| Human Molecular Genetics | Pages |
©1999 Oxford University Press |
The mouse Peutz-Jeghers syndrome gene Lkb1 encodes a nuclear protein kinase
Introduction
Results And Discussion
The mouse Lkb1 protein is highly conserved
Structure of the mouse Lkb1 gene
The mouse Lkb1 gene maps to chromosome 10
An unrelated gene overlaps the 3[prime] end of the Lkb1 gene
Lkb1 encodes a nuclear protein
Materials And Methods
Isolation of cDNA and genomic clones of mouse Lkb1
Chromosomal mapping of mouse Lkb1
Analysis of subcellular localization of Lkb1 by immunofluorescence
Acknowledgements
References
The mouse Peutz-Jeghers syndrome gene Lkb1 encodes a nuclear protein kinase
Received February 25, 1999; Revised and Accepted April 30, 1999
DDBJ/EMBL/GenBank accession nos AF145287-AF145297 and AF145697
The protein kinase gene LKB1 has recently been identified as the gene mutated in the Peutz-Jeghers cancer predisposition syndrome. This condition is characterized by inherited susceptibility to a range of cancers but in particular those of the gastrointestinal tract. Here we have characterized the mouse Lkb1 gene. The mouse Lkb1 gene consists of 10 exons covering ~15 kb in length, maps to mouse chromosome 10 and encodes a protein showing strong sequence similarity to human LKB1. The 3[prime] end of Lkb1 in the mouse is in very close proximity to the 3[prime] end of an apparently unrelated gene R29144/1 and it seems probable that overlapping transcripts of the two genes are produced. Using transfection of Lkb1 cDNAs we have shown that Lkb1 is most likely a nuclear protein and have defined a nuclear localization signal within the protein sequence. Thus the defect in Peutz-Jeghers syndrome may directly result in changes in gene expression in the nucleus of target cells.
INTRODUCTION
Peutz-Jeghers syndrome (PJS) is a rare, dominantly inherited condition, typified by the formation of intestinal hamartomatous polyps and mucocutaneous pigmentation affecting the lips, buccal mucosa and digits (1,2). Affected individuals are at least 10 times more likely to develop cancer than members of the general population (3,4). Tumours occur in a wide range of tissues, including the gastrointestinal tract, breast, testis and ovary.
Recently, a locus for PJS was mapped to human chromosome 19p13 by comparative genomic hybridization analysis of multiple hamartomas derived from a single PJS patient (5). Use of polymorphic markers in the region showed that the presumptive wild-type allele was lost in the hamartomas, which led to the suggestion that the target of the deletion was a PJS tumour suppressor gene (5). Finally, linkage analysis confirmed that a highly penetrant cancer susceptibility locus mapped to this region of chromosome 19 (5). Recombination mapping was used to delimit the critical region to ~800 kb and a gene was identified that showed multiple independent mutations in affected members of PJS families (6).
Sequence analysis of the gene mutated in PJS indicated that it had been isolated previously and encoded a protein that showed strong similarity to the family of serine/threonine protein kinases (7,8). The protein encoded by LKB1, originally described as a kinase expressed in human fetal liver (7), is probably the orthologue of the Xenopus serine/threonine kinase XEEK1 (8). XEEK1 is a kinase with an apparently narrow substrate specificity present in the cytoplasm of Xenopus oocytes and fertilized eggs but barely detectable during gastrulation and later embryonic stages. In humans, however, LKB1 appears to be ubiquitously expressed, being particularly highly expressed in the testis and fetal liver (6,9). Many of the mutations in the LKB1 gene found in PJS patients are predicted to disrupt or abolish the kinase activity of the protein (6,9), and the autokinase activity of epitope-tagged human LKB1 immunoprecipitated from transfected cells has recently been shown to be abolished by some disease-associated mutations (10,11).
Here we describe the structure of the mouse Lkb1 gene, map its chromosomal location and show that it encodes a highly conserved protein. Furthermore, we show that the gene encodes a potentially nuclear protein and identify the signal for nuclear localization.
RESULTS AND DISCUSSION
The mouse Lkb1 protein is highly conserved
Dbest (www.ncbi.nlm.nih.gov/dbest/index.html ) contains expressed sequence tags (ESTs) derived from mouse Lkb1 from cDNA libraries made from a wide range of tissues including skin, heart, brain, mammary gland, blood cells and early embryos, suggesting that, like its human counterpart (9), its expression is widespread. We obtained one of these cDNAs (IMAGE Consortium no. 696173), which potentially carried the full mouse Lkb1 open reading frame, and derived its complete sequence (GenBank accession no. AF145287). The first in-frame methionine codon fulfils Kozak's criteria for an initiation codon (12) and probably represents the initiation codon. The predicted open reading frame of mouse Lkb1 aligned to human LKB1 and XEEK1 is shown in Figure 1. The mouse Lkb1 gene encodes a highly conserved protein. Mouse Lkb1 and human LKB1 share 89.7% identity and 92.5% similarity overall, and 96.2% identity and 97.7% similarity in the core kinase domain. Mouse Lkb1 and XEEK1 share 78.6% identity and 84.5% similarity overall, and 92.7% identity and 96.2% similarity in the core kinase domain. This high degree of conservation, in particular in regions outside the core kinase domain, strongly suggests that mouse Lkb1, human LKB1 and XEEK1 are orthologues.
Figure 1. Alignment of mouse, human and Xenopus LKB1 proteins. The predicted open reading frames of mouse Lkb1, human LKB1 (GenBank accession no. AF035625) and Xenopus XEEK1 (GenBank accession no. U24435) were aligned using the Clustal W program (31). Identical residues are boxed in black and similar residues are shaded. The location of the core serine/threonine kinase domain is indicated and the location of a potential nuclear localization signal (NLS) is shown.
Structure of the mouse Lkb1 gene
DNA sequence derived from the mouse Lkb1 cDNA was used to screen a 129/SvJ bacterial artificial chromosome (BAC) library in pBELOBACII by PCR. The BAC clone that was identified was characterized by restriction mapping and subcloned and the exons sequenced. The mouse Lkb1 gene has 10 exons spread over 15 kb (Fig. 2), including one 3[prime]-untranslated exon. The gene is similar in organization to that of the previously characterized human LKB1 gene (Fig. 2) (6,9). However, in general, the introns in the mouse are smaller than those of the human gene apart from the intron between exons VII and VIII (1.8 kb in mouse, 1.0 kb in humans).
Figure 2. Structure of the mouse Lkb1 gene. The organization of mouse Lkb1 is shown compared with that of the human LKB1 gene. Exons are indicated by black boxes. The introns between exons I and II of the mouse gene (8 kb) and between exons I and II (13 kb) and VIII and IX (5 kb) of the human gene are not shown to scale. The asterisks indicate the introns flanked by atypical `AT-AC' splice acceptor and donor sequences. The sequences of the exons and flanking introns have been deposited in GenBank (accession nos AF145288-AF145297).
An unusual feature of the human gene is the use of non-canonical `AT-AC' splice junctions (13) flanking the intron between exons II and III. The nucleotides GT and AG are invariant at the borders of the introns of the vast majority of eukaryotic genes. However, there are a small number of genes in which the introns are flanked by AT and AC (13). The intron between exons II and III of the mouse Lkb1 gene contains a good match (ATATCCTG) to the consensus (ATATCCTT) for the 5[prime] border of this class of introns. The 3[prime] border (CCTAC) also matches the consensus (YCCAC) reasonably well. It is not known why some introns contain non-consensus splices sites. However, conservation of the AT-AC sequences in the intron between exons II and III of both mouse (Table 1) and human (6,9) LKB1 genes suggests that it might be of some functional significance.
Table 1.
| Exon | Exon size (bp) | Exon-intron junctions | Intron size (bp) |
| I | ~310 | ACGTCAAGAAgtaggtgcca...tctgttgcagGGAGATCCAG | 8000 |
| II | 84 | AGCAGAAGATatatcctgtg...agcgccctacGTATATGGTG | 592 |
| III | 90 | AAGCTCATGGgtgagtgccc...acccattcagGTACTTCCGC | 564 |
| IV | 133 | TGTTGCCGAGgtaggcacca...tgccctgcagGCCCTGCACC | 67 |
| V | 137 | GGGTCACACTgtaagtgtct...ctatgtgaagTTACAACATC | 404 |
| VI | 128 | CTACTCCGAGgtgggcatct...tgtcctacagGGATGTTGGA | 280 |
| VII | 58 | GGCAGCACAGgtgagcatgg...ccttctttagCTGGTTCCGG | 1800 |
| VIII | 197 | ACAGTGCCTGgtaagctggc...cttcccgtagGACAGGTCCT | 1100 |
| IX | 207 | AGGCCTACAGgtgggcatgg...ctaccaacagTGTGTCATCA | 144 |
| X | 214 |
In both human LKB1 and mouse Lkb1, exon X encodes exclusively the 3[prime]-untranslated sequence. However, there is no significant similarity in sequence between human and mouse exon X. Conservation of an intron in the 3[prime]-untranslated region (3[prime]-UTR) may reflect functional significance, perhaps related to the stability or localization of the mRNA.
Although originally thought to be uncommon, single 3[prime]-untranslated exons have now been identified in at least 70 mammalian genes (14). When these are present in genes, the translation termination codon is never >50 bp away from the 3[prime] splice junction of the last coding exon; in mouse Lkb1 this distance is 13 bp. Cellular mechanisms exist to eliminate inefficiently or erroneously spliced mRNAs, which would lead to the translation of prematurely terminated proteins. In such mRNAs the premature stop codon is likely to occur at some distance from the 3[prime]-most exon-exon junction and it has been proposed that when this distance is >50 bp the mRNA is recognized as abberant. The stability of normal mRNAs is ensured because stop codons occur <50 bp from the 3[prime]-most exon-exon junction.
Jeanne et al. (9) have suggested that the intron in the 3[prime]-UTR of human LKB1 is spliced only in testis. This is not the case for the mouse 3[prime]-UTR intron. Using PCR primers within exons VIII and X to amplify mouse Lkb1 cDNA from embryo (day 11.5), liver and testis, we have found only the amplification product derived from cDNA with the 3[prime]-UTR intron spliced (data not shown). In addition, mouse ESTs encoding Lkb1 and spanning the 3[prime]-UTR are all derived from cDNAs in which the 3[prime]-UTR intron has been spliced, and have been isolated from a range of tissues, including mouse embryos of various stages (GenBank accession nos W36008, AI324026 and AA546359), fertilized egg (GenBank accession no. C87545), mammary gland (GenBank accession no. AA542163), skin (GenBank accession no. AA612238) and hypothalmus (GenBank accession no. AA967770).
Searching the public EST databases with the mouse Lkb1 cDNA sequence using the BLAST program identified a mouse EST (GenBank accession no. AA798897, derived from skin) possibly representing a product of alternative splicing. This EST has an in-frame 42 bp deletion of the 5[prime] end of exon IV. The exon IV splice acceptor has been missed and a sequence within exon IV similar to a consensus splice acceptor used instead. This prompted us to search for alternative splicing within mouse Lkb1 by PCR. PCR primer combinations spanning all exons were used to amplify cDNA from testis, liver and day 11.5 embryo. The alternative splice suggested by EST accession no. AA798897 was not detected in these tissues and the only evidence of alternative splicing was the skipping of exon IV, which was detected as a minor variant (<5% of PCR product) in each of the tissues examined (data not shown).
The mouse Lkb1 gene maps to chromosome 10
We identified a (TG)n repeat sequence ~9 kb 3[prime] of the mouse Lkb1 gene. Primers were synthesized flanking this repeat and used in PCRs of DNA from C57BL/6 (B6) and Mus spretus (SPE). DNA fragments of 130 and 110 bp were amplified from B6 and SPE DNA, respectively. We then used the European Collaborative Interspecific Backcross (EUCIB) (15) to map the Lkb1 gene in the mouse genome. EUCIB consists of almost 1000 progeny from a backcross of B6×SPE F1 hybrid animals to either B6 or SPE which have been analysed for the segregation of several polymorphic markers per chromosome (15). We typed a randomly selected subset of 58 animals for this backcross for the presence of B6 or SPE Lkb1 alleles. Analysis of the haplotypes produced using the Mbx program (15) revealed significant linkage to markers on mouse chromosome 10 (Fig. 3). Lkb1 maps between the anchor markers D10Mit7 (1.9 ± 1.9 cM) and D10Mit20 (7.4 ± 3.6 cM). Within this interval, Lkb1 showed no recombinants with D10Mit29 and D19Mit117. LKB1 in humans maps to chromosome 19p13 and several other genes such as AMH, BSG and MADCAM1 mapping to this region have been localized to chromosome 10 in the mouse, suggesting that this is a conserved linkage group (www.informatics.jax.org/bin/query_homology ).
Figure 3. Lkb1 maps to mouse chromosome 10. The types and numbers of recombinants observed in 58 randomly selected EUCIB mice typed for the markers D10Mit20, Lkb1 and D10Mit7 are indicated. Open boxes represent the presence of the C57BL/6 variant, filled boxes the M.spretus variant. The dash indicates that the sample was not served for the relevant marker. A partial map of mouse chromosome 10 is shown. Numbers to the left indicate cM and are taken from the EUCIB base map.
An unrelated gene overlaps the 3[prime] end of the Lkb1 gene
Analysis of the sequence immediately flanking exons IX and X of the mouse Lkb1 gene and searching of the EST database revealed several transcripts apparently originating from the opposite DNA strand from which the Lkb1 gene is transcribed. Further sequence analysis of these ESTs revealed that these transcripts originate from an unrelated gene (R29144/1) which is immediately downstream of Lkb1 and transcribed in the opposite direction (Fig. 4). The R29144/1 gene is of unknown function and encodes a protein showing no significant sequence similarity to known proteins. The Lkb1 gene appears to be polyadenylated at multiple sites; in all the cases noted the polyadenylation signal sequence AAUAAA is present immediately upstream of the poly(A) tract. Transcripts of the R29144/1 gene appear to be polyadenylated at a single site preceded by the variant signal sequence CAUAAA. Mapping of the polyadenylation sites of Lkb1 and R29 indicates that the three distal Lkb1 sites and the R29144/1 site overlap by ~130 bp.
a
 |
b
 |
Figure 4. A gene overlaps the 3[prime]-end of the mouse Lkb1 gene. (a) The sequence of the 3[prime]-flanking regions of mouse Lkb1 is shown. The sequence of the C-terminal coding portion of Lkb1 and R29144/1 (on the opposite strand) are shown with the intervening 1200 bp. The intron in the 3[prime]-UTR of Lkb1 is shown in italics flanked by !. The polyadenylation sites of the various transcripts are indicated by horizontal arrows. ->|, transcripts from Lkb1|-<, transcripts from R29144/1. Potential polyadenylation signal sequences are underlined. Accession nos for ESTs indicated are: (i) AI324026, C87546 and AA6122388; (ii) C85710; (iii) AA408040, R75140 and AA589198; and (iv) AA386566 and AA386519. The sequence of the region between Lkb1 and R29144/1 has been submitted to GenBank (accession no. AF145697). (b) Diagrammatical representation of the region between Lkb1 and R29144/1. Lkb1 is transcribed from the top strand, left to right, and R29144/1 from the bottom strand, right to left. The longest transcripts from the two genes are indicated by arrows with the arrowhead representing the end of the transcript. The region spliced from the 3[prime]-UTR of Lkb1 is indicated. Termination condons (Ter) of the Lkb1 and R29144/1 genes are shown above and below the lines, respectively.
Several genes have been previously identified with overlapping 3[prime] ends (16-18), but the functional significance of this overlap is largely unknown. It seems possible that the sequence complementarity of the transcripts results in interaction in vivo; this may be an additional method of regulating the expression of these genes. The close proximity of the R29144/1 and Lkb1 genes in the mouse suggests that care should be exercised in analysing the function of Lkb1 by gene disruption.
Lkb1 encodes a nuclear protein
XEEK1 is expressed in the cytoplasm of Xenopus oocytes (8). However, certain Xenopus proteins are synthesized during oogenesis and stored to provide sufficient protein for the extremely rapid early development phase. These include transcription factors stored in the oocyte cytoplasm which are nuclear in somatic cells (19-21). Consequently, cytoplasmic localization in the oocyte may not reflect somatic localization and we wished to examine the cellular localization of mouse Lkb1 in somatic cells.
The mouse Lkb1 cDNA was cloned into an expression vector under the control of the elongation factor [alpha] promoter and the sequence encoding the myc epitope tag (recognized by the monoclonal antibody 9E10) was fused to the 5[prime] end at codon 2. The predicted molecular weight of tagged mLkb1 is 50.8 kDa. In transfected COS-7 cells, tagged mLkb1 (detected by staining western blots with the 9E10 antibody) is expressed as a doublet migrating at ~52 and 55 kDa on SDS-PAGE (Fig. 5a). As the epitope tag is N-terminal, these two forms of mLkb1 cannot result from the use of alternative initiation codons and most likely represent post-translational modification of the protein (perhaps phosphorylation).
Figure 5. Lkb1 is a nuclear protein. (a) COS-7 cell lysates from duplicate transfections of myc-tagged mLkb1 (+DNA) or mock transfections (-DNA) were analysed by 12% SDS-PAGE. Myc-tagged mLkb1 was detected by immunoblotting with anti-myc (9E10) and is expressed as a doublet of proteins migrating at ~52 and 55 kDa. (b) COS-7 cells transfected with myc-tagged mLkb1 with or without mutations in the putative NLS. The expressed protein was detected by immunofluorescence with anti-myc (9E10) and anti-mouse FITC. The same cells were counterstained with the fluorescent DNA intercalating dye DAPI to show the nucleus. The DAPI stain detects all cells, of which only a subset are transfected and hence FITC- positive. (i) Tagged mLkb1 is expressed predominantly in the nucleus. Patches of lower intensity fluorescence within the nucleus are nucleoli. (ii) Tagged mLkb1 with mutations in the putative NLS is expressed predominantly in the cytoplasm. (c) COS-7 cells transfected with EGFP with or without the putative mLkb1 NLS fused to the N-terminus. Expressed EGFP was detected by fluorescence microscopy. The same cells were counterstained with DAPI to show the nucleus. The DAPI stain detects all cells, of which only a subset are transfected and hence EGFP-positive. (i) EGFP is predominantly cytoplasmic. (ii) EGFP with the putative NLS fusion is predominantly nuclear. Patches of higher instensity fluorescence within the nucleus are nucleoli.
The cellular localization of tagged mLkb1 was detected in transfected COS cells by immunofluorescence (Fig. 5b). mLkb1 is expressed almost exclusively in the nucleus of COS cells. The mLkb1 amino acid sequence contains the motif PRRKRA, which is similar to a single basic type nuclear localization signal (NLS) (22) such as that seen in SV40 large T antigen (PKKKRKV). This sequence is conserved in human LKB1 and XEEK1 (Fig. 1). Mutation of this sequence to AAAKRA results in tagged mLkb1 being expressed predominantly in the cytoplasm of transfected COS cells (Fig. 5b). Similar results are obtained when tagged mLkb1 is expressed in the human embryonic kidney cell line 293 (data not shown).
The mLkb1 sequence QPRRRKRAK containing the putative NLS was fused to the N-terminus of enhanced green fluorescent protein (EGFP). The presence of the putative NLS, promotes the translocation of EGFP to the nucleus of transfected COS cells (Fig. 5c). In the absence of the putative NLS EGFP is expressed in the nucleus and cytoplasm of transfected COS cells, with no concentration of EGFP in the nucleus. However, when fused to the putative NLS, EGFP expression, although still present in the cytoplasm, is more concentrated in the nucleus.
Expression of tagged mLkb1 is largely excluded from the nucleoli [Fig. 5b(i)], suggesting that mLkb1 does not contain a functional nucleolar targetting sequence (23 and references therein). However, when the putative mLkb1 NLS is linked to EGFP, expression of EGFP is concentrated in the nucleoli [Fig. 5c(ii)]. The mLkb1 NLS does not resemble a nucleolar targetting sequence and the concentration of EGFP in nucleoli probably results from passive entry of NLS-EGFP into nucleoli, rather than reflecting a normal function of the mLkb1 NLS sequence.
The kinase most closely related to LKB1 (36% identity in the kinase domain) with a well-defined nuclear function is the Snf1 kinase of Saccharomyces cerevisiae. Snf1 is activated by high glucose concentrations leading to direct modulation of the activity of transcriptional repressors and activators which regulate the expression of gluconeogenic genes (24-26). Whether or not LKB1 is involved in the direct regulation of gene expression in a similar manner remains to be determined. However, transcriptional regulators involved in other intestinal polyposis syndromes which are potential targets of LKB1 signalling include SMAD4, TCF-4, [beta]-catenin and c-MYC (27-29).
MATERIALS AND METHODS
Isolation of cDNA and genomic clones of mouse Lkb1
Mouse Lkb1 cDNAs were identified by searching the dbest database (www.ncbi.nlm.nih.gov/dbest/index.html ) with the human LKB1 cDNA sequence. Several clones were identified. One of these (IMAGE Consortium no. 696173) was obtained and completely sequenced. A mouse BAC library made from strain 129/SvJ was screened by the manufacturer (Genome Systems, St Louis, MO) using the oligonucleotides CCAGGGCATTGTTCACAAGG and CAGATGTCCACCTTCAAACC.
Chromosomal mapping of mouse Lkb1
A (TG)n repeat sequence was identified ~9 kb distal to the mouse Lkb1 gene. Primers TCACATAAAAGGTGTCATCG and GGGAGGTGGTTGGCATTTGG amplified an ~130 bp fragment from B6 DNA and an ~110 bp fragment from SPE DNA. This PCR was used to follow segregation of variants of the Lkb1 locus in the EUCIB interspecific backcross (15). Twenty-seven animals from the backcross to B6 and 31 animals from the backcross to SPE were analysed. Haplotypes were analysed with the Mbx program (15).
Analysis of subcellular localization of Lkb1 by immunofluorescence
Expression constructs.
cDNA from codon 2 to the stop codon flanked by EcoRI and SalI linkers was cloned under the control of the elongation factor [alpha] promoter in the expression vector pEF.m6 (a gift of Dr R. Marais, Institute of Cancer Research, London, UK) such that the myc epitope tag (recognized by the monoclonal antibody 9E10) was fused in-frame at the N-terminus. The putative NLS of mLkb1 (PRRKRA) was mutated in this construct by site-directed mutagenesis to AAAKRA.
A synthetic oligonucleotide encoding an initiating methionine residue and the mLkb1 sequence QPRRKRAK, which includes the putative NLS, was cloned into the vector pEGFP-N1 (Clontech, Basingstoke, UK) to produce an EGFP fusion protein with this sequence at the N-terminus.
SDS-PAGE and western blotting of myc-tagged mLkb1.
For SDS-PAGE analysis COS-7 cells were plated at a density of ~20 000 cells/cm2 the day before transfection. Cells were transfected with tagged mLkb1 using lipofectamine reagent (Life Technologies, Paisley, UK) following the manufacturer's recommendations. Two days after transfection, cells were harvested and lysed in RIPA buffer (50 mM Tris-HC1 pH 8.0, 150 mM NaC1, 0.1% SDS, 0.5% sodium deoxycholate, 1% Nonidet P-40, 100 µg/ml PMSF, 1 µg/ml aprotinin, 1 µg/ml leupeptin) on ice for 15 min. The lysate was centrifuged at 10 000 g for 10 min, the supernatant mixed with SDS-PAGE loading buffer and ~50 µg of protein extract subjected to 12% SDS-PAGE. The gel was electro-blotted to a nitrocellulose membrane and immunodetection of transferred proteins carried out essentially as described previously (30). Tagged mLkb1 was detected using antibody clone 9E10, anti-mouse horseradish peroxidase conjugate (Sigma, Poole, UK) and ECL (Amersham, Little Chalfont, UK) followed by autoradiography.
Immunofluorescence detection of myc-tagged mLkb1.
COS-7 cells were transfected as described above. The day after transfection, cells were trypsinized and replated on to permanox slides (Life Technologies). Twenty-four hours later, cells were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 10 min, washed in PBS, treated with 0.2% Triton X-100 in PBS for 10 min, washed in PBS and treated with 10% fetal calf serum (FCS) in PBS for 10 min. Tagged mLkb1 was detected by incubation in mouse monoclonal anti-myc (clone 9E10) in 10% FCS/PBS for 2 h, after which slides were washed in PBS, incubated with FITC-conjugated anti-mouse antibody (1:250 dilution; Jackson Immunoresearch Laboratories, Stratech Scientific, Luton, UK) in 10% FCS/PBS for 1 h, washed in PBS, stained with the fluorescent DNA stain DAPI (2 µg/ml in PBS), mounted and viewed by indirect fluorescence microscopy.
Detection of EGFP.
COS-7 cells were transfected with pEGFP-N1 with or without the N-terminal mLbk1 NLS fusion and replated following transfection as described above. Twenty-four hours later, cells were fixed in 4% paraformaldehyde in PBS for 10 min, permeabilized with Triton X-100, stained with DAPI, mounted and viewed by indirect fluorescence microscopy.
ACKNOWLEDGEMENTS
We thank Jo Perry for help with linkage analysis and the Cancer Research Campaign for financial support.
REFERENCES
*To whom correspondence should be addressed. Tel: +44 171 352 8133 ext. 5177; Fax: +44 171 352 3299; Email: alana{at}icr.ac.uk
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  L. Zhou, S. S. Deepa, J. C. Etzler, J. Ryu, X. Mao, Q. Fang, D. D. Liu, J. M. Torres, W. Jia, J. D. Lechleiter, et al. Adiponectin Activates AMP-activated Protein Kinase in Muscle Cells via APPL1/LKB1-dependent and Phospholipase C/Ca2+/Ca2+/Calmodulin-dependent Protein Kinase Kinase-dependent Pathways J. Biol. Chem., August 14, 2009; 284(33): 22426 - 22435. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jansen, J. P. ten Klooster, G. J. Offerhaus, and H. Clevers LKB1 and AMPK Family Signaling: The Intimate Link Between Cell Polarity and Energy Metabolism Physiol Rev, July 1, 2009; 89(3): 777 - 798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Fan, C. Ma, and H. Zhang The molecular mechanisms that underlie the tumor suppressor function of LKB1 Acta Biochim Biophys Sin, February 1, 2009; 41(2): 97 - 107. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. C. Denison, N. J. Hiscock, D. Carling, and A. Woods Characterization of an Alternative Splice Variant of LKB1 J. Biol. Chem., January 2, 2009; 284(1): 67 - 76. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Dorfman and I. G. Macara STRAD{alpha} Regulates LKB1 Localization by Blocking Access to Importin-{alpha}, and by Association with Crm1 and Exportin-7 Mol. Biol. Cell, April 1, 2008; 19(4): 1614 - 1626. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.-Y. Zeng and S. L. Berger LKB1 Is Recruited to the p21/WAF1 Promoter by p53 to Mediate Transcriptional Activation. Cancer Res., November 15, 2006; 66(22): 10701 - 10708. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Forcet, S. Etienne-Manneville, H. Gaude, L. Fournier, S. Debilly, M. Salmi, A. Baas, S. Olschwang, H. Clevers, and M. Billaud Functional analysis of Peutz-Jeghers mutations reveals that the LKB1 C-terminal region exerts a crucial role in regulating both the AMPK pathway and the cell polarity Hum. Mol. Genet., May 15, 2005; 14(10): 1283 - 1292. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V Schumacher, T Vogel, B Leube, C Driemel, T Goecke, G Moslein, and B Royer-Pokora STK11 genotyping and cancer risk in Peutz-Jeghers syndrome J. Med. Genet., May 1, 2005; 42(5): 428 - 435. [Full Text] [PDF]
|
|
|
|
 |
|
 P A Marignani LKB1, the multitasking tumour suppressor kinase J. Clin. Pathol., January 1, 2005; 58(1): 15 - 19. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. B. Blumer, M. L. Bernard, Y. K. Peterson, J.-i. Nezu, P. Chung, D. J. Dunican, J. A. Knoblich, and S. M. Lanier Interaction of Activator of G-protein Signaling 3 (AGS3) with LKB1, a Serine/Threonine Kinase Involved in Cell Polarity and Cell Cycle Progression: PHOSPHORYLATION OF THE G-PROTEIN REGULATORY (GPR) MOTIF AS A REGULATORY MECHANISM FOR THE INTERACTION OF GPR MOTIFS WITH Gi{alpha} J. Biol. Chem., June 20, 2003; 278(26): 23217 - 23220. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. I. Jimenez, P. Fernandez, O. Dominguez, A. Dopazo, and M. Sanchez-Cespedes Growth and Molecular Profile of Lung Cancer Cells Expressing Ectopic LKB1: Down-Regulation of the Phosphatidylinositol 3'-Phosphate Kinase/PTEN Pathway Cancer Res., March 15, 2003; 63(6): 1382 - 1388. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sanchez-Cespedes, P. Parrella, M. Esteller, S. Nomoto, B. Trink, J. M. Engles, W. H. Westra, J. G. Herman, and D. Sidransky Inactivation of LKB1/STK11 Is a Common Event in Adenocarcinomas of the Lung Cancer Res., July 1, 2002; 62(13): 3659 - 3662. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Tiainen, K. Vaahtomeri, A. Ylikorkala, and T. P. Makela Growth arrest by the LKB1 tumor suppressor: induction of p21WAF1/CIP1 Hum. Mol. Genet., June 15, 2002; 11(13): 1497 - 1504. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Smith, S. I. Rayter, C. Niederlander, J. Spicer, C. M. Jones, and A. Ashworth LIP1, a cytoplasmic protein functionally linked to the Peutz-Jeghers syndrome kinase LKB1 Hum. Mol. Genet., December 1, 2001; 10(25): 2869 - 2877. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Watts, D. Morton, J Bestman, and K. Kemphues The C. elegans par-4 gene encodes a putative serine-threonine kinase required for establishing embryonic asymmetry Development, January 4, 2000; 127(7): 1467 - 1475. [Abstract] [PDF]
|
|
|
|
|
|
P. A. Marignani, F. Kanai, and C. L. Carpenter LKB1 Associates with Brg1 and Is Necessary for Brg1-induced Growth Arrest J. Biol. Chem., August 24, 2001; 276(35): 32415 - 32418. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. P. Sapkota, A. Kieloch, J. M. Lizcano, S. Lain, J. S. C. Arthur, M. R. Williams, N. Morrice, M. Deak, and D. R. Alessi Phosphorylation of the Protein Kinase Mutated in Peutz-Jeghers Cancer Syndrome, LKB1/STK11, at Ser431 by p90RSK and cAMP-dependent Protein Kinase, but Not Its Farnesylation at Cys433, Is Essential for LKB1 to Suppress Cell Growth J. Biol. Chem., May 25, 2001; 276(22): 19469 - 19482. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||