| Human Molecular Genetics | Pages |
©1999 Oxford University Press |
Characterization of the Menkes protein copper-binding domains and their role in copper-induced protein relocalization
Introduction
Results
The recombinant MNK protein behaves identically to the intrinsic protein
Mutational analysis of the MNK copper-binding domains
Discussion
Materials And Methods
Construction of Menkes full-length cDNA and copper-binding domain mutants
Tissue culture and transfection
Copper movement and immunofluorescence
Acknowledgements
References
Characterization of the Menkes protein copper-binding domains and their role in copper-induced protein relocalization
Received February 18, 1999; Revised and Accepted May 6, 1999
Menkes disease is a fatal X-linked disorder of copper metabolism. The gene defective in Menkes disease (ATP7A) encodes a copper transporting P-type ATPase (MNK or ATP7A) with six copper-binding domains at its N-terminus. MNK is normally localized to the trans-Golgi network in cultured cells, but relocates to the plasma membrane in the presence of elevated extracellular copper. In this study, the role of the six copper-binding domains on copper-induced redistribution is investigated. In a recombinant clone, when all the wild-type copper-binding motifs are mutated from GMXCXXC to GMXSXXS and the cells grown in medium containing elevated copper, relocalization of the recombinant protein to the plasma membrane was not observed. Using the same assay with any one of the six copper-binding domains intact, MNK moves to the plasma membrane in a way indistinguishable from the wild-type protein. Therefore, the copper-binding domains are vital for MNK trafficking and only a single domain is sufficient for this redistribution to occur.
INTRODUCTION
Menkes disease is an X-linked inherited disorder affecting copper metabolism. The gene defective in Menkes disease (ATP7A) encodes for the transmembrane protein MNK or ATP7A (1-3). MNK is a P-type ATPase which contains six repeats of the heavy metal-associated (HMA) sequence GMXCXXC in the N-terminus of the protein (4). The HMA motif is well conserved and is also found in a number of bacterial heavy metal-binding proteins. These include the cadmium resistance gene cadA from Staphylococcus aureus, the copper homeostasis genes copA and copB from Enterococcus hirae and the mercury resistance genes merA and merB from Bacillus spp. and Pseudomonas aeruginosa (5). The HMA motif is also found in the copper chaperone ATOX1 and its yeast homologue ATX1 (6). It has been shown that the HMA motif binds copper in either a two or three coordinate manner involving the two cysteines and sometimes also the methionine (7,8). When the first three HMA domains of a recombinant human MNK clone were mutated from GMXCXXC to GMXSXXS and the protein expressed in Saccharomyces cerevisiae, MNK no longer transported copper for incorporation into the cuproenzyme Fet3p (9).
The Menkes protein localizes to the trans-Golgi network (TGN) where it transports copper into the lumen for incorporation into cuproenzymes such as lysyl oxidase (10). The trans-Golgi location of the protein has been confirmed by co-localization experiments using immunofluorescence and known trans-Golgi enzyme markers (11-14), studies using brefeldin A (11,13) and by immunoelectron microscopy (15).
Overexpression of MNK in Chinese hamster ovary (CHO) cells is associated with copper resistance and an increased efflux of copper from the cells (16). Menkes disease cells accumulate copper and show a decreased rate of copper efflux compared with normal cells (17-19). These observations suggest that the Menkes disease protein has a role in copper efflux. Consistent with this proposed function is the observation that when cultured cells are stressed with copper there is a rapid and reversible redistribution of MNK to the plasma membrane and other non-Golgi vesicles (11,15,20). This redistribution does not require new protein synthesis and when MNK is overexpressed in CHO cells, the redistribution is detectable within 10 min of placing the cells in copper (11). When these overexpressing CHO cells were treated with drugs that block endocytosis (bafilomycin A1, chloroquine and ammonium chloride), MNK accumulated in small vesicles, suggesting that MNK is continually recycling between the TGN and the plasma membrane. On addition of copper to the medium the equilibrium shifts either by increased trafficking to the plasma membrane or by inhibition of the return journey to the TGN (11).
To date, two regions of the MNK protein have been found to play a role in localizing the protein within the cell. A TGN retention sequence has been identified in the third transmembrane domain (14,21) and a di-leucine motif at the C-terminus has been proposed to mediate the internalization of the protein from the plasma membrane (20,22). In this study, we focus on the role of the six copper-binding domains in protein trafficking. A comprehensive mutagenic study was performed where the cysteines in the copper-binding domains were mutated to serines producing mutants similar to those that have been shown to disrupt copper transport (9). Serine is similar in size to cysteine and yet, unlike the wild-type sequence GMXCXXC, the mutant sequence GMXSXXS will not bind copper (7,8). This makes serine an appropriate choice for mutation studies of these copper-binding domains. Clones containing only a single active copper-binding domain were constructed and the effect of copper on the redistribution of the protein investigated. We demonstrate that the copper-binding domains are essential for trafficking of the protein to the plasma membrane when the cell is stressed with copper. We also show that any one of these copper-binding domains is sufficient for this trafficking to occur.
RESULTS
The recombinant MNK protein behaves identically to the intrinsic protein
Human MRC5/V2 fibroblasts (23) were transfected with pCEP4MnkFL. This episomal vector expresses a recombinant protein consisting of the full-length Menkes protein fused with the 17 amino acid c-myc epitope at the C-terminus (14). To test for appropriate expression, western blot analysis was performed with the anti-myc monoclonal antibody. A band of 170 kDa was detected (data not shown). This agrees with the predicted size of the full-length recombinant Menkes fusion protein and with western blots performed by our group and others (9,12,14,15,24,25). Untransfected fibroblasts are not recognized by the anti-myc antibody (data not shown), demonstrating that the anti-myc antibody is specific for the recombinant protein and allowing the recombinant protein to be analysed independently of the native protein.
Under physiological conditions, the recombinant Menkes fusion protein has a perinuclear location (Fig. 1A) consistent with the TGN localization described previously (11-15,24). When the cells are incubated for 24 h in increasing concentrations of copper, increasing amounts of recombinant protein move to cytoplasmic vesicles and the plasma membrane (Fig. 1B-D). In 100 µM copper, some movement is observed (Fig. 1B) and in 200 µM the trend is even clearer (Fig. 1C). At 600 µM, the redistribution to the plasma membrane is most pronounced (Fig. 1D). The same movement was observed after 12 or 48 h in elevated copper (data not shown). Although the expression levels in individual cells varied, the overall distribution was consistent under each condition. On removal of the copper and incubation of the cells in basal medium for a further 24 h, the protein returns to a perinuclear location (Fig. 1E). This is consistent with previous reports showing the Menkes protein TGN location in physiological copper (12-14) and its trafficking in response to elevated copper (11,15,20,24). The results in Figure 1 show that the recombinant MNK-MYC fusion protein behaves identically to the wild-type MNK protein and the C-terminal c-myc tag does not interfere with the trafficking of MNK.
Figure 1. Copper-dependent relocalization of the wild-type recombinant MNK protein. Human fibroblasts were transfected with pCEP4MnkFL. Following transfection the cells were placed in medium containing copper at (A) basal levels, (B) 100 µM, (C) 200 µM or (D and E) 600 µM. After 24 h, the cells in (A)-(D) were fixed for immunofluorescence. Cells in (E) were returned to basal copper for 24 h and then fixed. To detect the recombinant MNK protein immunofluorescence was performed using anti-myc antibody.
Mutational analysis of the MNK copper-binding domains
A mutant, pCEP4[Delta]CB1-6, where all six copper-binding domains were mutated from GMXCXXC to GMXSXXS, was constructed. Unlike the wild-type protein, this mutant does not redistribute in the presence of 600 µM copper (Fig. 2). A small proportion of the recombinant mutant protein was detected in non-Golgi vesicles at all copper concentrations, suggesting that like the native protein (11) this recombinant protein is continually cycling between the TGN and the plasma membrane. Unlike the wild-type protein, the proportion of mutant protein in these vesicles did not increase with increasing levels of copper (Fig. 2). This shows that the copper-binding domains are essential for trafficking to occur.
Figure 2. The [Delta]1-6 mutant does not move in the presence of increased copper. Human fibroblasts were transfected with pCEP4[Delta]CB1-6. Following transfection, the cells were placed in either normal complete medium or medium containing 600 µM copper. After 24 h, the cells were fixed and the recombinant MNK protein detected using the anti-myc antibody.
A mutant, pCEP4[Delta]CB5, was prepared where the fifth copper-binding domain was mutated from GMXCXXC to GMXSXXS. A second mutant, pCEP4CB5WT, was constructed where only the fifth copper-binding domain was the wild-type sequence. If a single specific copper-binding domain was responsible for the copper-induced relocalization it would be expected that one of these mutants would behave like the wild-type protein and the other like pCEP4[Delta]CB1-6. As can be seen in Figure 3, this is not the case. Both of the mutant clones pCEP4[Delta]CB5 and pCEP4CB5WT redistribute to the plasma membrane in the presence of 600 µM copper. Like the wild-type fusion protein, this relocalization is also evident in the presence of 200 µM copper (data not shown). Both mutants also return to a perinuclear location once the extracellular copper is removed. Figure 3 shows that the fifth copper-binding domain is sufficient to cause relocalization. When the fifth copper-binding domain is removed, however, one of the other five copper-binding regions can substitute and the protein traffics normally. This suggests that more than one single copper-binding domain can traffic the protein.
Figure 3. The CB5WT and [Delta]CB5 mutants behave like the wild-type MNK clone. Human fibroblasts were transfected with either pCEP4CB5WT or pCEP4[Delta]CB5. The cells were incubated in (A) basal medium for 24 h, (B) basal medium supplemented with 600 µM copper for 24 h or (C) medium supplemented with 600 µM copper for 24 h followed by basal medium for a following 24 h. The cells were then fixed and permeabilized with methanol and the recombinant protein detected using the anti-myc antibody.
To determine which copper-binding domains could cause the protein to move in the presence of copper, an exhaustive series of mutants were prepared where a single copper-binding domain was the wild-type sequence and the other five were mutated. These mutants were designated pCEP4CB1WT, pCEP4CB2WT, pCEP4CB3WT, pCEP4CB4WT and pCEP4CB6WT. All of the mutants have a perinuclear location when placed in medium containing physiological levels of copper (Fig. 4). The effect of 600 µM copper on these mutants was investigated. As can be seen in Figure 4, all of these mutants behaved identically to the wild-type protein (Fig. 1), moving to cytoplasmic vesicles and the plasma membrane in the presence of 600 µM copper. All of these mutants also behaved in a way indistinguishable from the wild-type protein when placed in medium containing 50, 100, 150 and 200 µM copper for 24 h (data not shown).
Figure 4. Copper-induced relocalization in clones with only one functional copper-binding domain. Human MRC5/V2 fibroblasts were transfected with mutant Menkes clones that contained only one functional copper-binding domain. The cells were placed in either normal medium or medium containing 600 µM copper for 24 h before they were fixed and immunofluorescence performed.
These results show that any single copper-binding domain is sufficient to cause trafficking of the Menkes protein from the TGN to the plasma membrane when the cell is challenged with high concentrations of copper.
DISCUSSION
Previous reports from our group and others have identified a Golgi retention signal in the third transmembrane region and a di-leucine retrieval signal at the C-terminus of the MNK protein (14,20,22). This report shows that the copper-binding domains constitute a third important region that controls MNK distribution and its copper-induced trafficking.
Our results also show that any one of the six copper-binding domains is sufficient to effect this TGN to plasma membrane relocalization. This appears to be in contrast to the copper transporting activity of the protein. Studies in S.cerevisiae used FET3p-dependent growth (26,27) as an indirect measurement of copper transport and found that some copper-binding domains of the human Menkes protein were more important than others (9). In copper- and iron-deficient medium [Delta]CCC2 yeast cannot grow. Expression of MNK in these cells restores Fet3p activity and therefore growth (9). Cells expressing a mutant MNK clone where the first copper-binding domain is mutated showed 84% of the growth of cells expressing wild-type MNK. When the second copper-binding domain is also removed, a further 4% reduction in growth was observed (79% of cells expressing wild-type MNK). However, when the first three copper-binding domains were ablated negligible growth was observed, suggesting that the copper transport activity of the clones was destroyed (9). As this clone has the last three copper-binding domains intact, it shows that no single copper-binding domain is sufficient for copper transport. It also shows that the first two copper-binding domains have some effect on copper transport activity and suggests that the third copper-binding domain may be critical for MNK to act as a copper transporter.
A second human copper-transporting ATPase has been identified that is responsible for Wilson's disease. Like MNK, the Wilson disease protein (WND) is a P-type ATPase with six copper-binding domains at the N-terminus (28,29). WND is normally expressed in the liver and the brain, whereas MNK is expressed in most other tissues. WND is also normally localized to the TGN and can correct the copper transport defect found in a Menkes cell line, suggesting that these two proteins have complementary roles (24).
The redistribution of MNK to the plasma membrane in the presence of high levels of copper is possibly a functionally important process for the cell. When copper is present at toxic levels, this mechanism may help to ensure that excess copper is quickly and efficiently removed from the cell. Another strategy, to increase the rate of MNK synthesis in response to increased copper, does not occur (11). One possible explanation is that the synthesis of new MNK protein would be expected to be a relatively slow process requiring several hours. It is faster for the cell to recruit already synthesized MNK and re-deploy it to the plasma membrane. This trafficking has been reported to occur within 10 min in CHO cells, making this potential mechanism much faster than de novo protein synthesis (11).
If excess copper is not quickly removed from the cell and remains at toxic levels for several hours another mechanism appears to be utilized. This second mechanism does involve new protein synthesis. The copper scavenger metallothionein contains metal response elements (MRE) in its promoter and has been shown to be up-regulated in human fibroblasts in response to copper (30-34). This suggests that MNK may form the first line of defence to remove excess copper. If MNK is ineffectual and the increased copper efflux does not reduce the intracellular copper concentration, new metallothionein synthesis appears to act as a second defence mechanism.
Along with MNK there are many other examples of human proteins that are moved to the plasma membrane in response to a stimulus (35). An example is aquaporin2 (AQP2), the protein deficient in congenital nephrogenic diabetes (36). In the absence of antidiuretic hormone (ADH), the apical membrane surface of the mammalian kidney is virtually impermeable to water. AQP2 resides in endosomes that fuse with the plasma membrane when ADH interacts with its basolateral receptors and activates adenylate cyclase (35,37).
Another example is the mammalian insulin-responsive glucose transporter, GLUT4, which moves from specialized microsomes to the plasma membrane in response to insulin (38,39). This allows the muscles cells to respond very rapidly to changing demands for glucose by rapidly increasing the number of glucose transporters at the cell surface (39,40). Using immunoelectron microscopy, GLUT4 has been located in the TGN, the plasma membrane, endosomes and clathrin-coated vesicles. In the absence of insulin, however, the majority of GLUT4 is located in specialized vesicles that are located just below the cell surface (41,42). Following insulin treatment, these vesicles fuse with the plasma membrane.
The S.cerevisiae Menkes homologue CCC2 has only two copper-binding domains and yet transports copper and has a TGN location (26,43). This suggests that in MNK only two copper-binding domains may be required for copper transport. The copA gene from E.hirae also has homology to MNK but only has a single copper-binding domain. A Wilson disease mutant protein containing only the sixth copper-binding domain could rescue [Delta]CCC2 knockout S.cerevisiae, indicating that the first five Wilson disease copper-binding domains were unnecessary for copper transport (44). This report shows that any single copper-binding domain can cause MNK to move to the plasma membrane in high copper, and it appears that mutation of the first two copper-binding domains reduce Fet3p-dependent S.cerevisiae growth by only 21% (9). It is unclear why MNK has six copper-binding domains, but it is possible that all six are required for full copper transporting activity.
Although every copper-binding domain can act alone to cause the trafficking of MNK, we expect there to be a specific interaction. The function of the retention signal located in the third transmembrane region may be inhibited when copper binds to one of the copper-binding domains. One model to explain the action of transmembrane 3 is kin recognition. The kin recognition model postulates that MNK will oligomerize, preventing its incorporation into the transport vesicles (45,46). Bound copper may maintain MNK as a monomer, causing it to be moved to the cell surface. Another model postulates that copper bound to an N-terminal copper-binding domain may interact with the C-terminal di-leucine at the plasma membrane and inhibit the retrieval of MNK.
It is also possible that the trafficking involves the copper chaperone ATOX1. This chaperone is the human homologue of the yeast protein ATX1 and is believed to shuttle between the plasma membrane and the TGN as it carries copper from the transporter in the plasma membrane (hCTR1; 47) to the MNK protein in the TGN (48,49). This raises the possibility that during the chaperone's return journey to the plasma membrane the ATOX1-copper-MNK ternary complex may be involved in the copper-induced movement. Alternatively, copper-loaded ATOX1 may inhibit the return of MNK from the plasma membrane to the TGN by interacting with the copper-binding domains.
This study identifies a third important region of the MNK protein in protein trafficking. It also extends our knowledge of the control regions involved in MNK localization. Specifically, it shows that the N-terminal copper-binding domains are essential for copper-induced relocalization to occur. It also shows that only one of the copper-binding domains needs to be functional for MNK to redistribute and it provides an insight into how the cell copes with potentially damaging concentrations of copper.
MATERIALS AND METHODS
Construction of Menkes full-length cDNA and copper-binding domain mutants
The Menkes full-length cDNA containing the c-myc 9E10 epitope at the C-terminus (14) was cloned into pCEP4 (Invitrogen, Groningen, The Netherlands) producing the clone pCEP4MnkFL. The mammalian episomal expression vector pCEP4 drives expression of cDNAs placed into the polylinker via the high level, constitutive CMV promoter. Before cloning the Menkes cDNA into the NotI site, the pCEP4 multiple cloning site was modified to remove the BamHI site by digestion with BamHI and XbaI, filling in with Klenow and re-ligating.
The full-length Menkes cDNA clone was digested with BamHI and the 1.7 kb fragment containing all six copper-binding domains was cloned into pBluescript SKII- (Stratagene, La Jolla, CA). Each of the six copper-binding motifs, GMXCXXC, was mutated to GMXSXXS using the Clontech Transformer Site-Directed Mutagenesis system. The selection primer was alternated between one that removed the unique SacI site from the polylinker, replacing it with a SphI site (CAAAAGCTGGCATGCCACCGCGGT), and one that returned the polylinker sequence to wild-type (CAAAAGCTGGAGCTCCACCGCGGT). Each of the six copper-binding domains were sequentially mutated to produce a mutant with all six copper binding domains removed (pCEP4[Delta]CB1-6) using the following mutagenic primers: [Delta]CB1, ACTTCGAATTCCAGTGTTTGGACC; [Delta]CB2, ACCAGCCATTCAAGTACTAGCACT; [Delta]CB3, GATGGGATGCATAGTAAATCAAGTGTGTCA; [Delta]CB4, ACTAGTAATTCCAGTGTGCAGTCT; [Delta]CB5, ACTAGCGCTTCCAGTGTAGCAAAC; [Delta]CB6, ACGTCTGCCTCCAGCGTACATAAA. As an intermediary, a clone where all the copper-binding domains apart from the fifth were mutated was constructed, pCEP4CB5WT. The clone pCEP4[Delta]CB1-6 was then used in five separate mutagenesis reactions, each one mutating a single copper-binding domain back to the wild-type sequence. The five mutagenic primers used in this step were: CB1WT, GGTATGACTTGCAATTCCTGTGTTTGGACC; CB2WT, GGGATGACCTGCCATTCATGTACTAGCACT; CB3WtdSphI, GGGATGCATTGTAAATCATGTGTGTCAAAT; CB4WT, GGCATGACTTGTAATTCCTGTGTGCAGTCT; CB6WT, GGAATGACGTGTGCCTCCTGCGTACATAAA. Each mutagenic primer altered the restriction pattern of the clone, allowing easy selection of mutants by restriction digestion of the minipreps. The integrity of each mutant BamHI fragment was then confirmed by sequencing.
The mutant BamHI fragments were gel purified (using Geneclean; Bio101, Vista, CA) and ligated with BamHI-cut and alkaline phosphatase-treated pCEP4MnkFL to produce the full-length mutant constructs. Large scale preparation of these full-length constructs was performed by a modification of the Qiagen maxiprep method as described previously (14). The integrity of all the clones was confirmed by sequencing.
Tissue culture and transfection
The human fibroblast cell line MRC5/V2 (23) was grown using standard tissue culture techniques in complete medium [Dulbecco's modified Eagle's medium (Life Technologies, Paisley, UK) supplemented with 10% fetal bovine serum, penicillin, streptomycin and 2 mM L-glutamine].
On the day before transfection, two poly-L-lysine-coated 13 mm coverslips were placed in the bottom of a 60 mm Petri dish. The MRC5/V2 cells were harvested with trypsin and 5 × 105 cells placed in each Petri dish. The following day this gave ~50% confluency. Transfection was performed using the cationic lipid Superfect (Qiagen, Crawley, UK), using the manufacturer's instructions (5 µg of pCEP4 DNA, 150 µl unsupplemented medium and 30 µl Superfect).
Copper movement and immunofluorescence
The coverslip containing the transfected fibroblasts was placed in a well of a 6-well dish containing 2 ml of complete medium that had been supplemented with copper chloride to give the desired copper concentration. After 24 h the cells were either fixed or the medium was replaced with complete medium that contained physiological concentrations of copper for a further 24 h.
The cells were fixed onto the coverslip using ice-cold 100% methanol at -20°C for 5 min. After fixation, non-specific binding was blocked using 0.2% bovine serum albumin in phosphate-buffered saline (PBS). The cells were washed three times with PBS and then incubated in a 1/250 dilution of mouse anti-myc 9E10 antibody for 1 h. After a further three washes in PBS, the coverslip was incubated for 1 h in fluorescein-conjugated sheep anti-mouse secondary antibody (Sigma, Poole, UK) in PBS. After a final three washes, the coverslip was mounted on a slide using Vectorshield containing propidium iodide (Vector laboratories, Peterborough, UK).
The cells were viewed on a MRC1024 confocal microscope (Bio-Rad, Hemel Hempstead, UK) and a Nikon Optiphot-2 microscope using Lasersharp v.3 software (Bio-Rad). In each case, the gain was adjusted until the green channel was just saturating. All images were captured with a 60×, 1.4 oil immersion Nikon lens using a zoom setting of 2.0. The images were then imported into Adobe Photoshop v.3.0 and printed on a Tektronix Phaser 740 printer.
ACKNOWLEDGEMENTS
We thank Elaine Levy for assistance with the confocal microscope, and the Imperial Cancer Research Fund for the anti-myc 9E10 monoclonal antibody. This work was supported by funding from the Wellcome Trust and the Imperial Cancer Research Fund. A.P.M. is a Wellcome Principal Research Fellow.
REFERENCES
*To whom correspondence should be addressed. Tel: +44 1865 287510; Fax: +44 1865 287501; Email: michael.francis{at}well.ox.ac.uk
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  Z. G. Holloway, R. Grabski, T. Szul, M. L. Styers, J. A. Coventry, A. P. Monaco, and E. Sztul Activation of ADP-ribosylation factor regulates biogenesis of the ATP7A-containing trans-Golgi network compartment and its Cu-induced trafficking Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1753 - C1767. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P de Bie, P Muller, C Wijmenga, and L W J Klomp Molecular pathogenesis of Wilson and Menkes disease: correlation of mutations with molecular defects and disease phenotypes J. Med. Genet., November 1, 2007; 44(11): 673 - 688. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. De, G. D. Ciccotosto, R. E. Mains, and B. A. Eipper Trafficking of a Secretory Granule Membrane Protein Is Sensitive to Copper J. Biol. Chem., August 10, 2007; 282(32): 23362 - 23371. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Lutsenko, N. L. Barnes, M. Y. Bartee, and O. Y. Dmitriev Function and Regulation of Human Copper-Transporting ATPases Physiol Rev, July 1, 2007; 87(3): 1011 - 1046. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Banci, I. Bertini, F. Cantini, N. DellaMalva, T. Herrmann, A. Rosato, and K. Wuthrich Solution Structure and Intermolecular Interactions of the Third Metal-binding Domain of ATP7A, the Menkes Disease Protein J. Biol. Chem., September 29, 2006; 281(39): 29141 - 29147. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Lim, M. A. Cater, J. F. B. Mercer, and S. La Fontaine Copper-dependent Interaction of Dynactin Subunit p62 with the N Terminus of ATP7B but Not ATP7A J. Biol. Chem., May 19, 2006; 281(20): 14006 - 14014. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Guo, L. Nyasae, L. T. Braiterman, and A. L. Hubbard NH2-terminal signals in ATP7B Cu-ATPase mediate its Cu-dependent anterograde traffic in polarized hepatic cells Am J Physiol Gastrointest Liver Physiol, November 1, 2005; 289(5): G904 - G916. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Bitoun, A. Micheloni, L. Lamant, C. Bonnart, A. Tartaglia-Polcini, C. Cobbold, T. Al Saati, F. Mariotti, J. Mazereeuw-Hautier, F. Boralevi, et al. LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syndrome Hum. Mol. Genet., October 1, 2003; 12(19): 2417 - 2430. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. C. Steveson, G. D. Ciccotosto, X.-M. Ma, G. P. Mueller, R. E. Mains, and B. A. Eipper Menkes Protein Contributes to the Function of Peptidylglycine {alpha}-Amidating Monooxygenase Endocrinology, January 1, 2003; 144(1): 188 - 200. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Petris, I. Voskoboinik, M. Cater, K. Smith, B.-E. Kim, R. M. Llanos, D. Strausak, J. Camakaris, and J. F. B. Mercer Copper-regulated Trafficking of the Menkes Disease Copper ATPase Is Associated with Formation of a Phosphorylated Catalytic Intermediate J. Biol. Chem., November 22, 2002; 277(48): 46736 - 46742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B.-E. Kim, K. Smith, C. K. Meagher, and M. J. Petris A Conditional Mutation Affecting Localization of the Menkes Disease Copper ATPase. SUPPRESSION BY COPPER SUPPLEMENTATION J. Biol. Chem., November 8, 2002; 277(46): 44079 - 44084. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Puig, J. Lee, M. Lau, and D. J. Thiele Biochemical and Genetic Analyses of Yeast and Human High Affinity Copper Transporters Suggest a Conserved Mechanism for Copper Uptake J. Biol. Chem., July 12, 2002; 277(29): 26021 - 26030. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. DiDonato, J. Zhang, L. Que Jr., and B. Sarkar Zinc Binding to the NH2-terminal Domain of the Wilson Disease Copper-transporting ATPase. IMPLICATIONS FOR IN VIVO METAL ION-MEDIATED REGULATION OF ATPase ACTIVITY J. Biol. Chem., April 12, 2002; 277(16): 13409 - 13414. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. S.-C. Mak, C.-S. Chi, and C.-R. Tsai Menkes Gene Study in the Chinese Population J Child Neurol, April 1, 2002; 17(4): 250 - 252. [Abstract] [PDF]
|
|
|
|
 |
|
 Z. Weissman, I. Berdicevsky, B.-Z. Cavari, and D. Kornitzer The high copper tolerance of Candida albicans is mediated by a P-type ATPase PNAS, March 28, 2000; 97(7): 3520 - 3525. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Tsivkovskii, B. C. MacArthur, and S. Lutsenko The Lys1010-Lys1325 Fragment of the Wilson's Disease Protein Binds Nucleotides and Interacts with the N-terminal Domain of This Protein in a Copper-dependent Manner J. Biol. Chem., January 12, 2001; 276(3): 2234 - 2242. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Voskoboinik, J. Mar, D. Strausak, and J. Camakaris The Regulation of Catalytic Activity of the Menkes Copper-translocating P-type ATPase. ROLE OF HIGH AFFINITY COPPER-BINDING SITES J. Biol. Chem., July 20, 2001; 276(30): 28620 - 28627. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||