Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (101)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Arnould, C.
Right arrow Articles by Jonveaux, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arnould, C.
Right arrow Articles by Jonveaux, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

The signal transducer and activator of transcription STAT5b gene is a new partner of retinoic acid receptor [alpha] in acute promyelocytic-like leukaemia
Human Molecular Genetics Pages 1741-1749 ©1999 Oxford University Press


The signal transducer and activator of transcription STAT5b gene is a new partner of retinoic acid receptor [alpha] in acute promyelocytic-like leukaemia
Introduction
Results
   Fusion of STAT5b to RARA
   The STAT5b gene maps to 17q21.1-q21.2 close to the RARA locus
   Localization of the STAT5b-RARA protein in leukaemic cells
Discussion
Materials And Methods
   Patient
   5[prime]-RACE PCR
   Construction of the patient genomic library
   Sequencing reaction
   Isolation of a genomic clone containing the STAT5b gene
   Immunocytochemistry
   Southern blotting
   FISH
Acknowledgements
References


The signal transducer and activator of transcription STAT5b gene is a new partner of retinoic acid receptor [alpha] in acute promyelocytic-like leukaemia

Cécile Arnould+, Christophe Philippe+, Violaine Bourdon, Marie José Grégoire, Roland Berger1, Philippe Jonveaux§

Laboratoire de Génétique, UPRES-INRA 952, CHRU, Rue du Morvan, 54511 Vandoeuvre les Nancy, France and 1INSERM U434, SD 401 No. 434 CNRS, CEPH, 27 Rue Juliette Dodu, 75010 Paris, France

Received April 19, 1999; Revised and Accepted June 9, 1999

Acute promyelocytic leukaemia (APL) exhibits a characteristic t(15;17) translocation that fuses the promyelocytic leukaemia (PML) gene on 15q22 to the retinoic acid receptor [alpha] (RARA) gene on 17q12-q21.1. In a small subset of acute promyelocytic-like leukaemias (APL-L), RARA is fused to a different partner: the promyelocytic leukaemia zinc finger (PLZF) gene on 11q23, the nucleophosmin (NPM) gene on 5q35 or the nuclear mitotic apparatus (NuMA) gene on 11q13. We report on the molecular characterization of a RARA gene rearrangement in a patient with APL-L and demonstrate that the signal transducer and activator of transcription STAT5b gene is fused with RARA. STAT5b belongs to the janus kinase (JAK)-STAT signalling pathway. Remarkably, the STAT5b component of the chimeric protein is delocalized from the cytoplasm to the nucleus, where it displays a microspeckled pattern. Therefore, unusual features of this APL-L might result from dysregulation of the JAK/STAT5 signal transducing pathways in the patient leukaemic cells. In this study, we identified STAT5b as a new gene fused to RARA in leukaemia; this is the first human tumour bearing a structurally abnormal STAT gene.

INTRODUCTION

Chromosomal aberrations leading to gene fusion play an important role in a great number of haematopoietic malignancies. Acute promyelocytic leukaemia (APL) accounts for 10-15% of all acute non-lymphoid leukaemias. The vast majority of APL exhibits a characteristic t(15;17) translocation that fuses the promyelocytic leukaemia (PML) gene to the retinoic acid receptor [alpha] (RARA) gene (1), resulting in an aberrant PML-RARA protein associated with leukaemogenesis. The fusion protein inhibits differentiation and promotes survival of myeloid precursor cells. In APL-L patients (1-2%), the RARA gene is fused to a different partner as a result of variant rearrangements; apart from PML, promyelocytic leukaemia zinc finger (PLZF) (2), nucleophosmin (NPM) (3) and nuclear mitotic apparatus (NuMA) (4) have been found fused to RARA.

We have previously reported an APL-L case associated with a derivative chromosome 17 (5). A RARA gene rearrangement was found by Southern blot analysis. The PML-RARA gene fusion present in almost 100% of APL was ruled out (5).

In the present study, we demonstrate that this APL-L patient harbours a STAT5b-RARA gene fusion. STAT5b belongs to a family of latent cytosolic transcription factors activated by janus kinase (JAK) tyrosine kinases. The STAT family is composed of seven members in mammals (STAT1-STAT4, STAT5a, STAT5b and STAT6). After cytokine interaction with their receptor, JAKs are auto-transphosphorylated. Subsequently, the intracellular receptor docking site is phosphorylated by the activated JAK. Stat5b interacts with the activated receptor through its SH2 domain and in turn becomes phosphorylated (on Tyr699) by JAK. Phosphorylated STAT5b dimerizes in a head-to-tail configuration and STAT5b homodimers and STAT5a/b heterodimers proceed to the nucleus and regulate gene transcription through interaction between the DNA-binding domain and IFN-[gamma] activation sequence (GAS) (for reviews on the JAK/STAT pathway see refs 6-8). STAT5 proteins were initially characterized in sheep as prolactin-regulated mammary gland factors (9). The human STAT5b protein is highly homologous to STAT5a except for the C-terminal trans-activation domain (10,11). A great diversity of extracellular signalling polypeptides, including cytokines, growth factors and hormones, have been shown to trigger STAT5 protein activation (8). STAT5 proteins are mainly implicated in mammopoiesis, lactogenesis and body growth regulation. However, these transcription factors are also involved in haematopoiesis (12-17) and several lines of evidence implicate the Stat5 proteins in proliferation induced by mitogenic cytokines such as interleukin-2 (IL-2), IL-3, IL-7 (18-22), granulocyte colony-stimulating factor (G-CSF) (23) and erythropoietin (24).

The STAT5b gene gives rise to both long (94 kDa) and short (80 kDa) functionally distinct isoforms generated by protein processing relying on a nuclear serine protease (25). This natural short variant acts as a dominant negative STAT5b transcription factor (11,26) and is preferentially activated in multipotent haematopoietic progenitors (25).

STAT5a-/- and/or STAT5b-/- knockout mice have phenotypes mainly attributable to deficiencies in prolactin and growth hormone functions (14). STAT5a-/-b-/- double mutant mice have a profound deficiency in peripheral T cell proliferation together with a reduced number of cytokine colony-forming unit responses of bone marrow cells (14). Moreover, STAT5a-/- and STAT5b-/- mice exhibit a defect in natural killer cell proliferation and function (21). STAT5s regulate expression of many genes (8,21,27) coding for milk proteins ([beta]-casein and [beta]-lactoglobulin) and for proteins involved in haematopoiesis and the immune response [oncostatin M, c-myc, cytokine-inducible SH2 domain containing protein (CIS), IL-2R[alpha], IL-2R[beta], perforin and pim-1]. Under growth hormone stimulation, STAT5b controls liver gene expression in a sex-specific manner (28).

We report on the molecular characterization of the STAT5b-RARA gene fusion at both the cDNA and the genomic levels together with immunolocalization studies of the chimeric protein in the patient leukaemic cells. We discuss the potential implication of the STAT5b component of the fusion protein in leukaemogenesis in the present APL-L.

RESULTS

Fusion of STAT5b to RARA

In order to isolate the gene fused to RARA, a 5[prime] rapid amplification of cDNA ends (5[prime]-RACE) was performed on total RNAs extracted from the patient bone marrow cells (Fig. 1a). A Blastn analysis of a 5[prime]-RACE product-derived sequence showed an in-frame fusion between STAT5b and RARA genes (Fig. 1a). The resulting protein is composed of 1038 amino acids; a schematic representation of the anticipated structure of the STAT5b-RARA protein is shown in Figure 1b. The putative STAT5b-RARA protein contains all known functional domains of RARA except for the N-terminal trans-activating function. Apart from all RARA functional domains, the fusion protein contains the Stat5b coiled-coil region (29), DNA-binding domain and a truncated SH2 domain. Tyr699 essential for STAT5b activation and the C-terminal transactivation domain with Ser731 involved in regulation of STAT5b transcriptional activity are absent from the chimeric STAT5b-RARA protein. The reciprocal RARA-STAT5b mRNA was not detected after RT-PCR on patient bone marrow total RNAs (data not shown). The STAT5b rearrangement was confirmed at the genomic level by Southern blot analysis with STAT5b cDNA (Fig. 2).


   A

   B

Figure 1. Isolation and characterization of a STAT5b-RARA fusion. (a) A RARA-specific cDNA library was obtained after reverse transcription with oligonucleotide R2 (1) on total RNAs from patient bone marrow cells. We chose the avian myeloblastoid virus (AMV) reverse transcriptase because of its high thermostability in order to avoid problems due to RNA secondary structures in the 5[prime]-portion of the chimaeric transcript. After two rounds of PCR (2), a smear was obtained and the 5[prime]-RACE products were cloned in pPCR-Script Amp SK(+) (3). Sequencing with primer T3 (4) of clone no. 11, which contains a 1.2 kb insert, and database searches using the Blastn program (http:/www.ncbi.nlm.nih.gov/BLAST/ ), allowed the characterization of a fusion between STAT5b and the third exon of RARA (5). 100% homology was detected with human mRNA for RARA (accession no. M61111) from nt 574 corresponding to the 5[prime]-end of exon 3 up to nt 616, the 5[prime]-end of R4 (the oligonucleotide used for the nested PCR). In the chimaeric cDNA sequence, exon 3 from RARA was fused to the STAT5b gene, as revealed by a perfect homology between our chimaeric cDNA sequence and the STAT5b cDNA sequence (up to nt 2052). The presence of a chimaeric cDNA was confirmed by PCR on the patient cDNA library with oligonucleotides StgU and R4 (data not shown). The resulting 234 bp PCR product was sequenced, confirming the STAT5b-RARA gene fusion found by 5[prime]-RACE (data not shown). The STAT5b intron fused to RARA intron 2 is termed intron n because the STAT5b genomic structure is unknown. (b) The fusion between STAT5b exon n and the third exon of RARA preserved the reading frame in the mRNA. The predicted chimaeric transcript, from the STAT5b initiation codon to the end of the 3[prime]-untranslated region of RARA, is 4532 nt long and encodes a fusion protein composed of 1038 amino acid residues. The fusion protein contains a proline which replaces Thr60 and Glu636 in the wild-type RARA and STAT5b proteins, respectively.


Figure 2. Detection of the STAT5b gene rearrangement at the genomic level by Southern blot analysis. Southern blot analysis was done on DNA from patient bone marrow cells (P) and from a normal control (C) with the STAT5b cDNA probe. A junction fragment is detected with BglII (11 kb). The presence of a rearranged band confirms, at the genomic level, the result obtained with total RNAs after 5[prime]-RACE-PCR.

Characterization of the fusion at the genomic level was done with a PAC which contains all the STAT5b coding region and with a breakpoint spanning phage clone (Fig. 3). Sequence analysis showed a 3 bp insertion at the joining site; the 2.4 kb chimeric intron is mainly composed of STAT5b-derived intronic sequence. No homologies were detected with highly repeated long (LINES) and short interspersed elements (SINES). The breakpoint in RARA gene intron 2 is located in the so-called `extremely restricted region' (ERR) of 50 bp which has been identified as an illegitimate recombination hotspot involved in PML-RARA rearrangements (30,31). Moreover, we found short identical stretches of DNA between STAT5b and RARA at the joining points in the present case (Fig. 3), resembling those observed in PML-RARA fusions (32). The model of the t(15;17) translocation proposed by Yoshida et al. (32) is therefore likely to be relevant to this STAT5b-RARA gene fusion. The reciprocal chimeric RARA-STAT5b intron, estimated to be slightly larger than 17 kb long [the normal RARA intron 2 is 17 kb long (33)], was not detected by PCR with two different oligonucleotide pairs on patient genomic DNA (data not shown). This suggests a small interstitial deletion ranging from STAT5b intron n to RARA intron 2 as the most probable mechanism for formation of the STAT5b-RARA gene fusion. Duplication of the 17q21.3-q23 region observed after comparative genomic hybridization (CGH) analysis (see Materials and Methods) is probably a secondary event in leukaemogenesis.


   A

   B

Figure 3. Characterization of the STAT5b-RARA rearrangement at the genomic level. The characterization of the rearrangement at the genomic level was done with PAC 196p17 and a breakpoint spanning phage clone. PAC 196p17 was obtained by PCR screening of the RPCII PAC library (60); it contains all the STAT5b coding region (data not shown). The phage clone Da encompasses the STAT5b-RARA joining sequence. Southern blot analysis of EcoRI-digested phage Da DNA with a 5.5 kb EcoRI RARA genomic probe revealed a 6.5 kb junction fragment (data not shown). (a) The chimaeric intron was PCR amplified on phage Da DNA which contains the joining sequence. (1) The PCR reaction was performed with R4 and Stgn, an oligonucleotide localized at the 3[prime]-end of STAT5b exon n. The Stgn 3[prime] nucleotide corresponds to the last STAT5b-derived nucleotide in the chimaeric STAT5b-RARA cDNA. The chimaeric intron is ~2.4 kb long. (2) Sequence analysis starting from RARA exon 3 showed a normal RARA intronic sequence for 344 bp, the chimaeric intron is therefore essentially composed of STAT5b-derived intronic sequence. (b) The wild-type STAT5b intronic sequence around the breakpoint was obtained on a 2.8 kb StgU/StgL2 PCR product. The StgL2 3[prime]-end nucleotide corresponds to the 5[prime]-end of STAT5b exon n + 1; StgU is localized 168 nt upstream from Stgn at the cDNA level. (1) The PCR reaction was performed on PAC 196p17 DNA. The PAC 196p17 insert contains an internal NotI site; its size was estimated by field inversion gel electrophoresis (FIGE Mapper; Bio-Rad) to be ~100 kb. Southern blot analysis with STAT5b cDNA allowed us to estimate the STAT5b genomic size to be <50 kb (data not shown). (2) The Stg8 oligonucleotide was designed thanks to a StgL2-derived intronic sequence and allowed us to approach the wild-type intronic sequence around the breakpoint. Sequence analysis from StgU gave us partial information on the intron-exon structure of STAT5b. Exon n is 131 bp long (from nt 1922 to 2052; accession no. U47686) and is split off from exon n - 1 by a 101 bp intron n - 1. The donor and acceptor splice sites in introns n - 1 and n follow the GT/AG rule. (c) Comparison between the germline sequences (accession no. S57794 for the 3[prime]-end of RARA intron 2) and the chimaeric intronic sequence revealed a 3 nt insertion at the joining site between STAT5b and RARA genes. Moreover, short 3 bp identical stretches of DNA between STAT5b and RARA are present upstream from the cleavage sites in wild-type STAT5b and RARA introns.

The STAT5b gene maps to 17q21.1-q21.2 close to the RARA locus

STAT5a and STAT5b were both mapped at 17q11.2 (10) by FISH; however, the metaphase chromosome resolution did not allow precise localization of STAT5b in the 17q proximal region. Our FISH analysis with PAC 196p17 on normal prometaphases seems to indicate that the STAT5b and RARA genes are very close to each other in 17q21.1-q21.2 and that the physical distance between the two genes is most likely <3 Mb (34; Fig. 4).


Figure 4. Localization of the STAT5b gene in relation to the RARA locus by FISH on normal prometaphases. PAC 196p17 was biotin labeled and co-hybridized with digoxigenin-labeled Smith-Magenis/D17S258 (17p11.2) and RARA (17q21.1) probes (Oncor) on normal prometaphases and nuclei. On prometaphase chromosome 17, the STAT5b green signal, observed after FITC-avidin detection, co-localizes with the RARA red signal visualized after rhodamine-anti-digoxigenin detection, as demonstrated by yellow signals on 17q21.1-q21.2. No background was noted at any other chromosome location using the PAC clone 196p17 as a probe for FISH analysis.

Localization of the STAT5b-RARA protein in leukaemic cells

Immunolocalization studies on patient bone marrow cells show that the STAT5b-RARA protein is mainly localized in the nucleus but also to a lesser extent in the cytoplasm and displays a microspeckled pattern, whereas the normal STAT5b protein shows a normal diffuse cytoplasmic localization (Fig. 5).


Figure 5. The chimaeric STAT5b-RARA protein localizes in the nucleus and displays a microspeckled pattern. (a) Comparative immunolocalization of RARA and STAT5b in control and patient bone marrow cells. We performed a double labeling experiment with red fluorescence for STAT5b and green fluorescence for RARA on both control and patient bone marrow cells. (1) STAT5b N-20 polyclonal antibody against the N-terminal part of STAT5b. (2) RARA monoclonal antibody against a C-terminal RARA epitope. (3) A composite image with STAT5b- and RARA-derived fluorescence clearly shows, in patient bone marrow cells, yellow fluorescence in the nucleus, indicative of co-localization of STAT5b and RARA. In control bone marrow cells the STAT5b protein is essentially cytoplasmic while the RARA protein is nuclear; each protein displays a diffuse pattern. In patient bone marrow cells RARA antibody shows the well-known microspeckled characteristic pattern in APL; STAT5b antibody reveals a similar microspeckled pattern within the nucleus. The yellow nuclear signal is the result of STAT5b and RARA antibody co-localization due to the chimaeric protein, which is present mainly in the nucleus. To a lesser extent, the fusion protein is also present in the cytoplasm in a few patient myeloid cells (arrows), as demonstrated by green dots with the RARA antibody and by orange cytoplasmic fluorescence in the composite image. (b) Comparative immunolocalization of wild-type and rearranged STAT5b proteins. We used STAT5b N-20 and STAT5b C-17 antibodies against N- and C-terminal parts of the STAT5b protein, respectively. In this experiment, the FITC-avidin detection system gives green fluorescence for STAT5b. The pattern with STAT5b C-17 antibody is exclusively derived from the wild-type STAT5b protein while the STAT5b N-20 antibody detects normal and chimaeric proteins. In patient bone marrow cells, normal STAT5b protein shows a diffuse cytoplasmic pattern while the nuclear chimaeric protein clearly displays a microspeckled pattern.

DISCUSSION

In this study, we identified STAT5b as the fifth gene fused to RARA in APL and APL-L leukaemias. PML, PLZF, NPM, NuMA and STAT5b (in its phosphorylated form) are nuclear proteins. However, for the first time, the protein derived from the RARA gene partner can be localized in the cytosol (in its latent form). To date, all RARA partners contain an N-terminal protein-protein interaction domain; the STAT5b coiled-coil domain is located between amino acids 232 and 321 (29).

RARA is essential for proper myeloid cell differentiation in response to retinoic acid (RA). As for other APLs and APL-Ls, the chromosome 17 breakpoint in the present case is located in intron 2 of the RARA gene. This suggests that an abnormal receptor with almost all functional domains of the native RARA is the hallmark for inhibition of myeloid cell differentiation. The arrest of maturation of myeloid cells in APL-L reported in this study is possibly due to an abnormal RARA protein.

The well-characterized PML-RARA and PLZF-RARA oncogenic proteins mediate leukaemogenesis through recruitment of histone deacetylase leading to aberrant chromatin acetylation and transcriptional repression of RA-regulated genes (35-38). An N-CoR box has been implicated in the ability of RARA to interact with co-repressors (35). Moreover, in PML-RARA-associated APLs, delocalization of the normal PML protein in blast cells promotes survival of myeloid precursors, as PML has recently been shown to be involved in apoptotic pathways (39,40). Patients with the PML-RARA, NPM-RARA and NuMa-RARA gene fusions show complete remission after differentiation therapy with all-trans RA (ATRA) (41). Addition of ATRA mediates replacement of the repressor complex by an activator complex with acetyltransferase activity (42,38). The transcriptional activator complex is composed of CREB binding protein (CBP)/p300 and histone acetyltransferase. APL-Ls with the PLZF-RARA gene fusion are not sensitive to ATRA because the PLZF component of the chimeric protein is also able to recruit a repressor complex with histone deacetylase activity but RA has not effect on the PLZF-repressor complex (36-38). It is noteworthy that our case did not respond to ATRA. The STAT5b protein-protein interaction domain has been shown to associate with N-Myc interactor (Nmi), which in turn enhances association of CBP/p300 with STAT5 (29). The chimeric STAT5b-RARA protein could sequester CBP/p300 cofactors and therefore prevent ATRA to release the repressor complex from the RA target genes. Alternatively, an ATRA-insensitive association of N-CoR co-repressor with the N-terminal coiled-coil domain derived from the STAT5b component of the fusion protein could explain the unresponsiveness of the present APL-L to RA.

Apart from its role in prolactin and growth hormone-induced functions, STAT5b is also involved in differentiation and proliferation of myeloid progenitors. Notably, G-CSF, which plays a critical role in granulopoiesis, stimulates STAT5 transcription factor activity (23). The STAT5b component of the fusion protein could therefore participate in leukaemogenesis in the present APL-L and explain the atypical phenotype as compared with classical APL. Thus far, several reports link aberrations in the JAK/STAT pathways to malignant phenotypes. In Drosophila, a dominant mutant Jak kinase (hopTum-1) causes leukaemia-like abnormalities (43). Constitutive STAT5 activation has been found in T cell leukaemia/lymphoma (44,45) and in malignant T lymphocytes derived from cutaneous anaplastic large T cell lymphoma and Sezary syndrome (46). The STAT5 transcription factors were also found constitutively activated mainly in acute lymphoblastic leukaemias (ALL) (47,48) and in haematopoietic cell lines transformed by BCR/ABL tyrosine kinase (49,50). It was also found constitutively activated in acute myeloid leukaemias (47,48,51,52) and in familial erythrocytosis (53). Before this report, TEL-JAK2 fusions in a T cell childhood acute lymphoblastic leukaemia (54) and in myeloid leukaemias (55) were the unique gene rearrangements in the JAK/STAT pathways described in human cancers. All TEL-JAK2 variants strongly activate STAT5 (56). The finding of constitutively activated STAT5 transcription factors in numerous malignant haematopoietic disorders strongly supports the idea of STAT5-dependent oncogene activation. Very recently, Nieborowska-Skorska et al. (57) have demonstrated a causal involvement of STAT5 activation in BCR/ABL-mediated leukaemogenesis both in vitro and in vivo.

The present APL-L with a gene fusion between STAT5b and RARA is the first malignancy that harbours a rearranged member of the STAT gene family. The STAT5b-RARA chimeric protein contains 636 amino acids from the N-terminus of STAT5b; the fusion site occurs within the C-terminal SH2 domain of STAT5b, before Tyr699. The SH2 domain coordinates interaction of Stat5b with the phosphotyrosine docking site on the cytoplasmic part of the cytokine receptor. The phosphotyrosine docking site recruits the STAT5b protein by interacting with a critical arginine residue (Arg618) in the highly conserved core of SH2. When recruited, Tyr699 on STAT5b is phosphorylated [Tyr(P)], the activated form of STAT5b is then able to dimerize by reciprocal SH2-Tyr(P) interactions. The highly conserved core of the SH2 domain with Arg618 is present in the STAT5b-RARA protein; it could bind to the cytokine receptor. The cytoplasmic truncated STAT5b protein could therefore act in a dominant negative manner by competing with the normal STAT5b transcription factor for the interaction with the receptor docking site. Studies on homo- and heterodimerization between the STAT1 and STAT2 proteins showed that an unphosphorylated STAT can dimerize with a Tyr(P)-STAT; a single Tyr(P)-SH2 interaction therefore seems sufficient for dimerization (58,59). If the chimeric STAT5b-RARA protein could `dimerize' by a single Tyr(P)-SH2 interaction with the wild-type STAT5a and STAT5b proteins, it will sequester normal STAT proteins and perturbate the JAK/STAT5 pathways. Moreover, the fusion protein is mainly nuclear and contains a functional DNA-binding region. One could anticipate that stable homo- or heterodimers with normal STAT5a/b proteins are generated and bind to GAS elements. STAT5b-RARA-STAT5a/b heterodimers could either constitutively activate gene transcription or act in a dominant negative manner on activated wild-type STAT5a/b transcription factors. If the STAT5b-RARA gene fusion leads to a constitutively activated STAT5b transcription factor, cytokine independent growth may participate in leukaemogenesis in this APL-L. Lastly, and as mentionned above, the STAT5 transcription factors have been shown to interact with other proteins such as CBP/p300 to form enhanceosomes (29). In the present APL-L case, abnormal STAT5b proteins could sequester co-activators of other signalling pathways, including the retinoid pathway.

As patient material is no longer available, ongoing transfection studies with the chimeric cDNA in the Ba/F3 cell line, which is dependent on IL-3 for growth, will allow testing of the effect of the fusion protein on the STAT5 pathways. Moreover, co-transfection experiments with an RA-inducible reporter plasmid will also permit the study of the effect of STAT5b-RARA protein on RA-regulated genes.

MATERIALS AND METHODS

Patient

Details of the patient, a 67-year-old man, have been previously published (5). He had acute myeloid leukaemia (AML M1 in the French/American/British classification). However, in the bone marrow a minority of blast cells showed morphological features suggestive of the microgranular variant of APL, M3v. Blast cells failed to respond to ATRA in vitro. Cytogenetic analysis of bone marrow cells revealed a derivative chromosome 17 larger than a normal chromosome 17. Chromosome microdissection (5) and CGH analysis allowed us to demonstrate that extra material on der(17) was the result of a duplication of the 17q21.3-q23 region (data not shown).

5[prime]-RACE PCR

Total RNAs from patient bone marrow cells were extracted according to the TRIzol protocol (Sigma). Amplification of the unknown 5[prime]-end of the chimeric mRNA was performed with a 5[prime]/3[prime]-RACE kit (Boehringer Mannheim). The incubation step for first strand cDNA synthesis was performed at 55°C. Gene-specific first strand cDNA synthesis was performed using primer R2 (for oligonucleotides used in this study see Table 1) localized in exon 4 of the RARA gene (accession no. X06614). After dA tailing of the purified chimeric cDNA, a first PCR with an oligo(dT) anchor primer and R3 followed by a second semi-nested PCR using an anchor primer and R4 allowed us to obtain a 1.2 kb PCR product. Both PCRs were carried out with the Expand Long Template system (Boehringer Mannheim) at an annealing temperature of 63°C. Secondary PCR products were cloned using the PCR-Script AMP SK(+) cloning kit (Stratagene). After transformation of Epicurian Coli XL1-Blue MRF[prime] Kan supercompetent cells, plasmid DNA was extracted from white colonies with the Qiagen Plasmid Minikit and subsequently sequenced using primers T3 and T7.

Table 1. Oligonucleotides used in this study
Name Location Sequence (5[prime]->3[prime])
RARA    
R2 Exon 5 GCACCTCCTTCTTCTTCTTG
R3 Exon 3 CAGCCCTCACAGGCGCTGAC
R4 Exon 3 CTGGGCACTATCTCTTCAGAACT
STAT5b    
Stgn Exon n TGCTTGGAAGTTTGATTCTC
StgU Exon n - 1 GTTTGACGGTGTGATGGAAGTG
StgL2 Exon n + 1 AAGTCTCTGGTGGTAAAAGG
Stex5[prime] First exon CTCAGCAGCTCCAAGGAGAAGC
St165U Last exon AGCTTCTTCATCTTCACCA
Stg8 Intron n CCAGCACTTTGGGAGGCC
St165L 3[prime]-UTR AAACACATACTCGCACTCG

Construction of the patient genomic library

A phage library was constructed from patient genomic DNA extracted from bone marrow leukaemic cells by inserting partially MboI-digested DNA into the XhoI site of the [lambda] FixII vector (Stratagene) and the library was packaged with Gigapack II Plus Packaging extracts according to the manufacturers' protocols. The total phage library (106 phages) was screened with a 5.5 kb EcoRI genomic probe used to confirm an RARA gene rearrangement in the patient (1). A total of five bacteriophages were isolated after three rounds of screening. Bacteriophage DNAs were prepared with the Qiagen Lambda Maxi kit. Hybridization of the RARA 5.5 kb EcoRI genomic probe on EcoRI-digested phage DNA identified two phages (Ea and Da) spanning the junction fragment. Hybridization of chemiluminescence-labeled R4 and Stgn oligoprobes confirmed the presence of exonic sequences derived from both STAT5b and RARA in the 6.5 kb junction fragment.

Sequencing of the junction fragment was performed on the R4/Stgn PCR product of DNA from phage clones Ea and Da. PCR products were analysed by electrophoresis on a 0.8% agarose gel. The 2.4 kb band was purified with a Gel Extraction kit (Qiagen). Initially, sequencing was performed with R4 and Stgn; subsequently nested primers were designed to reach the joining site.

Sequencing reaction

Purified PCR products (30-100 ng) or cloned DNA (800 ng) were cycle sequenced using dye terminator chemistry with the AmpliTaq FS enzyme (Applied Biosystems) and were run on an ABI 373 DNA sequencer.

Isolation of a genomic clone containing the STAT5b gene

PAC 196p17 containing the entire coding region of the STAT5b gene was obtained after PCR screening of the RPCI1 PAC library constructed by Ioannou et al. (60). Primary and secondary pools as well as individual microtitre plates were purchased from the UK HGMP Resource Centre (Cambridge, UK). Initial PCR screening was performed with primers St165U and St165L flanking the STAT5b stop codon. DNA from PAC 196p17 was prepared with the Qiagen Maxi-prep kit. The presence of the 5[prime]-end of STAT5b was shown by Southern blot analysis with the Stex5[prime] oligoprobe. Labelling by terminal transferase with digoxigenin-11-ddUTP, incubation with an alkaline phosphatase-conjugated anti-digoxigenin antibody and autoradiography were performed following standard methods.

Immunocytochemistry

Patient and control bone marrow cells cryopreserved at -80°C were thawed and washed twice with an isotonic solution and cell pellets were then resuspended in the isotonic solution at 5 × 106 cells/ml. Aliquots of 250 000 cells were spread out on SuperFrost slides with a Cytospin at 400 r.p.m. for 5 min. Cells were subsequently air dried and fixed in cold 70% alcohol for 5 min at 4°C and washed twice for 5 min in cold phosphate-buffered saline (pH 7.2). For double-labelling, slides were then co-incubated for 2 h at room temperature with a mouse monoclonal antibody to RARA [Ab9a(F)(9a-9A6); 1/100] (Prof. P. Chambon, Strasbourg, France) and with rabbit polyclonal IgG STAT5b N-20 or STAT5b C-17 (2 mg/ml; Santa Cruz Biotechnology). After a second incubation with rhodamine-conjugated sheep anti-rabbit antibody (1/40; Oncor) for 30 min at room temperature, a final incubation with FITC-conjugated rabbit anti-mouse antibody (1/40; Dako) for 30 min at room temperature was performed. The slides were washed in phosphate-buffered saline and mounted with antifade (Oncor).

Southern blotting

Total genomic DNA from lymphocytes or from bone marrow cells was extracted with the Nucleon BACC3 DNA isolation kit (Amersham). Southern blot analysis was performed following standard methods. Rearrangement of the STAT5b locus was investigated with the full-length STAT5b cDNA.

FISH

FISH analysis was performed with PAC 196p17 on cytogenetic preparations from a normal male. Prometaphase chromosomes were prepared following the standard procedures. The D17S258 Smith-Magenis probe (Oncor) were used as a marker for chromosome 17p11.2. The D17S258 probe also contains a RARA-specific probe. PAC 196p17 DNA (17q12) was labelled by nick-translation (Biotin-Nick Translation Mix; Boehringer Mannheim) with 16-dUTP-biotin. Suppression of repetitive sequences with Cot-1 DNA followed by co-hybridization of D17S258, RARA and PAC 196p17 were done following standard methods. Washes, signal detection and amplification were performed according to the chromosome in situ hybridization protocol (Oncor). The chromosomes were counterstained with DAPI antifade (Oncor) and visualized with a Zeiss Axioplan fluorescent microscope equipped with a PSI Power Gene FISH System analyser.

ACKNOWLEDGEMENTS

The authors wish to thank Prof. C.C.A. Bernard (Melbourne, Australia), Dr O. Bernard (INSERM U434), Prof. P. Leblond, F. Wuilque, Drs M.T. Daniel and J. Buisine for helpful discussions. They are also indebted to Profs P. Chambon (IGBMC-LGME-U184-ULP) and W.J. Leonard (Bethesda, MD) for the RARA antibody and the STAT5b cDNA, respectively. We are grateful to L. Maury for help with the patient genomic library screening and to F. Poly for PAC library screening. We also thank Profs G. Faure and M.C. Bene for help with immunocytochemistry and M. Franck and B. Petitjean for technical assistance. This work was supported by Association pour la Recherche contre le Cancer, Ligue Nationale contre le Cancer, la Fondation contre la Leucémie and Association Française de lutte contre les Myopathies. C.A. was supported by a fellowship from the Ministère de la Recherche et de l'Espace (no. 94951338083).

REFERENCES

1. de Thé, H., Chomienne, C., Lanotte, M., Degos, L. and Dejean, A. (1990) The t(15;17) translocation of acute promyelocytic leukaemia fuses the retinoic acid receptor [alpha] gene to a novel transcribed locus. Nature, 347, 558-561. MEDLINE Abstract

2. Chen, Z., Brand, N.J., Chen, A., Chen, S.J., Tong, J.H., Wang, Z.Y., Waxman, S. and Zelent, A. (1993) Fusion between a novel Kruppel-like zinc finger gene and the retinoic acid receptor [alpha] locus due to a variant t(11;17) associated with acute promyelocytic leukaemia. EMBO J., 12, 1161-1167. MEDLINE Abstract

3. Redner, R.L., Rush, E.A., Faas, S., Rudert, W.A. and Corey, S.J. (1996) The t(5;17) variant of acute promyelocytic leukemia expresses a nucleophosmin-retinoic acid receptor fusion. Blood, 87, 882-886. MEDLINE Abstract

4. Wells, R.A., Catzavelos, C. and Kamel-Reid, S. (1997) Fusion of retinoic acid receptor [alpha] to NuMA, the nuclear mitotic apparatus protein, by a variant translocation in acute promyelocytic leukaemia. Nature Genet., 17, 109-113. MEDLINE Abstract

5. Jonveaux, P., Le Coniat, M., Derre, J., Flexor, M.A., Daniel, M.T. and Berger, R. (1996) Chromosome microdissection in leukemia: a power tool for the analysis of complex chromosomal rearrangements. Genes Chromosomes Cancer, 15, 26-33. MEDLINE Abstract

6. Darnell, J.E.Jr (1997) STATs and gene regulation. Science, 277, 1630-1635. MEDLINE Abstract

7. Pellegrini, S. and Dusanter-Fourt, I. (1997) The structure, regulation and function of the Janus kinases (JAKs) and the signal transducers and activators of transcription (STATs). Eur. J. Biochem., 248, 615-633. MEDLINE Abstract

8. Heim, M.E. (1999) The Jak-STAT pathway: cytokine signalling from the receptor to the nucleus. J. Recept. Signal Transduct. Res., 19, 75-120. MEDLINE Abstract

9. Wakoa, H., Gouilleux, F. and Groner, B. (1994) Mammary gland factor (MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response. EMBO J., 13, 182-191.

10. Lin, J.X., Mietz, J., Modi, W.S., John, S. and Leonard, W.J. (1996) Cloning of human Stat5b. J. Biol. Chem., 271, 10738-10744. MEDLINE Abstract

11. Moriggl, R., Gouilleux-Gruart, V., Jähne, R., Berchtold, S., Gartmann, C., Liu, X., Hennighausen, L., Sotiropoulos, A., Groner, B. and Gouilleux, F. (1996) Deletion of the carboxyl-terminal transactivation domain of MGF-Stat5 results in sustained DNA binding and a dominant negative phenotype. Mol. Cell. Biol., 16, 5691-5700. MEDLINE Abstract

12. Gouilleux, F., Pallard, C., Dusanter-Fourt, I., Wakao, H., Haldosen, L.-A., Norstedt, G., Levy, D. and Groner, B. (1995) Prolactin, growth hormone, erythropoietin and granulocyte-macrophage colony stimulating factor induce MGF-Stat5 DNA binding activity. EMBO J., 14, 2005-2013. MEDLINE Abstract

13. Welte, T., Koch, F., Schuler, G., Lechner, J., Doppler, W. and Heufler, C. (1997) Granulocyte-macrophage colony-stimulating factor induces a unique set of STAT factors in murine dendritic cells. Eur. J. Immunol., 27, 2737-2740. MEDLINE Abstract

14. Teglund, S., McKay, C., Schuetz, E., van Deursen, J.M., Stravopodis, D., Wang, D., Brown, M., Bodner, S., Grosveld, G. and Ihle, J.N. (1998) Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell, 93, 841-850. MEDLINE Abstract

15. al-Shami, A., Mahanna, W. and Naccache, P.H. (1998) Granulocyte-macrophage colony-stimulating factor-activated signaling pathways in human neutrophils. J. Biol. Chem., 273, 1058-1063. MEDLINE Abstract

16. Caldenhoven, E., van Dijk, T.B., Tjimensen, A., Raaijmakers, J.A.M., Lammers, J.W.J., Koenderman, L. and de Groot, R.P. (1998) Differential activation of functionally distinct STAT5 proteins by Il-5 and GM-CSF during eosinophil and neutrophil differentiation from human CD34+ hematopoietic stem cells. Stem Cells, 16, 397-403. MEDLINE Abstract

17. Welte, T., Leitenberg, D., Dittel, B.N., al-Ramadi, B.K., Xie, B., Chin, Y.E., Janeway, C.A.Jr, Bothwell, A.L.M., Bottomly, K. and Fu, X.Y. (1999) STAT5 interaction with the cell receptor complex and stimulation of T-cell proliferation. Science, 283, 222-225. MEDLINE Abstract

18. Wilks, A.F. and Oates, A.C. (1996) The JAK/STAT pathways. Cancer Surv., 27, 139-163. MEDLINE Abstract

19. Mui, A.L., Wakao, H., Kinoshita, T., Kitamura, T. and Miyajima, A. (1996) Suppression of interleukin-3-induced gene expression by a C-terminal truncated Stat5: role of Stat5 in proliferation. EMBO J., 15, 2425-2433. MEDLINE Abstract

20. van der Plas, D.C., Smiers, F., Pouwels, K., Hoefsloot, L.H., Lowenberg, B. and Touw, I.P. (1996) Interleukin-7 in human B cell precursor acute lymphoblastic leukemia cells and murine BAF3 cells involves activation of STAT1 and STAT5 mediated via the interleukin-7 receptor alpha chain. Leukemia, 10, 1317-1325. MEDLINE Abstract

21. Imada, K., Bloom, E.T., Nakajima, H., Horvath-Arcidiacono, J.A., Udy, G.B., Davey, H.W. and Leonard, W.J. (1998) Stat5b is essential for natural killer cell-mediated proliferation and cytolytic activity. J. Exp. Med., 7, 2067-2074.

22. Matikainen, S., Sareneva, T., Ronni, T., Lehtonen, A., Koskinen, P.J. and Julkunen, I. (1999) Interferon-[alpha] activates multiple STAT proteins and upregulates proliferation-associated IL-2Ra, c-myc and pim-1 genes in human T cells. Blood, 93, 1980-1991. MEDLINE Abstract

23. Dong, F., Xiuwen, L., de Koning, J.P., Touw, I.P., Henninghausen, L., Larner, A. and Grimley, P.M. (1998) Stimulation of STAT5 by granulocyte colony-stimulating factor (G-CSF) is modulated by two distinct cytoplasmic regions of the G-CSF receptor. J. Immunol., 161, 6503-6509. MEDLINE Abstract

24. Chrétien, S., Varlet, P., Verdier, F., Gobert, S., Cartron, J.P., Gisselbrecht, S., Mayeux, P. and Lacombe, C. (1996) Erythropoietin-induced erythroid differentiation of the human erythroleukemia cell line TF-1 correlates with impaired STAT5 activation. EMBO J., 15, 4174-4181. MEDLINE Abstract

25. Meyer, J., Jücker, M., Ostertag, W. and Stocking, C. (1998) Carboxyl-truncated STAT5b is generated by a nucleus-associated serine protease in early hematopoietic progenitors. Blood, 91, 1901-1908. MEDLINE Abstract

26. Wang, D., Stravopodis, D., Teglund, S., Kitazawa, J. and Ihle, J.N. (1996) Naturally occurring dominant negative variants of STAT5. Mol. Cell. Biol., 16, 6141-6148. MEDLINE Abstract

27. Yu, C.R., Ortaldo, J.R., Curiel, R.E., Young, H.A., Anderson, S.K. and Gosselin, P. (1999) Role of a STAT binding site in the regulation of the human perforin promoter. J. Immunol., 162, 2785-2790. MEDLINE Abstract

28. Gerbert, G.A., Park, S.H. and Waxman, D.J. (1999) Termination of growth hormone pulse-induced STAT5b signaling. Mol. Endocrinol., 13, 38-56. MEDLINE Abstract

29. Zhu, M., John, S., Berg, M. and Leonard, W.J. (1999) Functional association of Nmi with Stat5 and Stat1 in IL-2 and INF[gamma]-mediated signaling. Cell, 96, 121-130. MEDLINE Abstract

30. Tashiro, S., Kotomura, N., Tanaka, K., Suzuki, K., Kyo, T., Dohy, H., Niwa, O. and Kamada, N. (1994) Identification of illegitimate recombination hot spot of the retinoic acid receptor alpha gene involved in 15;17 chromosomal translocation of acute promyelocytic leukemia. Oncogene, 9, 1939-1345. MEDLINE Abstract

31. Tashiro, S., Wang, Z., Kotomura, N., Niwa, O., Ueda, K. and Kamada, N. (1997) Nuclear proteins binding to the recombination hotspot region of the retinoic acid receptor alpha gene. Leukemia, 11 (suppl. 3), 285-286. MEDLINE Abstract

32. Yoshida, H., Naoe, T., Fukutani, H., Kiyoi, H., Kubo, K. and Ohno, R. (1995) Analysis of the joining sequences of t(15;17) translocation in human acute promyelocytic leukemia: sequence non-specific recombination between the PML and RARA genes within identical short stretches. Genes Chromosomes Cancer, 12, 37-44. MEDLINE Abstract

33. Diverio, D., Lo Coco, F., D'Adamo, F., Biondi, A., Fagioli, M. and Grignani, F. (1992) Identification of DNA rearrangements at the retinoic receptor-[alpha] (RAR-[alpha]) locus in all patients with promyelocytic leukemia (APL) and mapping of APL breakpoints within the RAR-[alpha] second intron. Blood, 79, 3331-3336. MEDLINE Abstract

34. Bentley Lawrence, J., Carter, K.C. and Gerdes, M.J. (1992) Extending the capabilities of interphase chromatin mapping. Nature Genet., 2, 171-172. MEDLINE Abstract

35. Hong, S.H., David, G., Wong, C.W., Dejean, A. and Privalsky, M.L. (1997) SMRT corepressor interacts with PLZF and with the PML-retinoic acid receptor a (RAR[alpha]) and PLZF-RAR[alpha] oncoproteins associated with acute promyelocytic leukemia. Proc. Natl Acad. Sci. USA, 94, 9028-9033. MEDLINE Abstract

36. Lin, R.J., Nagy, L., Inoue, S., Shao, W., Miller, W.H.Jr and Evans, R.M. (1998) Role of the histone deacetylase complex in acute promyelocytic leukaemia. Nature, 391, 811-813. MEDLINE Abstract

37. Grignani, F., De Matteis, S., Nervi, C., Tomassoni, L., Gelmetti, V., Cioce, M., Zamir, I., Seiser, C., Grignani, F., Lazar, M.A., Minucci, S. and Pelicci, P.G. (1998) Fusion proteins of the retinoic acid receptor-[alpha] recruit histone deacetylase in promyelocytic leukaemia. Nature, 383, 815-818.

38. Guidez, F., Ivins, S., Zhu, J., Soderstrom, M., Waxman, S. and Zelent, A. (1998) Reduced retinoic acid-sensitivities of nuclear receptor corepressor binding to PML- and PLZF-RARalpha underlie molecular pathogenesis and treatment of acute promyelocytic leukemia. Blood, 91, 2634-2642. MEDLINE Abstract

39. Quignon, F., De Bels, F., Koken, M., Feunteun, J., Ameisen, J.C. and de Thé, H. (1998) PML induces a novel caspase-independent death process. Nature Genet., 20, 259-265. MEDLINE Abstract

40. Wang, Z.G., Ruggero, D., Ronchetti, S., Zhong, S., Gaboli, M., Rivi, R. and Pandolfi, P.P. (1998) Pml is essential for multiple apoptotic pathways. Nature Genet., 20, 266-272. MEDLINE Abstract

41. Lo Coco, F., Nervi, C., Avvisati, G. and Mandelli, F. (1998) Acute promyelocytic leukemia: a curable disease. Leukemia, 12, 1866-1880. MEDLINE Abstract

42. Chen, H., Lin, R.J., Schiltz, R.L., Chakravarti, D., Nash, A., Nagy, L., Privalsky, M.L., Nakatani, Y. and Evans, R.M. (1997) Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell, 90, 569-580. MEDLINE Abstract

43. Luo, H., Hanratty, W.P. and Dearolf, C.R. (1995) An amino acid substitution in Drosophila hopTum-1 Jak kinase causes leukemia-like hematopoietic defects. EMBO J., 14, 1412-1420. MEDLINE Abstract

44. Migone, T.S., Lin, J.X., Cereseto, A., Mulloy, J.C., O'Shea, J.J., Franchini, G. and Leonard, W.J. (1995) Constitutively activated Jak-Stat pathway in T cells transformed with HTLV-I. Science, 269, 79-81. MEDLINE Abstract

45. Takemoto, S., Mulloy, J.C.C., Cereseto, A., Migone, T.S., Patel, B.K.R., Matsuoka, M., Yamaguchi, K., Takatsuki, K., Kamihira, S., White, J.D., Leonard, W.J., Waldmann, T. and Franchini, G. (1997) Proliferation of adult T cell leukemia/lymphoma cells is associated with the constitutive activation of JAK/STAT proteins. Proc. Natl Acad. Sci. USA, 94, 13897-13902. MEDLINE Abstract

46. Zhang, Q., Nowak, I., Vonderheid, E.C., Rook, A.H., Kadin, M.E., Nowel, P.C., Shaw, L.E. and Wasik, M.A. (1996) Activation of Jak/STAT proteins involved in signal transduction pathway mediated by receptor for interleukin-2 in malignant T cell lymphocytes derived from cutaneous anaplastic large T-cell lymphoma and Sezary syndrome. Proc. Natl Acad. Sci. USA, 93, 9148-9153. MEDLINE Abstract

47. Gouilleux-Gruart, V., Debierre-Grockiego, F., Gouilleux, F., Capiod, J.C., Claisse, J.F., Delobel, J. and Prin, L. (1997) Activated Stat related transcription factors in acute leukemia. Leukemia Lymphoma, 28, 83-88.

48. Weber-Nordt, R., Egen, C., Wehinger, J., Ludwig, W., Gouilleux-Gruart, V., Mertelsman, R. and Finke, J. (1996) Constitutive activation of STAT proteins in primary lymphoid and myeloid leukemia cells and in Epstein-Barr virus (EBV)-related lymphoma cell lines. Blood, 88, 809-816. MEDLINE Abstract

49. Carlesso, N., Frank, D.A. and Griffin, J.D. (1996) Tyrosyl phosphorylation and DNA binding activity of signal transducers and activators of transcription (STAT) proteins in hematopoietic cell lines transformed by Bcr/Abl. J. Exp. Med., 183, 811-820. MEDLINE Abstract

50. Shuai, K., Halpern, J., ten Hoeve, J., Rao, X. and Sawyers, C.L. (1996) Constitutive activation of STAT5 by the BCR-ABL oncogene in chronic myelogenous leukemia. Oncogene, 13, 247-254. MEDLINE Abstract

51. Hayakawa, F., Towatari, M., Iida, H., Wakao, H., Kiyoi, H., Naoe, T. and Saito, H. (1998) Differential constitutive activation between STAT-related proteins and MAP kinase in primary acute myelogenous leukaemia. Br. J. Haematol., 101, 521-528. MEDLINE Abstract

52. Xia, Z., Baer, M.R., Block, A.W., Baumann, H. and Wetzler, M. (1998) Expression of signal transducers and activators of transcription proteins in acute myeloid leukemia blasts. Cancer Res., 58, 3173-3180. MEDLINE Abstract

53. Arcasoy, M.O., Harris, K.W. and Borget, B.G. (1999) A human erythropoietin receptor gene mutant causing familial erythrocytosis is associated with deregulation of the rates of Jak2 and Stat5 inactivation. Exp. Hematol., 27, 63-74. MEDLINE Abstract

54. Lacronique, V., Boureux, A., Delle Valle, V., Poirel, H., Quang, C.T., Mauchauffe, M., Berthou, C., Lessard, M., Berger, R., Ghysdael, J. and Bernard, O.A. (1997) A TEL-JAK2 fusion protein with constitutive kinase activity in human leukemia. Science, 278, 1309-1312. MEDLINE Abstract

55. Peeters, P., Raynaud, S.D., Cools, J., Wlodarska, I., Grosgeorge, J., Philip, P., Monpoux, F., Van Rompaey, L., Baens, M., Van den Berghe, H. and Marynen, P. (1997) Fusion of TEL, the ETS-variant gene 6 (ETV6), to the receptor-associated kinase JAK2 as a result of t(9;12) in a lymphoid and t(9;15;12) in a myeloid leukemia. Blood, 90, 2535-2540. MEDLINE Abstract

56. Schwaller, J., Frantsve, J., Aster, J., Williams, I.R., Tomasson, M.H., Ross, T.S., Peeters, P., Van Rompaey, L., Van Etten, R.A., Ilaria, R.J., Marynen, P. and Gilliland, D.G. (1998) Transformation of hematopoietic cell lines to growth-factor independence and induction of a fatal myelo- and lymphoproliferative disease in mice by retrovirally transduced TEL/JAK2 fusion genes. EMBO J., 17, 5321-5333. MEDLINE Abstract

57. Nieborowska-Skorska, M., Wasik, M.A., Slupianek, A., Salomoni, P., Kitamura, T., Calabretta, B. and Skorski, T. (1999) Signal transducer and activator of transcription (STAT)5 activation by BCR/ABL is dependent on intact Src homology (SH)3 and SH2 domain of BCR/ABL and is required for leukemogenesis. J. Exp. Med., 189, 1229-1242. MEDLINE Abstract

58. Zhang, X., Blenis, J., Li, H.C., Schindler, C. and Chen-Kiang, S. (1995) Requirement of serine phosphorylation for formation of STAT-promoter complexes. Science, 267, 1990-1994. MEDLINE Abstract

59. Gupta, S., Yan, H., Wong, L., Ralph, S., Krolewski, J. and Schindler, C. (1996) The SH2 domains of STAT1 and STAT2 mediate multiple interactions in the transduction IFN-[alpha] signals. EMBO J., 15, 1075-1084. MEDLINE Abstract

60. Ioannou, P.A., Amemiya, C.T., Garnes, J., Kroisel, P.M., Shizuya, H., Batzer, M.A. and de Jong, P.J. (1994) A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nature Genet., 6, 84-89. MEDLINE Abstract


+These authors contributed equally to this work
§To whom correspondence should be addressed. Tel: +33 3 83 15 37 69; Fax: +33 3 83 15 37 72; Email: p.jonveaux{at}chu-nancy.fr


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: jnl.info{at}oup.co.uk
Last modification:
Copyright© Oxford University Press, 1999.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
BloodHome page
M. A. Sanz, D. Grimwade, M. S. Tallman, B. Lowenberg, P. Fenaux, E. H. Estey, T. Naoe, E. Lengfelder, T. Buchner, H. Dohner, et al.
Management of acute promyelocytic leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet
Blood, February 26, 2009; 113(9): 1875 - 1891.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. Koppikar, V. W. Y. Lui, D. Man, S. Xi, R. L. Chai, E. Nelson, A. B.J. Tobey, and J. R. Grandis
Constitutive Activation of Signal Transducer and Activator of Transcription 5 Contributes to Tumor Growth, Epithelial-Mesenchymal Transition, and Resistance to Epidermal Growth Factor Receptor Targeting
Clin. Cancer Res., December 1, 2008; 14(23): 7682 - 7690.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Z.-Y. Wang and Z. Chen
Acute promyelocytic leukemia: from highly fatal to highly curable
Blood, March 1, 2008; 111(5): 2505 - 2515.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Catalano, M. A. Dawson, K. Somana, S. Opat, A. Schwarer, L. J. Campbell, and H. Iland
The PRKAR1A gene is fused to RARA in a new variant acute promyelocytic leukemia
Blood, December 1, 2007; 110(12): 4073 - 4076.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
G.-B. Zhou, J. Zhang, Z.-Y. Wang, S.-J. Chen, and Z. Chen
Treatment of acute promyelocytic leukaemia with all-trans retinoic acid and arsenic trioxide: a paradigm of synergistic molecular targeting therapy
Phil Trans R Soc B, June 29, 2007; 362(1482): 959 - 971.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. L. Reineke, H. Liu, M. Lam, Y. Liu, and H.-Y. Kao
Aberrant Association of Promyelocytic Leukemia Protein-Retinoic Acid Receptor-{alpha} with Coactivators Contributes to Its Ability to Regulate Gene Expression
J. Biol. Chem., June 22, 2007; 282(25): 18584 - 18596.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Vlasakova, Z. Novakova, L. Rossmeislova, M. Kahle, P. Hozak, and Z. Hodny
Histone deacetylase inhibitors suppress IFN{alpha}-induced up-regulation of promyelocytic leukemia protein
Blood, February 15, 2007; 109(4): 1373 - 1380.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. S. Carver and P. P. Pandolfi
Mouse modeling in oncologic preclinical and translational research.
Clin. Cancer Res., September 15, 2006; 12(18): 5305 - 5311.
[Abstract] [Full Text] [PDF]


Home page
ASH ANNUAL MEETING ABSTRACTSHome page
R. E. Gallagher, S. Mak, E. Paietta, B. Cooper, W. C. Ehmann, and M. S. Tallman
Identification of a Second Acute Promyelocytic Leukemia (APL) Patient with the STAT5b-RAR{alpha} Fusion Gene among PML-RAR{alpha}-Negative Eastern Cooperative Oncology Group (ECOG) APL Protocol Registrants.
Blood (ASH Annual Meeting Abstracts), November 16, 2004; 104(11): 3005 - 3005.
[Abstract]


Home page
Mol. Cell. Biol.Home page
S. Dong, D. L. Stenoien, J. Qiu, M. A. Mancini, and D. J. Tweardy
Reduced Intranuclear Mobility of APL Fusion Proteins Accompanies Their Mislocalization and Results in Sequestration and Decreased Mobility of Retinoid X Receptor {alpha}
Mol. Cell. Biol., May 15, 2004; 24(10): 4465 - 4475.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. W. Sternberg and D. G. Gilliland
The Role of Signal Transducer and Activator of Transcription Factors in Leukemogenesis
J. Clin. Oncol., January 15, 2004; 22(2): 361 - 371.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Benekli, M. R. Baer, H. Baumann, and M. Wetzler
Signal transducer and activator of transcription proteins in leukemias
Blood, April 15, 2003; 101(8): 2940 - 2954.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Dong and D. J. Tweardy
Interactions of STAT5b-RARalpha , a novel acute promyelocytic leukemia fusion protein, with retinoic acid receptor and STAT3 signaling pathways
Blood, April 15, 2002; 99(8): 2637 - 2646.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. B. Maurer, C. Wichmann, A. Gross, H. Kunkel, T. Heinzel, M. Ruthardt, B. Groner, and M. Grez
The Stat5-RARalpha fusion protein represses transcription and differentiation through interaction with a corepressor complex
Blood, April 15, 2002; 99(8): 2647 - 2652.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
J. L. Hummel, T. Zhang, R. A. Wells, and S. Kamel-Reid
The Retinoic Acid Receptor {alpha} (RAR{alpha}) Chimeric Proteins PML-, PLZF-, NPM-, and NuMA-RAR{alpha} Have Distinct Intracellular Localization Patterns
Cell Growth Differ., April 1, 2002; 13(4): 173 - 183.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
J. L. Slack, S. Waxman, G. Tricot, M. S. Tallman, and C. D. Bloomfield
Advances in the Management of Acute Promyelocytic Leukemia and Other Hematologic Malignancies with Arsenic Trioxide
Oncologist, April 1, 2002; 7(90001): 1 - 13.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Kastner, H. J. Lawrence, C. Waltzinger, N. B. Ghyselinck, P. Chambon, and S. Chan
Positive and negative regulation of granulopoiesis by endogenous RAR{alpha}
Blood, March 1, 2001; 97(5): 1314 - 1320.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Frade, M. Balbo, and M. Barel
RB18A, Whose Gene Is Localized on Chromosome 17q12-q21.1, Regulates in Vivo p53 Transactivating Activity
Cancer Res., December 1, 2000; 60(23): 6585 - 6589.
[Abstract] [Full Text]


Home page
BloodHome page
D. Sainty, V. Liso, A. Cantu-Rajnoldi, D. Head, M.-J. Mozziconacci, C. Arnoulet, L. Benattar, S. Fenu, M. Mancini, E. Duchayne, et al.
A new morphologic classification system for acute promyelocytic leukemia distinguishes cases with underlying PLZF/RARA gene rearrangements
Blood, August 15, 2000; 96(4): 1287 - 1296.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Grimwade, A. Biondi, M.-J. Mozziconacci, A. Hagemeijer, R. Berger, M. Neat, K. Howe, N. Dastugue, J. Jansen, I. Radford-Weiss, et al.
Characterization of acute promyelocytic leukemia cases lacking the classic t(15;17): results of the European Working Party
Blood, August 15, 2000; 96(4): 1297 - 1308.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (101)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Arnould, C.
Right arrow Articles by Jonveaux, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arnould, C.
Right arrow Articles by Jonveaux, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?