| Human Molecular Genetics | Pages |
©1999 Oxford University Press |
A common functional polymorphism (C->A substitution at position -863) in the promoter region of the tumour necrosis factor-[alpha] (TNF-[alpha]) gene associated with reduced circulating levels of TNF-[alpha]
Introduction
Results
Detection of common polymorphisms in the promoter region of the TNF-[alpha] gene
Allele frequencies and degree of linkage disequilibrium
Allele-specific binding of nuclear protein to the -863C/A polymorphic site
The rare allele of the -863C/A polymorphism decreases the transcription of the TNF-[alpha] gene
Association between the -863C/A polymorphism and serum TNF-[alpha] concentration
Discussion
Materials And Methods
Subjects
Cell culture
Blood sampling, biochemical methods and DNA procedures
Gene sequencing
Genotyping
EMSA
DNA constructs
Transient transfection assay
Statistical methods
Acknowledgements
A common functional polymorphism (C->A substitution at position -863) in the promoter region of the tumour necrosis factor-[alpha] (TNF-[alpha]) gene associated with reduced circulating levels of TNF-[alpha]
Received January 29, 1999; Revised and Accepted June 1, 1999
Tumour necrosis factor-[alpha] (TNF-[alpha]) plays a key role in orchestrating the complex events involved in inflammation and immunity. Accordingly, TNF-[alpha] has been implicated in a wide range of autoimmune and infectious diseases, but also in conditions such as obesity and insulin resistance. The regulation of TNF-[alpha] expression in man is indicated to be partly genetically determined. We therefore screened a 1263 bp section of the proximal promoter of the TNF-[alpha] gene for common genetic variants affecting the transcriptional activity of the gene. Here we report the characterization of a common functional polymorphism in the promoter region of the TNF-[alpha] gene, a C->A substitution at position -863. Electromobility shift assays provided evidence for a distinct difference in the binding of monocytic and hepatic nuclear factors to the -863C and -863A alleles. The rare -863A allele was associated with 31% lower transcriptional activity (P < 0.001) in chloramphenicol acetyltransferase (CAT) reporter gene studies in human hepatoblastoma (HepG2) cells, indicating that the -863C/A polymorphism influences the basal rate of transcription of the TNF-[alpha] gene in vitro. Allele frequencies were 0.83/0.17 amongst 254 apparently healthy men of Swedish origin, aged 35-50 years. In 156 men, the -863C/A polymorphism was associated with the serum TNF-[alpha] concentration, carriers of the rare A allele having a significantly lower TNF-[alpha] level (P < 0.05). It is concluded that the common -863C/A polymorphism in the promoter region of the TNF-[alpha] gene is functional in vitro in monocytic and hepatic cells and influences the serum TNF-[alpha] concentration in vivo in healthy middle-aged men.
INTRODUCTION
Tumour necrosis factor-[alpha] (TNF-[alpha]) is a cytokine with a wide range of pro-inflammatory activities (1,2). It is produced primarily by monocytes/macrophages (3), although significant amounts are also secreted by several other cell types. TNF-[alpha] is synthesized as a 26 kDa membrane-bound protein (pro-TNF) that is cleaved by TNF-processing enzymes (4-6) to release the soluble 17 kDa TNF-[alpha] molecule. The mature TNF-[alpha] protein can subsequently bind to one of its receptors, TNF receptor 1 (TNF-R1) or TNF receptor 2 (TNF-R2), which are expressed in most nucleated cells (7). Upon interaction of TNF-[alpha] with these receptors, a variety of responses are elicited which affect the regulation of a large number of genes (2).
Disturbances of TNF-[alpha] metabolism have been implicated in several disorders. Early reports focused on the role of TNF-[alpha] in autoimmune and infectious diseases, including rheumatoid arthritis (8), systemic lupus erythematosus (9), Crohn's disease (10), cerebral malaria (11) and leishmaniasis (12). More recent studies have provided evidence for a role for TNF-[alpha] in obesity and insulin resistance (13,14), indicating that perturbations of TNF-[alpha] metabolism may affect the onset of non-insulin-dependent diabetes mellitus (NIDDM) and may play a role in the development of cardiovascular disorders (15).
The expression of TNF-[alpha] is indicated to be partly genetically determined, as polymorphic sites closely linked to the TNF-[alpha] locus are associated with differences in cellular TNF-[alpha] secretion (9,16,17). While there is evidence for transcriptional regulation of TNF-[alpha] gene expression (18-21), polymorphisms in the promoter region of the TNF-[alpha] gene may be important for TNF-[alpha] gene expression and protein production. Accordingly, four common polymorphisms, a G->A substitution at position -308 (22), a G->A substitution at position -238 (23), a C->A substitution at position -857 (24) and a C->A substitution at position -863 (25), and three rare polymorphisms at positions -163 (26), -376 (26) and -574 (25) have been described in the proximal promoter of the TNF-[alpha] gene. Recent analysis of a large number of DNA samples derived from two distinct human populations has generated a consensus TNF-[alpha] promoter sequence (25) which is identical to our sequence analysis. As outlined by Uglialoro et al. (25), the previously reported -238, -244, -308, -376, -857 and -863 polymorphisms are actually located at positions -237, -243, -307, -375, -856 and -862, respectively. However, to avoid unnecessary confusion, throughout this report we refer to these polymorphisms using the locations reported in the original publications.
There is some evidence for a relationship between two of the common polymorphisms and human disease, while it was reported that the -308G/A polymorphism is associated with the clinical course of cerebral malaria (11) and related to insulin resistance (27) and obesity (24,27), and the -238G/A polymorphism is associated with rheumatoid arthritis (28). However, it is not clear whether these promoter polymorphisms are of functional relevance in the regulation of TNF-[alpha] transcription.
We therefore screened a large section of the proximal promoter of the TNF-[alpha] gene in search of common genetic variants with distinct effects on the transcriptional activity of the gene. Here we report that the C->A substitution at position -863 of the promoter of the TNF-[alpha] gene influences the binding of nuclear proteins obtained from human monocytes, human monocytic (U937) cells and human hepatoblastoma (HepG2) cells in electromobility shift assays (EMSAs) and has a substantial impact on the basal rate of transcription of the gene encoding TNF-[alpha] in vitro. Furthermore, the rare -863A allele is associated with significantly lower serum TNF-[alpha] concentrations in healthy middle-aged men. It is concluded that the -863C/A polymorphism in the promoter region of the TNF-[alpha] gene is a physiologically relevant mutation influencing TNF-[alpha] expression in man.
RESULTS
Detection of common polymorphisms in the promoter region of the TNF-[alpha] gene
A 1263 bp fragment of the proximal promoter of the TNF-[alpha] gene was sequenced in both directions using DNA samples from 10 subjects with a wide range of serum TNF-[alpha] concentrations. Five nucleotide differences were consistently observed compared with the sequence reported by Takashiba et al. (29): a C was deleted at position -441, an extra A was found at position -505, and G->C, G->A and A->G substitutions were observed at positions -568, -648 and -885, respectively.
Four previously described polymorphisms were observed in several subjects: a G->A substitution at position -238 (23), a G->A substitution at position -308 (22), a C->T substitution at position -857 (24) and a C->A substitution at position -863 (25). In addition, a T->C substitution at position -1031 was discovered. Assays were developed for the detection of all five promoter mutations (see below), and additional DNA samples were analysed from subjects who were homozygous for the rare alleles of the different polymorphisms. No additional polymorphisms were detected. Assays were also developed for the detection of the -163G/A and -376G/A polymorphisms described by Hamann et al. (26). However, only one heterozygote for the rare -376A allele was detected during screening for the two polymorphisms in 193 subjects. As a consequence, no further studies were conducted in relation to the -163G/A and -376G/A polymorphisms.
Allele frequencies and degree of linkage disequilibrium
Genotyping for the -238G/A, -308G/A, -857C/T, -863C/A and -1031T/C polymorphisms was performed in 254 healthy, population-based men aged 35-50 years. All polymorphisms were found to be in Hardy-Weinberg equilibrium. Allele frequencies and pairwise linkage disequilibrium coefficients are shown in Table 1. Complete allelic associations were observed between the -238G/A and the -1031T/C polymorphisms and between the -863C/A and the -1031T/C polymorphisms. In contrast, no association was found between the -238A/-863A/-1031C haplotype and the -308G/A and/or the -857C/T polymorphisms.
Table 1. Allele frequencies and pairwise linkage disequilibrium coefficients of five polymorphisms in the promoter region of the TNF-[alpha] gene in 254 healthy middle-aged men
| Polymorphism | Allele frequencies | Normalized linkage disequilibrium coefficient (±|D[prime]|) | |||
| -238 | -308 | -857 | -863 | ||
| -238G/A | 0.97/0.03 | ||||
| -308G/A | 0.80/0.20 | 0.27 | |||
| -857C/T | 0.94/0.06 | 0.00 | 0.24 | ||
| -863C/A | 0.83/0.17 | 0.22 | 0.24 | 0.20 | |
| -1031T/C | 0.80/0.20 | -0.93 | 0.25 | 0.25 | -0.94 |
Allele-specific binding of nuclear protein to the -863C/A polymorphic site
The possibility that the nucleotide substitutions at positions -238, -308, -857, -863 and -1031 affect the interaction with nuclear proteins was analysed by EMSA using nuclear extracts derived from U937 cells. No evidence was found for differences in the binding characteristics of DNA fragments containing either the wild-type or the mutant site for the -238G/A, -308G/A, -857C/T and -1031T/C polymorphisms (data not shown). However, distinct differences were observed in the binding characteristics of 32 bp DNA fragments containing either the -863C or -863A site of the TNF-[alpha] promoter (Fig. 1). Two DNA-protein complexes, marked with arrowheads, showing allele-specific binding were detected using nuclear extracts derived from U937 cells (Fig. 1A) and HepG2 cells (Fig. 1B). The protein(s) of the complexes bound with higher affinity to the wild-type -863C probe (lanes 2-4) than to the mutant -863A probe (lanes 6-8). Competition studies using a 400-fold excess of unlabelled EMSA probes showed that the two protein complexes of the wild-type promoter fragment are sequence specific, as the band intensities were unchanged when the mutant probe was added as competitor (Fig. 1A and B, lane 11) whereas the band diminished substantially when the wild-type probe was used as competitor (Fig. 1A and B, lane 10). Taken together, the results of the EMSA studies indicate that there is specific protein binding to the segment of the TNF-[alpha] promoter spanning from position -876 to position -845 and that this binding is reduced when there is a C->A substitution at position -863. Similar results were obtained in EMSA studies using nuclear extracts from human monocytes (data not shown).
Figure 1. A representative EMSA of the -863C/A region of the TNF-[alpha] promoter. EMSA of nuclear extract derived from U937 cells (A) and HepG2 cells (B) bound to a 32 bp DNA fragment containing either the -863C (lanes 1-4 and 9-12) or the -863A site (lanes 5-8 and 13-16) of the TNF-[alpha] promoter. All incubations were performed in 20 µl. Lanes 1 and 5, no extract; lanes 2 and 6, 1 µg of extract; lanes 3 and 7, 2 µg of extract; lanes 4, 8 and 9-16, 4 µg of extract; lanes 9 and 13, -863C and -863A probe, respectively, without competitors; lanes 10 and 15, -863C and -863A probe, respectively, with a 400-fold excess of -863C probe as competitor; lanes 11 and 14, -863C and -863A probe, respectively, with a 400-fold excess of -863A probe as competitor; lanes 12 and 16, -863C and -863A probe, respectively, with a 400-fold excess of non-specific (X) competitor. The arrowheads denote the specific DNA-protein complexes associated with the -863C/A polymorphic site.
The rare allele of the -863C/A polymorphism decreases the transcription of the TNF-[alpha] gene
Since the EMSA studies using extracts from either human monocytes or U937 or HepG2 cells showed similar DNA-protein interactions, for technical reasons the transient transfection studies were conducted in HepG2 cells to explore whether the -863C/A polymorphism influences the basal rate of transcription of the TNF-[alpha] gene. The rates of transcription of a 1078 bp fragment of the proximal promoter spanning from -1061 to +17 of the TNF-[alpha] gene containing the -863A site were compared with those of an identical fragment of the wild-type promoter. As shown in Figure 2, significantly lower CAT activities were observed for the -863A construct as compared with the -863C construct (a 31% decrease, P < 0.001), indicating that the C->A substitution at the -863 position of the TNF-[alpha] promoter decreases the basal rate of transcription of the TNF-[alpha] gene.
Figure 2. Reporter gene assays of TNF-[alpha] gene promoter constructs. CAT activities of constructs harbouring 1078 bp fragments with either the -863C or the -863A site (three independent experiments in duplicate or triplicate) were compared in transfection studies using HepG2 cells. CAT levels are expressed as a percentage of control (-863C) after standardization for [beta]-galactosidase activity. Bars indicate mean values with standard deviations. The statistical significance of differences was determined by Student's unpaired t-test.
Association between the -863C/A polymorphism and serum TNF-[alpha] concentration
The relationship between the -863C/A polymorphism and serum TNF-[alpha] concentration was analysed subsequently in 156 individuals belonging to the original population of 254 apparently healthy, middle-aged men. As shown in Table 2 and Figure 3, carriers of the rare -863A allele had significantly lower serum TNF-[alpha] levels (P < 0.05 in analysis of variance). The association was graded, i.e. subjects homozygous for the -863A allele had lower serum TNF-[alpha] concentrations than subjects who were heterozygous for the -863A allele. In contrast, no association was observed between the equally common -308G/A polymorphism, which is only weakly linked to the -863 polymorphism, and serum TNF-[alpha] levels (Table 2). The low frequencies of the rare alleles of the -238G/A and -857C/T polymorphisms (0.03 and 0.06, respectively, in this population) precluded analyses of genotype-phenotype associations for these polymorphisms.
Figure 3. Carriers of the rare -863A allele have a significantly lower serum TNF-[alpha] level. Box plots display the TNF-[alpha] levels (pg/ml) of the individuals with -863C/C and -863 C/A genotypes. Fifty percent of the values are contained within the box. 1, -863C/C; 2, -863C/A; 3, -863A/A.
Table 2. Serum TNF-[alpha] concentration according to TNF-[alpha] -308G/A and -863C/A genotypes in healthy middle-aged men
| N | TNF-a (pg/ml) | |
| -308G/A genotype | ||
| -308G/G | 99 | 2.25 ± 0.64 |
| -308G/A | 50 | 2.39 ± 0.76 |
| -308A/A | 7 | 2.27 ± 0.76 |
| Variance analysis | NS | |
| -863C/A genotype | ||
| -863C/C | 106 | 2.39 ± 0.73 |
| -863C/A | 44 | 2.10 ± 0.52 |
| -863A/A | 6 | 1.94 ± 0.37 |
| Variance analysis | P < 0.05 |
DISCUSSION
The objective of our study was to identify polymorphisms that are physiologically relevant for TNF-[alpha] metabolism and that may, therefore, be useful genetic markers for resolving the issue of whether a causal relationship exists between TNF-[alpha] expression and various disease states, such as autoimmune and infectious diseases, obesity, insulin resistance, NIDDM and cardiovascular disease. While there is evidence for transcriptional regulation of TNF-[alpha] gene expression (18-21), we carried out an extensive screening of the promoter region of the TNF-[alpha] gene and performed functional studies in vitro of all common polymorphisms encountered. Three basic observations were made in relation to the -863C/A polymorphism. Firstly, results from the EMSA studies using nuclear extracts from human monocytes and U937 and HepG2 cells indicated that the -863C/A polymorphism strongly influenced the specific binding of nuclear protein(s). These allele-specific differences were observed consistently using different probes and different nuclear extracts. It is noteworthy that the -863C/A polymorphism is situated at the border of a 10 bp sequence (GGGGACCCCC) which shows considerable similarity with the consensus sequence for the nuclear factor-[kappa]B (NF-[kappa]B)-binding site. This suggests that differencies in the binding affinity of NF-[kappa]B may be the basis for the observed differencies in transcriptional activity of the two alleles. However, we have been unable to demonstrate an allele-specific response to 10 µg/ml lipopolysaccharide (LPS) in transfection experiments when using the -863C/A constructs (data not shown). Secondly, transfection studies provided evidence that the rare -863A allele is associated with a decreased basal transcription rate compared with constructs harbouring the wild-type allele. Thirdly, the rare -863A allele was associated with significantly lower serum TNF-[alpha] concentrations in a well-defined group of apparently healthy, middle-aged men of Swedish origin. Accordingly, it is proposed that the -863C/A polymorphism affects the binding of nuclear protein(s) to the promoter region of the TNF-[alpha] gene, with accompanying changes in TNF-[alpha] expression, leading to variation in serum TNF-[alpha] levels. However, it should be emphasized that whereas the data presented in this report are compatible with this interpretation, not all components of this hypothesis have been tested experimentally. Indeed, we cannot formally exclude the possibility that other mutations, linked to the -863C/A polymorphism, may influence the expression of TNF-[alpha].
A potential physiological role for the -308G/A polymorphism has been indicated in several studies (11,24,27) and further underlined by recent studies demonstrating that the G->A substitution has a significant effect on transcriptional activity in reporter gene assays (30,31). In contrast, no association could be detected between the -308G/A polymorphism and either myocardial infarction, severity of angiographically assessed coronary artery disease or metabolic and haemostatic disturbances in the large ECTIM study (Etude Cas-Témoin de l'Infarctus du Myocarde) (24). Other experimental studies have also been unable to demonstrate a difference in transcriptional activity between the -308G and -308A alleles (25,32,33). Indeed, experiments reported by Wilson et al. (30) and the results of our own EMSA studies provided no evidence for a significant difference in affinity of DNA-binding protein(s) for the two allelic forms of the TNF-[alpha] promoter. However, use of different cell lines, constructs and stimulants may yield contradictory results in similar EMSA or reporter gene studies. Nevertheless, no relationship was observed between the -308G/A polymorphism and serum TNF-[alpha] concentration in the present study. Accordingly, it remains uncertain whether the -308G/A polymorphism plays a direct physiological role in regulating TNF-[alpha] gene expression.
The physiological significance of the -238G/A polymorphism hitherto has not been analysed in great detail. An association was observed recently between the -238G/A polymorphism and susceptibility to and/or severity of rheumatoid arthritis (28). However, Pociot et al. (34) found no evidence of a functional significance of this polymorphism when studying its influence on TNF-[alpha] production by monocytes in vitro upon LPS or allogenic stimulation, and Uglialoro et al. (25) failed to detect any effect on TNF-[alpha] transcription in T- and B-cell model systems. Indeed, in the present study, no support was obtained for a significant difference in affinity of DNA-binding protein(s) for the -238G or A alleles. Thus, the limited data reported so far do not provide strong evidence in favour of a physiological role of the -238G/A polymorphism in the regulation of TNF-[alpha] gene transcription.
In the course of this study, the discovery of a -862C/A polymorphism (identical to the -863C/A polymorphism described here) was reported by Uglialoro et al. (25). No effect of the polymorphic site was seen in CAT reporter gene assays when TNF-[alpha] transcription was analysed in vitro in T- and B-cell systems. These results are in apparent contrast to our findings that the rare -863A-allele is associated with a marked decrease in the basal rate of TNF-[alpha] transcription in vitro in HepG2 cells and with significantly lower serum TNF-[alpha] concentrations in vivo in healthy middle-aged men. The discrepancy between the two sets of reporter gene studies may be related to the use of murine cell lines by Uglialoro et al. (25) and human cells in the present study. It is notable in this context that we could demonstrate allele-specific binding of nuclear protein(s) to the -863C/A polymorphic site using different probes and different extracts from monocytic U937 cells, human monocytes and HepG2 cells.
In all, the data presented in this report indicate that the -863C/A polymorphism in the promoter region of the TNF-[alpha] gene influences TNF-[alpha] expression and suggest that it may be a useful genetic marker for resolving the issue of whether a causal relationship exists between TNF-[alpha] and human disease.
MATERIALS AND METHODS
Subjects
A total of 254 men aged 35-50 years (45.3 ± 5.3 years, mean ± SD) were investigated. They were recruited at random from the general population of the greater Stockholm area using a registry containing all permanent residents in Stockholm County. Of those initially invited, 81% agreed to participate in the research programme. All the men were interviewed to exclude individuals with a history of cardiovascular disease. Additional exclusion criteria were symptoms of infectious disease, the presence of concomitant chronic disorders, such as severely impaired renal function, arteritis, collagenosis and diabetes mellitus, a history of alcohol abuse or other forms of addiction, and non-Swedish origin of the subject. All subjects gave their informed consent to participate in the study, the protocol of which had been approved by the local ethics committee.
Cell culture
The human hepatoblastoma cell line HepG2 was cultured in 90 mm dishes in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (FCS). The human monocyte/macrophage cell line U937 was cultured in 7.5% FCS-RPMI 1640 medium in standard tissue culture flasks in a humidified air/CO2 (19:1) incubator at 37°C. U937 cell density was kept between 0.2 and 1 × 106 cells/ml.
Blood sampling, biochemical methods and DNA procedures
Blood was drawn into sterile vacutainer tubes, and prepared by centrifugation (1.750 g for 10 min) at 2 h after venepuncture. For DNA procedures, nucleated cells from frozen whole blood were prepared according to Sambrook et al. (35), and DNA was extracted by a salting-out method (36). The TNF-[alpha] concentration was determined in duplicate in serum samples obtained from 156 unselected individuals belonging to the original population of 254 healthy middle-aged men, using the Quantikine High Sensitivity assay as recommended by the manufacturer (R&D Systems, Minneapolis, MN).
Gene sequencing
For the nucleotide sequencing of the promoter region of the TNF-[alpha] gene, a 1263 bp section of the proximal promoter, spanning from position -1214 to +49, was amplified by PCR, using the forward primer 5[prime]-TCTGGGAGTGAGAACTTCCC and the reverse primer 5[prime]-CCCTCTTAGCTGGTCCTCTG. This PCR fragment was used as template for further amplifications as part of the Taq DyeDeoxy Terminator Cycle sequencing system (Perkin Elmer, Applied Biosystems Division, Foster City, CA). Nested primers, designed on the basis of the published sequences of the promoter of the TNF-[alpha] gene (29,37,38), were used for the analysis of overlapping sections of 200-300 bp in both directions.
Genotyping
Genotyping for the -238G/A polymorphism was performed using a PCR fragment amplified by the forward primer 5[prime]-AAACAGACCACAGACCTGGTC and the reverse primer 5[prime]-CTCACACTCCCCATCCTCCCGGATC. The reverse primer contained two nucleotide mismatches (underlined), which made it possible to use the restriction enzyme BamHI for the detection of the -238G/A polymorphism. The -308G/A polymorphism was analysed using the forward primer 5[prime]-GAGGCAATAGGTTTTGAGGGCCAT and the reverse primer 5[prime]-GGGACACACAAGCATCAAG. The forward primer contained one nucleotide mismatch (underlined), which made it possible to use the restriction enzyme NcoI for the detection of the -308G/A polymorphism. Genotyping for the -857C/T and -863C/A polymorphisms was performed using the forward primer 5[prime]-GGCTCTGAGGAATGGGTTAC and the reverse primers 5[prime]-CCTCTACATGGCCCTGTCTAC and 5[prime]-CTACATGGCCCTGTCTTCGTTACG, respectively. The two reverse primers each contain a nucleotide mismatch (underlined), which made it possible to detect both polymorphisms using the restriction enzyme TaiI. It is noteworthy that the reverse primer for the -863C/A polymorphism overlaps with the -857C/T polymorphism and contains the wild-type C nucleotide at the -857 position. The -1031T/C polymorphism was evaluated using the forward primer 5[prime]-TATGTGATGGACTCACCAGGT and the reverse primer 5[prime]-CCTCTACATGGCCCTGTCTT, followed by digestion with the restriction enzyme BbsI.
The conditions for the genotyping were: PCR in a 25 µl reaction mixture containing 50-500 ng of genomic DNA, 1.2 µM of the primers, 50 mM KCl, 10 mM Tris-HCl pH 9.0, 0.1% Triton X-100, 0.2 mM of each dNTP and 1 U Taq polymerase. The concentration of MgCl2 varied between the PCR reactions for the different polymorphisms and was 1.5 mM for the -238 locus, 1.0 mM for -308, 2.0 mM for -857, 1.25 mM for -863 and 0.83 mM for -1031. All amplifications except that for the -863 site contained a final concentration of 4% dimethyl sulfoxide. The reaction mixtures were incubated for 3 min at 94°C, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 1 min and extension at 72°C for 2 min. Digestions with the appropriate restriction enzymes were performed as described by the manufacturer (New England Biolabs, Hitchin, UK).
EMSA
The sequences of the double-stranded oligonucleotides used in EMSA were as follows:
-238, 5[prime]-ACCCCCCTCGGAATCGGAGCAGGGAGGATG; -308, 5[prime]-GTTTTGAGGGGCATGGGGACGGGGTTCAGC; -857, 5[prime]- TATGGGGACCCCCCCTTAACGAAGACAGGGCC; -863, 5[prime]-TATGGGGACCCCCCCTTAACGAAGACAGGGCC; and -1031, 5[prime]-GAGAAGCTGAGAAGATGAAGGAAAAGTCAG. The polymorphic sites are underlined. Nuclear extracts were prepared according to Alksnis et al. (39). All buffers were freshly supplemented with leupeptin (15 µg/ml), aprotinin (15 µg/ml), dithiothreitol (1 mM), EDTA (0.2 mM, pH 8.0) and phenylmethylsulfonyl fluoride (1.0 mM). The protein concentration in the extracts was estimated by the method of Kalb and Bernlohr (40). Incubation for EMSA was conducted as described (41), and the reaction products were applied to 7% (w/v) polyacrylamide gel (80:1 acrylamide/N,N[prime]-methylene-bisacrylamide weight ratio), whereafter electrophoresis was performed in 22.5 mM Tris/22.5 mM boric acid/0.5 mM EDTA buffer for 2.5 h at 200 V. Non-radioactive competitor DNAs, either identical, of the opposite allelic variant or of non-specific origin, were added in 400-fold excess of the labelled DNA.
DNA constructs
A 1078 bp fragment (from -1061 to +17) of the TNF-[alpha] promoter was subcloned from a genomic cosmid clone (ATCC 57590) obtained from American type culture collection (Rockville, MD). Briefly, a subfragment of the promoter was amplified using the forward primer 5[prime]-GAGGCCGCCAGACTGCAGCAG and the reverse primer 5[prime]-CTGTCCTTCTAGAGGGAGCGTCT. The amplification introduced an XbaI site (underlined) in the reverse primer. The PCR product was digested with PstI and XbaI and ligated into PstI-XbaI-cut pCAT basic vector (Promega, Madison, WI). The C->A point mutation at -863 was introduced by a QuickChange Site-Directed Mutagenesis Kit (Stratagene, Cambridge, UK).
Transient transfection assay
Confluent HepG2 cells were transfected using the calcium phosphate-DNA co-precipitation method, essentially as described (35). pSV-[beta]-galactosidase (Promega) was co-transfected as an internal control. In all experiments, 5 µg of CAT construct and 5 µg of [beta]-galactosidase plasmid were added to the medium. CAT activity was analysed using the method described by Sambrook et al. (35) and quantified using a phosphorimager (Bio-imaging Analyzer BAS-2500; Fuji Photo Film, Tokyo, Japan). [beta]-Galactosidase activity was determined as described by the supplier (Promega). CAT levels were expressed as a percentage of control (-863C) after standardization for [beta]-galactosidase activity. All constructs were tested in triplicate or duplicate in three independent transfection experiments.
Statistical methods
Distributions of continuous variables in groups were expressed as means ± SD. Logarithmic transformation was performed on all skewed variables to obtain a normal distribution before statistical computations and significance testing were undertaken. Allele frequencies were estimated by gene counting. A [chi]2 test was used to compare the observed numbers of each TNF-[alpha] genotype with those expected for a population in Hardy-Weinberg equilibrium. The normalized linkage disequilibrium coefficient (D[prime]) for all pairs of TNF-[alpha] polymorphisms was calculated according to Ott (42). One-way analyses of variance performed by the general linear model procedure were carried out to test whether genetic variation within the TNF-[alpha] locus was associated with differences in serum TNF-[alpha] concentration. The Scheffé multiple comparison test was used as a post-hoc test. Differences in transcriptional activity between promoter constructs were evaluated by Student's unpaired two-tailed t-test.
ACKNOWLEDGEMENTS
We thank Anastasia Iliadou BSc, Division of Genetic Epidemiology, Institute of Environmental Medicine, Karolinska Institutet, for help with statistical analyses. This work was supported by grants from the Swedish Medical Research Council (8311, 8691 and 12660), the Swedish Heart-Lung Foundation, the Marianne and Marcus Wallenberg Foundation, the Petrus and Augusta Hedlund Foundation, the Professor Nanna Svartz Foundation and the King Gustaf V 80th Birthday Foundation. P.E. holds a postdoctoral research fellowship from the Swedish Medical Research Council.
REFERENCES
*To whom correspondence should be addressed. Tel: +46 8 517 73221; Fax: +46 8 311298; Email tiinasko@instmed.ks.se
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  A. L. Van Dyke, M. L. Cote, A. S. Wenzlaff, W. Chen, J. Abrams, S. Land, C. N. Giroux, and A. G. Schwartz Cytokine and Cytokine Receptor Single-Nucleotide Polymorphisms Predict Risk for Non-Small Cell Lung Cancer among Women Cancer Epidemiol. Biomarkers Prev., June 1, 2009; 18(6): 1829 - 1840. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Liu, E. J. Metter, L. Ferrucci, and S. M. Roth TNF promoter polymorphisms associated with muscle phenotypes in humans J Appl Physiol, September 1, 2008; 105(3): 859 - 867. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-f. Cheung, G.-y. Huang, S.-b. Chen, X.-q. Liu, L. Xi, X.-c. Liang, M.-r. Huang, S. Chen, L.-s. Huang, X.-q. Liu, et al. Inflammatory Gene Polymorphisms and Susceptibility to Kawasaki Disease and Its Arterial Sequelae Pediatrics, September 1, 2008; 122(3): e608 - e614. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. W. Hsing, L. C. Sakoda, A. Rashid, G. Andreotti, J. Chen, B.-S. Wang, M.-C. Shen, B. E. Chen, P. S. Rosenberg, M. Zhang, et al. Variants in Inflammation Genes and the Risk of Biliary Tract Cancers and Stones: A Population-Based Study in China Cancer Res., August 1, 2008; 68(15): 6442 - 6452. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Gingo, L. J. Silveira, Y. E. Miller, A. L. Friedlander, G. P. Cosgrove, E. D. Chan, L. A. Maier, and R. P. Bowler Tumour necrosis factor gene polymorphisms are associated with COPD Eur. Respir. J., May 1, 2008; 31(5): 1005 - 1012. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-J. Chang, P.-C. Tsai, C.-J. Chen, H.-M. Lai, and Y.-C. Ko The polymorphism -863C/A in tumour necrosis factor-{alpha} gene contributes an independent association to gout Rheumatology, November 1, 2007; 46(11): 1662 - 1666. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Oda, N. Tanaka, T. Arai, J. Araki, Y. Song, L. Zhang, A. Kuchiba, T. Hosoi, T. Shirasawa, M. Muramatsu, et al. Polymorphisms in pro- and anti-inflammatory cytokine genes and susceptibility to atherosclerosis: a pathological study of 1503 consecutive autopsy cases Hum. Mol. Genet., March 15, 2007; 16(6): 592 - 599. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Purdue, Q. Lan, A. Kricker, A. E. Grulich, C. M. Vajdic, J. Turner, D. Whitby, S. Chanock, N. Rothman, and B. K. Armstrong Polymorphisms in immune function genes and risk of non-Hodgkin lymphoma: findings from the New South Wales non-Hodgkin Lymphoma Study Carcinogenesis, March 1, 2007; 28(3): 704 - 712. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sharma, A. Sharma, S. Kumar, S. K. Sharma, and B. Ghosh Association of TNF Haplotypes with Asthma, Serum IgE Levels, and Correlation with Serum TNF-{alpha} Levels Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 488 - 495. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. M. Ramos, M.-T. Lin, E. B. Larson, I. Maezawa, L.-H. Tseng, K. L. Edwards, G. D. Schellenberg, J. A. Hansen, W. A. Kukull, and L.-W. Jin Tumor Necrosis Factor {alpha} and Interleukin 10 Promoter Region Polymorphisms and Risk of Late-Onset Alzheimer Disease. Arch Neurol, August 1, 2006; 63(8): 1165 - 1169. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Ma, G. Ruan, Y. Wang, Q. Li, P. Zhu, Y.-Z. Qin, J.-L. Li, Y.-R. Liu, D. Ma, and H. Zhao Two Single-Nucleotide Polymorphisms with Linkage Disequilibrium in the Human Programmed Cell Death 5 Gene 5' Regulatory Region Affect Promoter Activity and the Susceptibility of Chronic Myelogenous Leukemia in Chinese Population Clin. Cancer Res., December 15, 2005; 11(24): 8592 - 8599. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. S. Monraats, N. M. M. Pires, A. Schepers, W. R. P. Agema, L. S. M. Boesten, M. R. de Vries, A. H. Zwinderman, M. P. M. de Maat, P. A. F. M. Doevendans, R. J. de Winter, et al. Tumor necrosis factor-{alpha} plays an important role in restenosis development FASEB J, December 1, 2005; 19(14): 1998 - 2004. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F Navaglia, D Basso, C-F Zambon, E Ponzano, L Caenazzo, N Gallo, A Falda, C Belluco, P Fogar, E Greco, et al. Interleukin 12 gene polymorphisms enhance gastric cancer risk in H pylori infected individuals J. Med. Genet., June 1, 2005; 42(6): 503 - 510. [Full Text] [PDF]
|
|
|
|
 |
|
 T. O. White, P. J. Jenkins, R. D. Smith, C. W.J. Cartlidge, and C. M. Robinson The Epidemiology of Posttraumatic Adult Respiratory Distress Syndrome J. Bone Joint Surg. Am., November 1, 2004; 86(11): 2366 - 2376. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Asghar, S. Yoshida, S. Kennedy, K. Negoro, W. Zhuo, S. Hamana, S. Motoyama, S. Nakago, D. Barlow, and T. Maruo The tumor necrosis factor-{alpha} promoter -1031C polymorphism is associated with decreased risk of endometriosis in a Japanese population Hum. Reprod., November 1, 2004; 19(11): 2509 - 2514. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. L. Ma, N. L.S. Tang, L. C.W. Lam, and H. F.K. Chiu Association between tumor necrosis factor-{alpha} promoter polymorphism and Alzheimer's disease Neurology, January 27, 2004; 62(2): 307 - 309. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Heesen, D. Kunz, M. Wessiepe, T. van der Poll, A. H. Zwinderman, and B. Blomeke Rapid Genotyping for Tumor Necrosis Factor-{alpha} (TNF-{alpha}) -863C/A Promoter Polymorphism That Determines TNF-{alpha} Response Clin. Chem., January 1, 2004; 50(1): 226 - 228. [Full Text] [PDF]
|
|
|
|
|
|
Y. J. Kim, H.-S. Lee, J.-H. Yoon, C. Y. Kim, M. H. Park, L. H. Kim, B. L. Park, and H. D. Shin Association of TNF-{alpha} promoter polymorphisms with the clearance of hepatitis B virus infection Hum. Mol. Genet., October 1, 2003; 12(19): 2541 - 2546. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Giordani, P. Bruzzi, C. Lasalandra, M. Quaranta, F. Schittulli, F. Della Ragione, and A. Iolascon Association of Breast Cancer and Polymorphisms of Interleukin-10 and Tumor Necrosis Factor-{alpha} Genes Clin. Chem., October 1, 2003; 49(10): 1664 - 1667. [Full Text] [PDF]
|
|
|
|
 |
|
 S. Tuglular, P. Berthoux, and F. Berthoux Polymorphisms of the tumour necrosis factor {alpha} gene at position -308 and TNFd microsatellite in primary IgA nephropathy Nephrol. Dial. Transplant., April 1, 2003; 18(4): 724 - 731. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Amicosante, F. Berretta, A. Franchi, P. Rogliani, C. Dotti, M. Losi, R. Dweik, and C. Saltini HLA-DP-unrestricted TNF-{alpha} release in beryllium-stimulated peripheral blood mononuclear cells Eur. Respir. J., November 1, 2002; 20(5): 1174 - 1178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shen, L. Wang, M. R. Spitz, W. K. Hong, L. Mao, and Q. Wei A Novel Polymorphism in Human Cytosine DNA-Methyltransferase-3B Promoter Is Associated with an Increased Risk of Lung Cancer Cancer Res., September 1, 2002; 62(17): 4992 - 4995. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. van Heel, I. A. Udalova, A. P. De Silva, D. P. McGovern, Y. Kinouchi, J. Hull, N. J. Lench, L. R. Cardon, A. H. Carey, D. P. Jewell, et al. Inflammatory bowel disease is associated with a TNF polymorphism that affects an interaction between the OCT1 and NF-{kappa}B transcription factors Hum. Mol. Genet., May 16, 2002; 11(11): 1281 - 1289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Skoog, W. Dichtl, S. Boquist, C. Skoglund-Andersson, F. Karpe, R. Tang, M.G. Bond, U. de Faire, J. Nilsson, P. Eriksson, et al. Plasma tumour necrosis factor-{alpha} and early carotid atherosclerosis in healthy middle-aged men Eur. Heart J., March 1, 2002; 23(5): 376 - 383. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. A. Hendrickson, R. Gokhale, and J. H. Cho Clinical Aspects and Pathophysiology of Inflammatory Bowel Disease Clin. Microbiol. Rev., January 1, 2002; 15(1): 79 - 94. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Post, R. Laham, F. W. Sellke, and M. Simons Therapeutic angiogenesis in cardiology using protein formulations Cardiovasc Res, February 16, 2001; 49(3): 522 - 531. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. A. Udalova, A. Richardson, A. Denys, C. Smith, H. Ackerman, B. Foxwell, and D. Kwiatkowski Functional Consequences of a Polymorphism Affecting NF-kappa B p50-p50 Binding to the TNF Promoter Region Mol. Cell. Biol., December 15, 2000; 20(24): 9113 - 9119. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||