclw also appear to affect only spermatogenesis (22,23). Furthermore, targeted inactivation of desert hedgehog (dhh), a signaling gene expressed in Sertoli cells, causes meiotic arrest and germ cell death in the 129/Sv inbred background (24). Therefore it was important to determine which testicular cell type expresses Morc. Northern blot analyses of isolated germ cells and two classic germ cell-deficient mouse mutants and in situ hybridization to wild-type testis sections all indicated that Morc is expressed specifically in germ cells.

The Morc transcript is rare: prolonged exposure is needed to detect Morc mRNA by northern blotting. Related genes are present in humans, nematodes, plants and slime mold, but none of these genes has been functionally characterized. Although the human and mouse Morc genes are expressed specifically in male germ cells, two related human genes, KIAA0852 and KIAA0136, are expressed in multiple tissues. These data suggest that Morc plays a specialized role in germ cells that may be related to a more general function of other family members in somatic cells.

What does MORC do? The presence of related genes in such diverse eukaryotes as humans, nematodes, plants and slime mold predicts an important function for Morc gene family members in the biology of multicellular organisms. Based upon the protein's nuclear localization and the similar phenotypes of other mouse knockouts (6), MORC may regulate transcription, cell division, DNA repair or meiotic chromosome dynamics. The MORC proteins are predicted to have conserved coiled-coil domains, suggesting that they interact with other proteins. The punctate staining pattern of transfected MORC suggests that the protein may be part of a large nuclear complex such as the DNA `repairosome' (25). Interestingly, Morc is transcribed in both mitotic and meiotic germ cells, although testes lacking MORC show no histological defects prior to the onset of meiosis (8). Perhaps MORC is required in spermatogonia for assembly of a nuclear complex to be used later during meiosis. Alternatively, the Morc transcript could be translationally regulated, accumulating in spermatogonia and then translated in spermatocytes. Although translational regulation has not been demonstrated in spermatogonia, it is well known for a number of genes expressed in post-meiotic spermatids (26).

Since expression of mouse Morc is most obvious in germ cells, alterations of human MORC or the pathway in which it acts might play a role in infertility, a problem affecting 10% of all couples, which involves the male partner in about half of cases. Testis-specific expression of MORC could mean that selective inhibition of human MORC may not have systemic side-effects. Thus, MORC or its biochemical pathway could provide attractive new targets for development of contraceptives or alleviation of infertility.

MATERIALS AND METHODS

cDNA cloning and sequencing

Isolation of P1 clones from the Morc locus was described previously (8). Exon trapping was performed with the vector pSPL3-iv (27) according to the manufacturer's instructions (Gibco BRL, Gaithersburg, MD), using libraries prepared from size-fractionated BamHI+BglII- or PstI-digested P1 DNA. 5[prime]- and 3[prime]-RACE was performed with Morc-specific primer ATGGGGAGTACTTGAAAATGATGGAC (5[prime]-RACE) or AGATGCCGGGGCTGTAAGACTCG (3[prime]-RACE), using commercial mouse testis cDNA (Clontech, Palo Alto, CA) and the Expand High Fidelity PCR System (Boehringer Mannheim, Indianapolis, IN). RACE products were blunt-ended, phosphorylated and cloned into the EcoRV site of pBluescript II KS+ (Stratagene, La Jolla, CA) and two independent clones were sequenced for each product. The mouse Morc cDNA was used to isolate a cDNA from a human testis library (Clontech) by plaque hybridization. The full-length human cDNA was isolated by 3[prime]-RACE using commercial human testis cDNA (Clontech) as described above, with Morc-specific primer CTTCTTCGCCAGCGTCTTCTCA. RACE products were cloned as above and three independent clones were sequenced.

Expression assays

Total RNA was extracted from testes of wild-type, heterozygous or homozygous mice using TRIzol reagent according to the manufacturer's instructions (Gibco BRL). Samples were dissolved in 200-350 µl buffer containing 20 mM Tris, pH 8.4, 2 mM MgCl2, 50 mM KCl and treated for 15 min at room temperature with 0.06 U/µl DNase I (amplification grade; Gibco BRL) and 0.11 U/µl RNaseOUT RNase inhibitor (Gibco BRL). For northern blots, 25 µg samples of RNA were electrophoresed on 1% agarose-2.2 M formaldehyde gels (28), transferred to Hybond N (Amersham Pharmacia Biotech, Arlington Heights, IL) and hybridized overnight at 65°C in Rapid-Hyb buffer (Amersham Pharmacia Biotech). The exon 2-4 probe was an EcoRI-HindIII mouse Morc cDNA subclone (nt 161-333) radiolabeled with [[alpha]-32P]dCTP with LacZ forward and reverse primers using a PCR labeling kit (Gibco BRL). Tissue distributions were examined using human and mouse multiple tissue northern blots (Clontech). A mouse Morc cDNA fragment (nt 1771-3008) was random primer labeled using a kit according to the manufacturer's instructions (Amersham Pharmacia Biotech) and used as the 3[prime] region probe. A random primer labeled human [beta]-actincDNA (Clontech) was used for control hybridizations. Signals were visualized using a Molecular Dynamics STORM860 phosphorimager. For RT-PCR assays, 3 µg of total RNA per sample was reverse transcribed with Superscript II (Gibco BRL) and PCR was performed using one tenth of the cDNA product. Primers were: AGATGCCGGGGCTGTAAGACTCG and TTCATCCGGGGTTCAAAATACAGA (5[prime] primers); AAGCGCAGCCGCAGAAGTCTCAACT and GCCGGCAGCTGACAGTCACCACTC (3[prime] primers); CGTGGGCGTGGGCCAACAGTT (Morc exon 1) and ATGGGGAGTACTTGAAAATGATGGAC (Morc exon 7); and AGTTAGCCGTTATTAGTGGAGAGG (transgene promoter sequence; 8) and Morc exon 7 primer. The latter primer pair gave several products from +/- testis RNA, the most abundant of which was sequenced. RNA in situ hybridization to serial sections of wild-type testis was performed as described previously (29) using cDNA probes corresponding to the entire Morc coding region. Enriched germ cell fractions were prepared and RNA extracted essentially as described previously (30). Purities of fractions, assayed by light microscopy, were: spermatogonia, 72.8%; leptotene/zygotene spermatocytes, 79%; early pachytene spermatocytes, 64%; pachytene spermatocytes, 88.7%; round spermatids, 68%; residual bodies, 87%.

Protein alignments

Proteins were aligned using MegAlign (DNASTAR). Identity = matching residues [divide] (matching residues + mismatching residues + number of gaps) was calculated for human and mouse MORC, DAX1, SCP1 and DMC1 proteins using Lipman-Pearson alignments with default parameters (ktuple 2, gap penalty 4, gap length penalty 12). Motifs conserved between MORC and other proteins were identified using BLOCKMAKER (31-33).

Protein immunolocalization

The FLAG epitope was added at the N- or C-terminus of the mouse MORC peptide sequence by replacing the initiator methionine codon with a SalI restriction site (34) or the termination codon with an NruI restriction site (35), respectively. The pMEPy vectors (36) containing FLAG-tagged MORC were transfected into COS7 cells using TransFast reagent (Promega, Madison, WI). Cells were cultured for 48 h after transfection, fixed with 4% paraformaldehyde (w/v) in phosphate-buffered saline (PBS) and permeabilized with 0.1% Triton X-100 (w/v) in PBS. Proteins were detected by sequential 60 min room temperature incubations in PBS containing 4% bovine serum albumin (PBS+4% BSA) (w/v), 14.5 µg/ml biotinylated anti-FLAG antibody M2 (Eastman Kodak, Rochester, NY) in PBS+4% BSA and 5 µg/ml fluoresceinated streptavidin (Vector Laboratories, Burlingame, CA) in PBS+4% BSA. Nuclei were stained with 0.4 µg/ml DAPI in Vectashield antifade reagent (Vector Laboratories). Membranes were stained by adding 2 µM DiIC18 (3) (Molecular Probes, Eugene, OR) to the culture medium 16 h prior to fixation. Cells were photographed under epifluorescence using a Zeiss Axiphot microscope with triple-pass filter and Kodak Ektachrome 400 color slide film.

ACKNOWLEDGEMENTS

We thank R. Schultz for a mouse testis cDNA library; N. Miura for help with in situ hybridization; M. Brown, J. Goldstein, J. Holder and R. Prueitt for helpful comments; and B. Ouyang for technical assistance. This work was supported by the UT Southwestern Program for Excellence in Postgraduate Research (M.L.W. and A.R.Z.) and NIH grant HD31376 (M.A.H.).

NOTE ADDED IN PROOF

The C.elegans predicted protein ZC155.3 from cosmid ZC155 (protein ID AAD31935.1) has been revised such that residue no. 399 is now residue no. 34. All homologies remain the same.

REFERENCES

1. Handel, M.A. (1987) Genetic control of spermatogenesis in mice. Results Probl. Cell Differ., 15, 1-62. MEDLINE Abstract

2. Dix, D.J., Allen, J.W., Collins, B.W., Mori, C., Nakamura, N., Poorman-Allen, P., Goulding, E.H. and Eddy, E.M. (1996) Targeted gene disruption of Hsp70-2 results in failed meiosis, germ cell apoptosis, and male infertility. Proc. Natl Acad. Sci. USA, 93, 3264-3268. MEDLINE Abstract

3. Baker, S.M., Plug, A.W., Prolla, T.A., Bronner, C.E., Harris, A.C., Yao, X., Christie, D.M., Monell, C., Arnheim, N., Bradley, A., Ashley, T. and Liskay, R.M. (1996) Involvement of mouse Mlh1 in DNA mismatch repair and meiotic crossing over [see comments]. Nature Genet., 13, 336-342. MEDLINE Abstract

4. Edelmann, W., Cohen, P.E., Kane, M., Lau, K., Morrow, B., Bennett, S., Umar, A., Kunkel, T., Cattoretti, G., Chaganti, R., Pollard, J.W., Kolodner, R.D. and Kucherlapati, R. (1996) Meiotic pachytene arrest in MLH1-deficient mice. Cell, 85, 1125-1134. MEDLINE Abstract

5. Toscani, A., Mettus, R.V., Coupland, R., Simpkins, H., Litvin, J., Orth, J., Hatton, K.S. and Reddy, E.P. (1997) Arrest of spermatogenesis and defective breast development in mice lacking A-myb. Nature, 386, 713-717. MEDLINE Abstract

6. Okabe, M., Ikawa, M. and Ashkenas, J. (1998) Male infertility and the genetics of spermatogenesis. Am. J. Hum. Genet., 62, 1274-1281. MEDLINE Abstract

7. Meisler, M.H. (1992) Insertional mutation of `classical' and novel genes in transgenic mice. Trends Genet., 8, 341-344. MEDLINE Abstract

8. Watson, M.L., Zinn, A.R., Inoue, N., Hess, K.D., Cobb, J., Handel, M.A., Halaban, R., Duchene, C.C., Albright, G.M. and Moreadith, R.W. (1998) Identification of morc (microrchidia), a mutation that results in arrest of spermatogenesis at an early meiotic stage in the mouse. Proc. Natl Acad. Sci. USA, 95, 14361-14366. MEDLINE Abstract

9. Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Hirosawa, M., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N. and Ohara, O. (1998) Prediction of the coding sequences of unidentified human genes. XII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res., 5, 355-364. MEDLINE Abstract

10. Nagase, T., Seki, N., Tanaka, A., Ishikawa, K. and Nomura, N. (1995) Prediction of the coding sequences of unidentified human genes. IV. The coding sequences of 40 new genes (KIAA0121-KIAA0160) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res., 2, 167-174. MEDLINE Abstract

11. Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., Burton, J., Connell, M., Copsey, T., Cooper, J. et al.(1994) 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans [see comments]. Nature, 368, 32-38. MEDLINE Abstract

12. Ban, C., Junop, M. and Yang, W. (1999) Transformation of MutL by ATP binding and hydrolysis: a switch in DNA mismatch repair. Cell, 97, 85-97. MEDLINE Abstract

13. Berger, B., Wilson, D.B., Wolf, E., Tonchev, T., Milla, M. and Kim, P.S. (1995) Predicting coiled coils by use of pairwise residue correlations. Proc. Natl Acad. Sci. USA, 92, 8259-8263. MEDLINE Abstract

14. Landschulz, W.H., Johnson, P.F. and McKnight, S.L. (1988) The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science, 240, 1759-1764. MEDLINE Abstract

15. Nakai, K. and Kanehisa, M. (1992) A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics, 14, 897-911. MEDLINE Abstract

16. Hummel, K. (1966) Atrichosis. Mouse Newslett., 34, 31.

17. Cattanach, B.M., Pollard, C.E. and Hawkes, S.G. (1971) Sex-reversed mice: XX and XO males. Cytogenetics,10, 318-337. MEDLINE Abstract

18. Zanaria, E., Muscatelli, F., Bardoni, B., Strom, T.M., Guioli, S., Guo, W., Lalli, E., Moser, C., Walker, A.P., McCabe, E.R. et al.(1994) An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita. Nature, 372, 635-641. MEDLINE Abstract

19. Guo, W., Lovell, R.S., Zhang, Y.H., Huang, B.L., Burris, T.P., Craigen, W.J. and McCabe, E.R. (1996) Ahch, the mouse homologue of DAX1: cloning, characterization and synteny with GyK, the glycerol kinase locus. Gene, 178, 31-34. MEDLINE Abstract

20. Sage, J., Martin, L., Cuzin, F. and Rassoulzadegan, M. (1995) cDNA sequence of the murine synaptonemal complex protein 1 (SCP1). Biochim. Biophys. Acta, 1263, 258-260. MEDLINE Abstract

21. Meuwissen, R.L., Meerts, I., Hoovers, J.M., Leschot, N.J. and Heyting, C. (1997) Human synaptonemal complex protein 1 (SCP1): isolation and characterization of the cDNA and chromosomal localization of the gene. Genomics, 39, 377-384. MEDLINE Abstract

22. Ross, A.J., Waymire, K.G., Moss, J.E., Parlow, A.F., Skinner, M.K., Russell, L.D. and MacGregor, G.R. (1998) Testicular degeneration in Bclw-deficient mice [see comments]. Nature Genet., 18, 251-256. MEDLINE Abstract

23. Print, C.G., Loveland, K.L., Gibson, L., Meehan, T., Stylianou, A., Wreford, N., de Kretser, D., Metcalf, D., Kontgen, F., Adams, J.M. and Cory, S. (1998) Apoptosis regulator bcl-w is essential for spermatogenesis but appears otherwise redundant. Proc. Natl Acad. Sci. USA, 95, 12424-12431. MEDLINE Abstract

24. Bitgood, M.J., Shen, L. and McMahon, A.P. (1996) Sertoli cell signaling by Desert hedgehog regulates the male germline. Curr. Biol., 6, 298-304. MEDLINE Abstract

25. He, Z. and Ingles, C.J. (1997) Isolation of human complexes proficient in nucleotide excision repair. Nucleic Acids Res., 25, 1136-1141. MEDLINE Abstract

26. Hecht, N.B. (1995) The making of a spermatozoon: a molecular perspective. Dev. Genet., 16, 95-103. MEDLINE Abstract

27. Nisson, P.E., Ally, A. and Watkins, P.C. (1994) Protocols for trapping internal and 3[prime]-terminal exons. PCR Methods Appl., 4, S24-S39. MEDLINE Abstract

28. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

29. Yashima, K., Ashfaq, R., Nowak, J., Von Gruenigen, V., Milchgrub, S., Rathi, A., Albores-Saavedra, J., Shay, J.W. and Gazdar, A.F. (1998) Telomerase activity and expression of its RNA component in cervical lesions. Cancer, 82, 1319-1327. MEDLINE Abstract

30. Cobb, J., Reddy, R.K., Park, C. and Handel, M.A. (1997) Analysis of expression and function of topoisomerase I and II during meiosis in male mice. Mol. Reprod. Dev., 46, 489-498. MEDLINE Abstract

31. Smith, H.O., Annau, T.M. and Chandrasegaran, S. (1990) Finding sequence motifs in groups of functionally related proteins. Proc. Natl Acad. Sci. USA, 87, 826-830. MEDLINE Abstract

32. Henikoff, S. and Henikoff, J.G. (1991) Automated assembly of protein blocks for database searching. Nucleic Acids Res., 19, 6565-6572. MEDLINE Abstract

33. Lawrence, C.E., Altschul, S.F., Boguski, M.S., Liu, J.S., Neuwald, A.F. and Wootton, J.C. (1993) Science, 262, 208-214. MEDLINE Abstract

34. Watanabe, R., Kinoshita, T., Masaki, R., Yamamoto, A., Takeda, J. and Inoue, N. (1996) Detecting subtle sequence signals: a Gibbs sampling strategy for multiple alignment. J. Biol. Chem., 271, 26868-26875. MEDLINE Abstract

35. Nakamura, N., Inoue, N., Watanabe, R., Takahashi, M., Takeda, J., Stevens, V.L. and Kinoshita, T. (1997) Expression cloning of PIG-L, a candidate N-acetylglucosaminyl-phosphatidylinositol deacetylase. J. Biol. Chem., 272, 15834-15840. MEDLINE Abstract

36. Ohishi, K., Kurimoto, Y., Inoue, N., Endo, Y., Takeda, J. and Kinoshita, T. (1996) Cloning and characterization of the murine GPI anchor synthesis gene Pigf, a homologue of the human PIGF gene. Genomics, 34, 340-346. MEDLINE Abstract


*Present address: Ambion Inc., 2130 Woodward Street 200, Austin, TX 78744, USA
+Present address: ThromboGene Ltd, 13012 Morehead Drive, Chapel Hill, NC 27514, USA
§These authors contributed equally to this work
¶To whom correspondence should be addressed at: Eugene McDermott Center for Human Growth and Development, UT Southwestern Medical School, 6000 Harry Hines Boulevard, Dallas, TX 75235, USA. Tel: +1 214 648 1615; Fax: +1 214 648 1666; Email: andrew{at}mcdermott.swmed.edu


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
K. Takahashi, N. Yoshida, N. Murakami, K. Kawata, H. Ishizaki, M. Tanaka-Okamoto, J. Miyoshi, A. R. Zinn, H. Shime, and N. Inoue
Dynamic Regulation of p53 Subnuclear Localization and Senescence by MORC3
Mol. Biol. Cell, May 1, 2007; 18(5): 1701 - 1709.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. Maldonado-Saldivia, J. van den Bergen, M. Krouskos, M. Gilchrist, C. Lee, R. Li, A. H. Sinclair, M. A. Surani, and P. S. Western
Dppa2 and Dppa4 Are Closely Linked SAP Motif Genes Restricted to Pluripotent Cells and the Germ Line
Stem Cells, January 1, 2007; 25(1): 19 - 28.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. O. Gure, R. Chua, B. Williamson, M. Gonen, C. A. Ferrera, S. Gnjatic, G. Ritter, A. J.G. Simpson, Y.-T. Chen, L. J. Old, et al.
Cancer-Testis Genes Are Coordinately Expressed and Are Markers of Poor Outcome in Non-Small Cell Lung Cancer
Clin. Cancer Res., November 15, 2005; 11(22): 8055 - 8062.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
K.-H. Jung, M.-J. Han, Y.-S. Lee, Y.-W. Kim, I. Hwang, M.-J. Kim, Y.-K. Kim, B. H. Nahm, and G. An
Rice Undeveloped Tapetum1 Is a Major Regulator of Early Tapetum Development
PLANT CELL, October 1, 2005; 17(10): 2705 - 2722.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhao, S. W. Kwon, A. Anselmo, K. Kaur, and M. A. White
Broad Spectrum Identification of Cellular Small Ubiquitin-related Modifier (SUMO) Substrate Proteins
J. Biol. Chem., May 14, 2004; 279(20): 20999 - 21002.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Berg, T. J. Meza, M. Mahic, T. Thorstensen, K. Kristiansen, and R. B. Aalen
Ten members of the Arabidopsis gene family encoding methyl-CpG-binding domain proteins are transcriptionally active and at least one, AtMBD11, is crucial for normal development
Nucleic Acids Res., September 15, 2003; 31(18): 5291 - 5304.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. L. Holder Jr, N. F. Butte, and A. R. Zinn
Profound obesity associated with a balanced translocation that disrupts the SIM1 gene
Hum. Mol. Genet., January 1, 2000; 9(1): 101 - 108.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Inoue, N.
Right arrow Articles by Zinn, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inoue, N.
Right arrow Articles by Zinn, A. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?