Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (86)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Holder, J. L.
Right arrow Articles by Zinn, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holder, J. L., Jr
Right arrow Articles by Zinn, A. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2000, Vol. 9, No. 1 101-108
© 2000 Oxford University Press

Profound obesity associated with a balanced translocation that disrupts the SIM1 gene

J. Lloyd Holder, Jr, Nancy F. Butte1 and Andrew R. Zinn+

Eugene McDermott Center for Human Growth and Development and Department of Internal Medicine, The University of Texas Southwestern Medical School, 6000 Harry Hines Boulevard, Dallas, TX 75235, USA and 1Children’s Nutrition Research Center and Department of Pediatrics, Baylor College of Medicine, 1100 Bates Street, Houston, TX 77030, USA

Received 13 September 1999; Revised and Accepted 27 October 1999.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Studies of mice and humans have revealed a number of genes that when mutated result in severe obesity. We have studied a unique girl with early-onset obesity and a de novo balanced translocation between chromo- somes 1p22.1 and 6q16.2. Her weight gain is most likely due to excessive food intake, since measured energy expenditure was normal. We cloned and sequenced both translocation breakpoints. The translocation does not appear to affect any transcription unit on 1p, but it disrupts the SIM1 gene on 6q. SIM1 encodes a human homolog of Drosophila Sim (Single-minded), a tran- scription factor involved in midline neurogenesis, and is a prototypical member of the bHLH-PAS (basic helix–loophelix + period, aryl hydrocarbon receptor, Single-minded) gene family. Our subject’s trans- location separates the 5' promoter region and bHLH domain from the 3' PAS and putative transcriptional regulation domains. The transcriptional targets of SIM1 are not known. Mouse Sim1 is expressed in the developing kidney and central nervous system, and is essential for formation of the supraoptic and paraventricular (PVN) nuclei of the hypothalamus. Previous neuroanatomical and pharmacological studies have implicated the PVN in the regulation of body weight: PVN neurons express the melanocortin 4 receptor and appear to be physiological targets of {alpha}-melanocyte-stimulating hormone, which inhibits food intake. We hypothesize that haploinsufficiency of SIM1, possibly acting upstream or downstream of the melanocortin 4 receptor in the PVN, is responsible for severe obesity in our subject.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The prevalence of obesity is increasing in the USA and other developed countries. A 20% increase in body weight is associated with increased incidence of non-insulin-dependent diabetes mellitus, hypertension, osteoarthritis and hyper- lipidemia. Numerous family, twin and adoption studies over the past 60 years indicate that the heritability of obesity is of the order of 0.4–0.8 (1,2); in most cases the pattern of inheritance is polygenic. Genetic studies in humans and laboratory animals have mapped quantitative trait loci that influence body weight and diabetes susceptibility (3), but the molecular nature of these genes is as yet unknown.

In contrast, studies of monogenic obesity in mice have greatly advanced our knowledge of the endocrine and metabolic pathways regulating body weight. Five mouse spontaneous obesity mutations have been cloned: diabetes, fat, obese, tubby and yellow. The most famous of these are obese, which encodes leptin (4), and diabetes, which encodes the leptin receptor (57). Leptin is a polypeptide hormone secreted by adipocytes; the hypothalamus receives this signal and responds by negatively regulating food intake. Fat encodes carboxypeptidase E, an enzyme necessary for normal processing of neuropeptides such as proopiomelanocortin (POMC), which is involved in central control of feeding behavior as well as processing of hormones such as proinsulin that regulate peripheral energy metabolism (8). Yellow is a mutation causing ectopic expression of the Agouti gene, which encodes a competitive antagonist of {alpha}-melanocyte-stimulating hormone ({alpha}-MSH) signaling (9).

Predictably, screening of morbidly obese humans has identified rare mutations in some of these same genes, including leptin (10) and the leptin receptor (11). Human mutations associated with obesity have also been discovered in genes encoding other elements of these pathways, such as POMC (12), prohormone convertase I (13), which cooperates with carboxypeptidase E in prohormone processing, and the melanocortin 4 receptor (MC4R) (14,15), a key hypothalamic target of {alpha}-MSH (16). Clinical and metabolic studies of these rare human patients have complemented studies of laboratory rodents in defining the roles of these molecules in energy balance and revealed some interesting species differences, e.g. the association of leptin deficiency with hypercortisolemia in mice but not humans (10).

We report clinical and molecular studies of a unique patient with obesity and a balanced 1p;6q chromosome translocation. The results suggest an unsuspected role for a transcription factor in the regulation of food intake. The transcription factor, SIM1, is critical for the formation of the supraoptic and paraventricular hypothalamic nuclei in mice. The latter nucleus is well known to be involved in energy homeostasis (17). Our data suggest that SIM1 plays a role in this function.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Clinical studies
The proband (SW116) was referred to a pediatric geneticist at age 18 months because of excessive growth. A prenatal karyotype performed for advanced maternal age revealed a de novo balanced translocation between the short arm of chromosome 1 and the long arm of chromosome 6: karyotype 46,XX,t(1;6)(p22.1;q16.2). She was delivered at term by Cesarean section after an uncomplicated pregnancy. At birth she weighed 3.7 kg [National Center for Health Statistics (NCHS) Z-score +1.5 SD] and was 53 cm long (+1.3 SD). Accelerating growth was noted at age 3 months, and by 25 months she weighed 19.8 kg (+5.2 SD) and was 96 cm tall (+3.1 SD) (weight for height +3.5 SD). She was not dysmorphic and, apart from her obesity, there were no features suggestive of Prader–Willi, Bardet–Biedl or other well defined syndromes. An umbilical hernia present during infancy resolved without treatment.

The father was 188 cm tall and weighed 104 kg [body mass index (BMI) = 29.4], the mother was 160 cm tall and weighed 54 kg (BMI = 21.1) and a male sib at age 51 months was 111 cm tall (+1.5 SD) and weighed 22.4 kg (+2.5 SD) (weight for height +1.9 SD). Abdominal computerized tomography (CT) and pituitary magnetic resonance imaging of the proband were normal. Laboratory tests revealed slightly elevated serum insulin (16 µU/ml; normal 2–13 µU/ml); normal thyroid-stimulating hormone, glucose, growth hormone, somatomedin-C, calcium and phosphate; and slightly depressed cortisol (5.9 µg/dl; normal 8.7–22.4 µg/dl) concentrations. Repeat tests at age 53 months were normal, except for a radiographic bone age measurement of 82 months. Serum leptin concentrations were 16 and 24 ng/ml at 38 and 53 months of age, respectively, commensurate with her obesity (18,19).

The proband’s height curve has remained stable at +3 SD, whereas her weight and weight-for-height curves continue to deviate upward (Fig. 1A–C). Her rate of weight gain is comparable with that of girls with mutations in leptin or leptin receptor (Fig. 1D). The mother noted mild hyperphagia beginning around age 4 years. There has been no evidence of developmental delay, preschool difficulties or precocious puberty.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 1. Growth curves. Weight (A), height (B) and weight-for-stature curves (C). Thick line, SW116; thin line, mean; dashed line, ±3 SD (52). (D) Weight curve for SW116 compared with girls with mutations in leptin (triangles) (10) or leptin receptor genes (diamonds) (11). Negative inflections represent dietary and/or pharmacological interventions.

 
SW116’s body composition, food intake and energy expenditure were studied at age 67 months. She weighed 47.5 kg (+9.3 SD) and was 127.2 cm tall (+3.2 SD) (weight for height +6.3 SD). Fat mass was 52%, with generalized distribution. A 3 day food intake record by the mother indicated energy intake of 5017 kJ/day. Her basal and sleeping metabolic rates, measured by 24 h calorimetry, were slightly greater than predicted by equations derived from calorimetry of 318 girls (unpublished data) (Fig. 2). The 24 h respiratory quotient was normal at 0.86. Total energy expenditure in the free-living state measured by the doubly labeled water method was 8314 kJ/day, significantly greater than her reported energy intake. The ratio of total energy expenditure to basal metabolic rate, an index of physical activity level, was 1.45, which is within the range of measurements (1.3–2.5) observed for a series of 101 normal 8-year-old girls (unpublished data). Observation of her ad libitum consumption revealed an aggressive, voracious appetite.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 2. Energy expenditure measurements. Basal metabolic rate (BMR), sleeping metabolic rate (SMR) and total energy expenditure (TEE) were measured by 24 h calorimetry for SW116 (open bars) and compared with values predicted from her gender, age, race and body weight (hatched) or from her fat-free mass and fat mass (stippled). Gray bar, SW116’s TEE measured by the doubly labeled water method.

 
Molecular studies
Review of the cytogenetic literature revealed two patients with complex phenotypes that included early-onset obesity and small interstitial deletions of 6q (20,21) potentially overlapping SW116’s breakpoint (Fig. 3). We hypothesized that SW116’s unusual growth was due to haploinsufficiency of a gene on 6q. We tested a number of CEPH megaYACs (where YAC is yeast artificial chromosome) from the Whitehead Institute contig by fluorescence in situ hybridization (FISH) against the patient’s cell line and identified one clone, y852C9, that gave signals on both the der(1) and der(6) chromosomes as well as from chromosome 6 (data not shown). Sequence-tagged sites (STSs) mapping to this YAC clone were used to isolate a smaller Washington University YAC, yA35F11, that also crossed the breakpoint by FISH, and allowed us to map the breakpoint between D6S475 and WI6516. We then isolated bacterial artificial chromosome (BAC) clones using markers WI6516, AFM176xg9 and D6S475, and sequenced the ends of these clones to generate additional STS markers. A BAC and P1 artificial chromosome (PAC) contig (Fig. 4) was constructed by iterative library screening, end sequencing and STS content mapping. We confirmed that BAC b325C19 crossed the breakpoint by FISH and also found that the del(6)(q16.2q21) subject reported by Villa et al. (21) (Fig. 3) was deleted for this probe (data not shown).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 3. Cytogenetic abnormalities of 6q associated with obesity. (A) Partial karyotype of SW116 showing balanced translocation. (B) Idiograms of chromosome 6 depicting SW116 translocation breakpoint (arrow) and two interstitial deletions associated with obesity (20,21).

 


View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. Large-insert clone contigs containing translocation breakpoints. (A) 6q16.2 breakpoint. (B) 1p22.1 breakpoint. y, YAC; b, BAC; P, PAC; T, T7 end; S, Sp6 end.

 
To facilitate further breakpoint mapping, we made a somatic cell hybrid selectively retaining the der(1) chromosome. STS content mapping using this hybrid allowed us to position the chromosome 6 breakpoint on our contig and to map the chromosome 1 breakpoint between markers WI7492 and D1S1673. Three BAC clones containing D1S1673 were isolated and STSs generated from end sequences. All three clones crossed the breakpoint by STS content mapping and by FISH (data not shown).

Database searches revealed a match between one end of BAC clone b353H2, which crosses the 6q breakpoint, and a 177 kb contiguous genomic sequence from 6q16 deposited in GenBank (accession no. Z86062). Additional genomic sequence from BAC clone b21C21 crossing the 1p breakpoint was generated by the Sanger Center (GenBank accession no. AL049861). We used these genomic sequences to design additional primers used to fine-map the breakpoints by polymerase chain reaction (PCR) (data not shown). Restriction fragments from either side of the translocation detected a novel der(6) junction fragment (Fig. 5A). Similar results were obtained for the der(1) chromosome (data not shown), indicating that the translocation was not accompanied by a large concomitant deletion. We PCR-amplified and sequenced both junctions and found that the translocation deleted only a single base pair of chromosome 6 and none of chromosome 1 (Fig. 5B).



View larger version (77K):
[in this window]
[in a new window]
 
Figure 5. Novel junction fragment in SW116. (A) Genomic DNA from SW116 or her parents was digested with XbaI and hybridized with a fragment from chromosome 6 (left). The blot was stripped and rehybridized with a fragment from chromosome 1 (right). (B) Sequences of junction fragments in SW116 versus normal chromosome 6 (GenBank accession no. Z86062, nucleotides 54278–54308) or normal chromosome 1 [GenBank accession no. AL049861, version .8 (GI:5777829); nucleotides 80545–80574, reverse complement].

 
The translocation disrupts SIM1
BLAST analysis of >84 kb of contiguous genomic sequence from BAC clone b21C21, as well as exon trapping experiments using clones b261L4 and b219G7, failed to identify any 1p22 transcription units disrupted by the translocation (data not shown). In contrast, sequence and mapping data indicated that the 6q breakpoint lies within a known gene, SIM1. Inspection of the intron/exon structure of SIM1 indicated that the translocation breakpoint falls within the first intron and separates the 5' flanking sequence and the first exon from downstream exons (Fig. 6).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. SIM1 gene structure and translocation breakpoint in SW116. Structure of human SIM1 gene (A) and protein (B). Gray areas, coding regions; hatched areas, functional domains; arrows, translocation breakpoint.

 
To determine whether our proband’s other SIM1 allele was normal, we PCR-amplified and sequenced all SIM1 exons and splice sites (data not shown). She is heterozygous for a silent C->T substitution at nucleotide 1328 in exon 9 of the coding sequence. We found no other mutations. Thus, SW116 is presumably heterozygous for a loss-of-function SIM1 mutation. Attempts to detect SIM1 transcripts by reverse transcription (RT)–PCR of RNA from control and patient lymphoblastoid cells were unsuccessful.

SIM1 mutations are probably not a common cause of early-onset obesity
We performed mutation detection using single-strand conformation polymorphism (SSCP) analysis and limited DNA sequencing on samples from 45 markedly obese children referred to a pediatric endocrinologist. We found no other coding or splice site mutations (data not shown). The C->T silent substitution in SW116 appears to be a common polymorphism. Eight of the 45 obese children were heterozygous for the T allele, and the remaining subjects were homozygous for the C allele. In comparison, 9 of 33 controls were heterozygous for the T allele, and the remainder were homozygous for the C allele. There was no significant association of obesity with this polymorphism ({chi}2 = 0.53, 0.25 < P < 0.5).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We identified a mutation in the SIM1 gene in a girl with profound obesity and increased linear growth. We suspect that her weight gain must involve occult food consumption, since measured energy expenditure was normal and was significantly greater than her reported caloric intake. We hypothesize that SIM1 haploinsufficiency causes her phenotype. If this hypothesis is correct, obesity due to SIM1 mutations would be expected to show autosomal dominant inheritance. We cannot test this prediction in our kindred, since the translocation occurred de novo. We did not find any additional SIM1 mutations by SSCP in 45 other children with marked obesity, but such mutations may be identified by screening larger numbers of subjects with more sensitive techniques. Linkage of obesity to 6q16.2 has not been reported in large genetic studies, but these studies have not specifically examined subjects with severe, early-onset obesity. The physical map of 6q16.2 and the availability of SIM1 genomic sequences should facilitate testing for associations between obesity and the SIM1 gene.

We cannot exclude the possibility that one or both of the SIM1 gene fragments are expressed as part of a fusion gene, although we did not identify any other transcription units in close proximity to the breakpoints. It is also possible that a truncated SIM1 transcript produces a dominant-negative protein. The reported interstitial 6q deletions associated with early-onset obesity are consistent with our haploinsufficiency model. Screening additional patients with early-onset obesity might reveal additional microscopic or submicroscopic deletions of SIM1.

Position effects on expression of nearby genes could also account for the phenotype of our proband. Inspection of the human transcript map revealed no other obvious candidate genes near either translocation breakpoint. The leptin receptor gene (LEPR) maps to 1p31, >20 Mb from the 1p breakpoint, and this locus appeared to be intact by FISH (data not shown). The only human obesity-related trait that has been genetically mapped near either breakpoint is a quantitative trait locus for 24 h respiratory quotient linked to D1S550 on 1p31–p21 in a study of Pima Indians (22). However, this locus is unlikely to be relevant to our subject’s phenotype, since her 24 h respiratory quotient was normal.

It is also possible that the phenotype of our proband and her translocation are coincidental. Indeed, her father and brother, who do not carry the translocation, are large. However, unlike the proband, the father’s obesity developed during adulthood, and the brother’s growth was not sufficiently abnormal to bring him to medical attention. Nevertheless, as with any complex trait, genetic background and environmental factors undoubtedly contribute to the severity of the phenotype.

SIM1 is a mammalian homolog of the Drosophila transcription factor Single-minded, a prototypical member of the bHLH-PAS (basic helix–loop–helix + period, aryl hydrocarbon receptor, Single-minded) family of proteins. Homozygous loss-of-function mutations in Drosophila Single-minded result in the failure of formation of midline central nervous system structures (23). Two mouse genes, Sim1 and Sim2, were cloned by nucleotide sequence homology (24). Both homologs are also present in humans, and the predicted mouse and human SIM1 proteins show 96% amino acid identity (25).

Dimerization of bHLH-PAS proteins with other bHLH-PAS proteins such as the aryl hydrocarbon receptor nuclear translocator is necessary for their function (26). Specificity of dimerization is mediated at least in part through the PAS domains (27). The translocation in SW116 separates the promoter and bHLH-encoding exon 1 of SIM1 from the downstream portion of the gene encoding the PAS and transcriptional regulatory domains, and probably represents a loss-of-function mutation.

By northern blot analysis, mouse Sim1 is expressed in adult kidney (24,28). Whole-mount in situ hybridization of embryonic day 16.5 mouse embryos revealed expression restricted to the kidney tubules, spinal cord and parts of the midbrain and forebrain. Particularly interesting is Sim1’s expression in anterior hypothalamic nuclei of the forebrain. Michaud et al. (29) determined that Sim1 is highly expressed in the supraoptic (SON), paraventricular (PVN) and anterior periventricular (aPV) nuclei of the hypothalamus in newborn mice. Both the SON and PVN have neuroendocrine functions. The PVN produces corticotropin-releasing factor (CRF) and thyrotropin-releasing hormone (TRH), whereas both the PVN and SON produce oxytocin and arginine vasopressin (AVP). The aPV produces somatostatin, which also impinges on the pituitary.

Targeted inactivation of Sim1 confirmed its critical role in the development of neuroendocrine lineages in the hypothalamus (29). In mice lacking SIM1, these nuclei are hypocellular and lack at least five types of secretory neuron (identified by the expression of oxytocin, vasopressin, TRH, corticotropin-releasing hormone and somatostatin) due to failure of terminal neuronal differentiation. These animals die shortly after birth, presumably due to multiple hypothalamic–pituitary axis (HPA) deficits. There is no discernible phenotype in other tissues. No growth abnormality in heterozygotes was reported, but this does not preclude a human SIM1 heterozyogous phenotype, as there are examples of other genes that are haploinsufficient in humans but not in laboratory mice, e.g. endothelin B receptor (30,31) or Sonic hedgehog (32). Detailed studies of Sim1 heterozygous mice are in progress.

Sim1 continues to be expressed in the PVN in adult mice (unpublished data), suggesting that SIM1 participates in post-developmental HPA function(s). These functions are presently obscure, since SIM1’s transcriptional targets are not known. Expression of Sim1 in the PVN is intriguing with regard to obesity, since this nucleus is critical for the integration of signals governing appetite and energy expenditure (17). Lesions in the rat PVN result in obesity, and microinjection into the PVN of virtually all known orexigenic neuro- transmitters or neuropeptides stimulates feeding. Conversely, microinjection of anorexic peptides such as CRF or leptin attenuates post-fasting food intake.

PVN neurons also express the MC4R (33), neuropeptide Y receptors Y1 (34) and Y5 (35), galanin and galanin receptors 1 and 2 (36), CRF and CRF receptor (37,38), and the orexin 2 (hypocretin) receptor (39). This nucleus appears to be an important mediator of these anorexigenic and orexigenic signals (17). Mutations in the MC4R gene have been shown to cause obesity and increased linear growth in both mice and humans (14,15). The increased linear growth phenotype is not a general feature of monogenic obesity, since leptin deficiency does not increase linear growth in humans (40) and in fact impairs linear growth in mice. In this regard, our proband’s tall stature and the coincident expression of SIM1 and MC4R in the PVN suggest that both genes may belong to the same physiological or even molecular pathway regulating growth and energy balance. Alternatively, our proband’s stature may reflect increased growth velocity without change in final height, as has been noted in other obese children and ascribed to increased insulin levels (41).

Previous genetic and pharmacological studies have identified a number of signaling molecules important for hypothalamic regulation of energy balance (17), but few studies have examined nuclear transcription. The transcription factor Fos is induced rapidly in response to cytokine-related signals, and this induction has been used to map leptin-responsive neurons in the hypothalamus (42). Mice lacking another transcription factor expressed in the hypothalamus, nHLH2, show adult-onset obesity, possibly through a quantitative defect in POMC levels in the arcuate nucleus (43). It seems likely that changes in hypothalamic gene expression mediated by transcription factors such as nHLH2 or SIM1 play a role in the long-term regulation of food intake and energy expenditure.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Clinical studies
Studies were approved by the Institutional Review Boards at the University of Texas Southwestern Medical School and Baylor College of Medicine, and informed consent was obtained for all studies.

Body weight was measured with a digital balance and height was measured with a stadiometer. Skinfold and circumference measurements were taken at various sites of the body. Dual-energy X-ray absorptiometry (DXA; Hologic 4500A, Madison, WI) was used to measure fat mass, fat-free mass and total body-bone mineral content.

A 3 day food intake record was kept by the child’s parents, after instruction by a registered dietitian. The food intake records were converted to nutrient intakes (energy, protein, fat and carbohydrate) using the Minnesota Nutrition Data System.

Energy expenditure was measured in a metabolic research unit by calorimetry or in the free-living state by the doubly labeled water method.

Calorimetry
. Energy expenditure was measured for 24 h in a room respiration calorimeter. The operation and calibration of the calorimeters have been described in detail previously (44). Energy expenditure was computed at 1 min intervals from O2 consumption and CO2 production, and used to calculate 24 h total energy expenditure, basal metabolic rate, sleeping metabolic rate and respiratory quotient.

Doubly labeled water.
Total energy expenditure over a 14 day period was calculated from the fractional turnover rates of 2H and 18O following oral ingestion of 100 mg/kg 2H2O and 125 mg/kg 18O as water (45). Isotope dilution spaces were used to compute total body water. Baseline urine samples were collected. Subsequently, one daily urine sample was collected at home for the next 14 days. The 2H and 18O abundances of the urine samples were measured by gas-isotope-ratio mass spectrometry. CO2 production (VCO2) was calculated from the dilution spaces and fractional turnover rates of 2H and 18O using the multipoint slope–intercept method. Fractionated insensible water losses were calculated from ventilatory volume and body surface area, both expressed as functions of CO2 production. Total energy expenditure was calculated using the Weir equation (46).

Molecular studies
Epstein–Barr virus-immortalized cell lines were generated from SW116 and her parents by standard methods. The balanced translocation was verified by two-color FISH as previously described (47), using whole chromosome paints for chromosomes 1 and 6. A somatic cell hybrid retaining the der(1) chromosome was constructed by fusing the patient’s lymphoblastoid cells to thymidine kinase-deficient Chinese hamster cells (48) using polyethylene glycol 4000 (Life Technologies, Rockville, MD). Colonies were selected in the presence of hypoxanthine–aminopterin–thymidine. After >10 serial passages, DNA was extracted from clones and tested by PCR for various chromosome 1 and 6 STS markers.

BAC clones were isolated by PCR screening pooled DNAs from Research Genetics (Huntsville, AL). YAC clone y852C9 was obtained from a local copy of the CEPH library. YAC clone yA35F11 was isolated by PCR screening pooled DNAs from the Washington University library. YACs and BACs were used for FISH as described previously (47). PAC clones were isolated from an arrayed library (49) by filter hybridization. BAC and PAC ends were sequenced using either a Thermo Sequenase cycle sequencing kit (Amersham Pharmacia Biotech, Uppsala, Sweden) or an ABI PRISM 310 automated sequencer (Perkin Elmer Applied Biosystems, Foster City, CA) according to the manufacturers’ instructions.

Exon trapping experiments were performed using BAC clones b261L4 and b219G7 as described (50). PCR and Southern blotting were performed using standard protocols (51). Genomic DNA from SW116 or her parents was digested with XbaI and hybridized with a KpnI–XbaI fragment from chromosome 1 (GenBank accession no. AL049861, nucleotides 83 014–85 386). After exposure to a phosphoimager screen, the filter was stripped and reprobed with a HindIII fragment from chromosome 6 (GenBank accession no. Z86062, nucleotides 54 268–54 318). Primer pairs GACCCCTTCACTCTGCTGTAACC and TCGCCGAGCCCTGTGGAGAC or CATCTTTTGTCTCCCCTCCTGAAC and CAAAAGGGTACTCTAG- CCGACTCC were used to PCR-amplify der(6) or der(1) junction sequences, respectively. Products were sequenced directly using an ABI 310 sequencer. SSCP was performed using MDE gel matrix (FMC Bioproducts, Rockland, ME) according to the manufacturer’s instructions. Primers used to amplify SIM1 exons were as follows:

CTGGGAACACCACTCTCATTTTGA and

AGAAGAAAGGGGGAACAAGACACA (exon 1);

TCAGACCCTCAAAGCTTATGTGTT and

CAGGTCCGGGTTCAGTGG (exon 2);

GCCCCCTACCCCTGCTTCC and

TGGCTTCATCTTCGTGGTA (exon 3);

GGGGAAAAACCACAAGCGGACTGC and

CCACGGCGACGGCGACATC (exon 4);

CTTGCTTCCCGCCTCCTCTGACTC and

AGCTTCCCTTCGTTCCTCTC (exon 5);

GCCGCCCTCAGGCTAGGA and

TGTGGCTGAGTCTCCCTCCCTATC (exon 6);

CAGCGGATGCGCCAAGGTTG and

TCCTGCAGGGATTGCTCTC (exon 7);

GGGGTGGGTGAAGGGGTCTCA and

CAGGCAGGCTGGTTCACC (exon 8);

AAAAAGAAAGTTGCAAAACAG and

ATGGTGGCTGATTAAGGGCTTTGT (exon 9);

CAATGAGACCTTAAGGGTGCTTGTAG and

TGGAGTTCGGGAACCCTTTCAC (exon 10);

ACATCATGTGAGCCTGTTTCAAATA and

CATAGTAAATGCTGGTAATGGGGTAT (exon 11).

The exon 10 and 11 products were digested with HhaI or MnlI, respectively, prior to SSCP.


    ACKNOWLEDGEMENTS
 
We thank R. Prueitt, W. DiBella, L. Sellati and B. Ouyang for assistance in contig construction, P. White for DNA samples from obese children, S. Gregory and the Sanger Center for DNA sequencing, J. Hoo for cells from the 6q deletion patient, R. Unger for leptin measurements, C.M. Fan and J. Michaud for communicating unpublished data, H. Hobbs and L. Magargal for helpful comments on the manuscript, and most of all patient SW116 and her parents and physicians (G. Wilson, D. Granger, J. Germak). This work was supported by the American Diabetes Association, the US Department of Agriculture, and the Medical Scientist Training Program at UT Southwestern.


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +1 214 648 1600; Fax: +1 214 648 1666; Email: azndrew.zinn@email.swmed.edu Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Stunkard, A.J., Sorensen, T.I., Hanis, C., Teasdale, T.W., Chakraborty, R., Schull, W.J. and Schulsinger, F. (1986) An adoption study of human obesity. N. Engl. J. Med., 314, 193–198.[Abstract]

2 Stunkard, A.J., Harris, J.R., Pedersen, N.L. and McClearn, G.E. (1990) The body-mass index of twins who have been reared apart. N. Engl. J. Med., 322, 1483–1487.[Abstract]

3 Perusse, L., Chagnon, Y.C., Weisnagel, J. and Bouchard, C. (1999) The human obesity gene map: the 1998 update. Obes. Res., 7, 111–129.[Web of Science][Medline]

4 Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L. and Friedman, J.M. (1994) Positional cloning of the mouse obese gene and its human homologue. Nature, 372, 425–432.[Medline]

5 Tartaglia, L.A. et al. (1995) Identification and expression cloning of a leptin receptor, OB-R. Cell, 83, 1263–1271.[Web of Science][Medline]

6 Lee, G.H., Proenca, R., Montez, J.M., Carroll, K.M., Darvishzadeh, J.G., Lee, J.I. and Friedman, J.M. (1996) Abnormal splicing of the leptin receptor in diabetic mice. Nature, 379, 632–635.[Medline]

7 Chen, H., Charlat, O., Tartaglia, L.A., Woolf, E.A., Weng, X., Ellis, S.J., Lakey, N.D., Culpepper, J., Moore, K.J., Breitbart, R.E. et al. (1996) Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell, 84, 491–495.[Web of Science][Medline]

8 Naggert, J.K., Fricker, L.D., Varlamov, O., Nishina, P.M., Rouille, Y., Steiner, D.F., Carroll, R.J., Paigen, B.J. and Leiter, E.H. (1995) Hyperproinsulinaemia in obese fat/fat mice associated with a carboxypeptidase E mutation which reduces enzyme activity. Nature Genet., 10, 135–142.[Web of Science][Medline]

9 Miller, M.W., Duhl, D.M., Vrieling, H., Cordes, S.P., Ollmann, M.M., Winkes, B.M. and Barsh, G.S. (1993) Cloning of the mouse agouti gene predicts a secreted protein ubiquitously expressed in mice carrying the lethal yellow mutation. Genes Dev., 7, 454–467.[Abstract/Free Full Text]

10 Montague, C.T., Farooqi, I.S., Whitehead, J.P., Soos, M.A., Rau, H., Wareham, N.J., Sewter, C.P., Digby, J.E., Mohammed, S.N., Hurst, J.A. et al. (1997) Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature, 387, 903–908.[Medline]

11 Clement, K., Vaisse, C., Lahlou, N., Cabrol, S., Pelloux, V., Cassuto, D., Gourmelen, M., Dina, C., Chambaz, J., Lacorte, J.M. et al. (1998) A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature, 392, 398–401.[Medline]

12 Krude, H., Biebermann, H., Luck, W., Horn, R., Brabant, G. and Gruters, A. (1998) Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. Nature Genet., 19, 155–157.

13 Jackson, R.S., Creemers, J.W., Ohagi, S., Raffin-Sanson, M.L., Sanders, L., Montague, C.T., Hutton, J.C. and O’Rahilly, S. (1997) Obesity and impaired prohormone processing associated with mutations in the human prohormone convertase 1 gene. Nature Genet., 16, 303–306.[Web of Science][Medline]

14 Vaisse, C., Clement, K., Guy-Grand, B. and Froguel, P. (1998) A frameshift mutation in MC4R is associated with a dominant form of obesity. Nature Genet., 20, 113–114.[Web of Science][Medline]

15 Yeo, G.S.H., Farooqi, I.S., Aminiam, S., Halsall, D.J., Stanhope, R.G. and O’Rahilly, S. (1998) A frameshift mutation in MC4R associated with dominantly inherited human obesity. Nature Genet., 20, 111–112.[Web of Science][Medline]

16 Huszar, D., Lynch, C.A., Fairchild-Huntress, V., Dunmore, J.H., Fang, Q., Berkemeier, L.R., Gu, W., Kesterson, R.A., Boston, B.A., Cone, R.D. et al. (1997) Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell, 88, 131–141.[Web of Science][Medline]

17 Kalra, S.P., Dube, M.G., Pu, S., Xu, B., Horvath, T.L. and Kalra, P.S. (1999) Interacting appetite-regulating pathways in the hypothalamic regulation of body weight. Endocr. Rev., 20, 68–100.[Abstract/Free Full Text]

18 Verrotti, A., Basciani, F., Morgese, G. and Chiarelli, F. (1998) Leptin levels in non-obese and obese children and young adults with type 1 diabetes mellitus. Eur. J. Endocrinol., 139, 49–53.[Abstract]

19 Garcia-Mayor, R.V., Andrade, M.A., Rios, M., Lage, M., Dieguez, C. and Casanueva, F.F. (1997) Serum leptin levels in normal children: relationship to age, gender, body mass index, pituitary-gonadal hormones, and pubertal stage. J. Clin. Endocrinol. Metab., 82, 2849–2855.[Abstract/Free Full Text]

20 Turleau, C., Demay, G., Cabanis, M.O., Lenoir, G. and de Grouchy, J. (1988) 6q1 monosomy: a distinctive syndrome. Clin. Genet., 34, 38–42.[Web of Science][Medline]

21 Villa, A., Urioste, M., Bofarull, J.M. and Martinez-Frias, M.L. (1995) De novo interstitial deletion q16.2q21 on chromosome 6. Am. J. Med. Genet., 55, 379–383.[Web of Science][Medline]

22 Norman, R.A., Tataranni, P.A., Pratley, R., Thompson, D.B., Hanson, R.L., Prochazka, M., Baier, L., Ehm, M.G., Sakul, H., Foroud, T. et al. (1998) Autosomal genomic scan for loci linked to obesity and energy metabolism in Pima Indians. Am. J. Hum. Genet., 62, 659–668.[Web of Science][Medline]

23 Nambu, J.R., Franks, R.G., Hu, S. and Crews, S.T. (1990) The single-minded gene of Drosophila is required for the expression of genes important for the development of CNS midline cells. Cell, 63, 63–75.[Web of Science][Medline]

24 Fan, C.M., Kuwana, E., Bulfone, A., Fletcher, C.F., Copeland, N.G., Jenkins, N.A., Crews, S., Martinez, S., Puelles, L., Rubenstein, J. and Tessier-Lavigne, M. (1996) Expression patterns of two murine homologs of Drosophila single-minded suggest possible roles in embryonic patterning and in the pathogenesis of Down syndrome. Mol. Cell. Neurosci., 7, 1–16.[Web of Science][Medline]

25 Chrast, R., Scott, H.S., Chen, H., Kudoh, J., Rossier, C., Minoshima, S., Wang, Y., Shimizu, N. and Antonarakis, S.E. (1997) Cloning of two human homologs of the Drosophila single-minded gene SIM1 on chromosome 6q and SIM2 on 21q within the Down syndrome chromosomal region. Genome Res., 7, 615–624.[Abstract/Free Full Text]

26 Michaud, J. and Fan, C.M. (1997) Single-minded—two genes, three chromosomes. Genome Res., 7, 569–571.[Free Full Text]

27 Zelzer, E., Wappner, P. and Shilo, B.Z. (1997) The PAS domain confers target gene specificity of Drosophila bHLH/PAS proteins. Genes Dev., 11, 2079–2089.[Abstract/Free Full Text]

28 Ema, M., Morita, M., Ikawa, S., Tanaka, M., Matsuda, Y., Gotoh, O., Saijoh, Y., Fujii, H., Hamada, H., Kikuchi, Y. and Fujii-Kuriyama, Y. (1996) Two new members of the murine Sim gene family are transcriptional repressors and show different expression patterns during mouse embryogenesis. Mol. Cell. Biol., 16, 5865–5875.[Abstract]

29 Michaud, J., Rosenquist, T., May, N. and Fan, C.-M. (1998) Development of neuroendocrine lineages requires the bHLH-PAS transcription factor SIM1. Genes Dev., 12, 3264–3275.[Abstract/Free Full Text]

30 Hosoda, K., Hammer, R.E., Richardson, J.A., Baynash, A.G., Cheung, J.C., Giaid, A. and Yanagisawa, M. (1994) Targeted and natural (piebald-lethal) mutations of endothelin-B receptor gene produce megacolon associated with spotted coat color in mice. Cell, 79, 1267–1276.[Web of Science][Medline]

31 Puffenberger, E.G., Hosoda, K., Washington, S.S., Nakao, K., deWit, D., Yanagisawa, M. and Chakravarti, A. (1994) A missense mutation of the endothelin-B receptor gene in multigenic Hirschsprung’s disease. Cell, 79, 1257–1266.[Web of Science][Medline]

32 Roessler, E., Belloni, E., Gaudenz, K., Jay, P., Berta, P., Scherer, S.W., Tsui, L.C. and Muenke, M. (1996) Mutations in the human Sonic Hedgehog gene cause holoprosencephaly. Nature Genet., 14, 357–360.[Web of Science][Medline]

33 Mountjoy, K.G., Mortrud, M.T., Low, M.J., Simerly, R.B. and Cone, R.D. (1994) Localization of the melanocortin-4 receptor (MC4-R) in neuroendocrine and autonomic control circuits in the brain. Mol. Endocrinol., 8, 1298–1308.[Abstract/Free Full Text]

34 Jacques, D., Tong, Y., Dumont, Y., Shen, S.H. and Quirion, R. (1996) Expression of the neuropeptide Y Y1 receptor mRNA in the human brain: an in situ hybridization study. Neuroreport, 7, 1053–1056.[Web of Science][Medline]

35 Gerald, C., Walker, M.W., Criscione, L., Gustafson, E.L., Batzl-Hartmann, C., Smith, K.E., Vaysse, P., Durkin, M.M., Laz, T.M., Linemeyer, D.L. et al. (1996) A receptor subtype involved in neuropeptide-Y-induced food intake. Nature, 382, 168–171.[Medline]

36 Gundlach, A.L. and Burazin, T.C. (1998) Galanin–galanin receptor systems in the hypothalamic paraventricular and supraoptic nuclei. Some recent findings and future challenges. Ann. N. Y. Acad. Sci., 863, 241–251.[Web of Science][Medline]

37 Richard, D., Rivest, R., Naimi, N., Timofeeva, E. and Rivest, S. (1996) Expression of corticotropin-releasing factor and its receptors in the brain of lean and obese Zucker rats. Endocrinology, 137, 4786–4795.[Abstract]

38 Schwartz, M.W., Seeley, R.J., Campfield, L.A., Burn, P. and Baskin, D.G. (1996) Identification of targets of leptin action in rat hypothalamus. J. Clin. Invest., 98, 1101–1106.[Web of Science][Medline]

39 Trivedi, P., Yu, H., MacNeil, D.J., Van der Ploeg, L.H. and Guan, X.M. (1998) Distribution of orexin receptor mRNA in the rat brain. FEBS Lett., 438, 71–75.[Web of Science][Medline]

40 O’Rahilly, S. (1998) Life without leptin. Nature, 392, 330–331.[Medline]

41 De Simone, M., Farello, G., Palumbo, M., Gentile, T., Ciuffreda, M., Olioso, P., Cinque, M. and De Matteis, F. (1995) Growth charts, growth velocity and bone development in childhood obesity. Int. J. Obes. Relat. Metab. Disord., 19, 851–857.[Web of Science][Medline]

42 Woods, A.J. and Stock, M.J. (1996) Leptin activation in hypothalamus. Nature, 381, 745.[Medline]

43 Good, D.J., Porter, F.D., Mahon, K.A., Parlow, A.F., Westphal, H. and Kirsch, I.R. (1997) Hypogonadism and obesity in mice with a targeted deletion of the Nhlh2 gene. Nature Genet., 15, 397–401.[Web of Science][Medline]

44 Moon, J.K., Vohra, F.A., Valerio Jimenez, O.S., Puyau, M.R. and Butte, N.F. (1995) Closed-loop control of carbon dioxide concentration and pressure improves response of room respiration calorimeters. J. Nutr., 125, 220–228.

45 IDEC Group (1990) The Doubly-Labeled Water Method for Measuring Energy Expenditure: Technical Recommendations for Use in Humans. International Atomic Energy Agency, Vienna, Austria.

46 van de Weir, J.B. (1949) New methods for calculating metabolic rate with special reference to protein metabolism. J. Physiol., 109, 1–9.

47 Guillén, D.R., Lowichik, A., Schneider, N.R., Cohen, D.S., Garcia, S. and Zinn, A.R. (1997) Prune-belly syndrome and other anomalies in a stillborn fetus with a ring X chromosome lacking XIST. Am. J. Med. Genet., 70, 32–36.[Web of Science][Medline]

48 Mohandas, T., Sparkes, R.S., Sparkes, M.C., Shulkin, J.D., Toomey, K.E. and Funderburk, S.J. (1979) Regional localization of human gene loci on chromosome 9: studies of somatic cell hybrids containing human translocations. Am. J. Hum. Genet., 31, 586–600.[Web of Science][Medline]

49 Ioannou, P.A., Amemiya, C.T., Garnes, J., Kroisel, P.M., Shizuya, H., Chen, C., Batzer, M.A. and de Jong, P.J. (1994) A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nature Genet., 6, 84–89.[Web of Science][Medline]

50 Inoue, N., Hess, K.D., Moreadith, R.W., Richardson, L.L., Handel, M.A., Watson, M.L. and Zinn, A.R. (1999) New gene family defined by MORC, a nuclear protein required for mouse spermatogenesis. Hum. Mol. Genet., 8, 1201–1207.[Abstract/Free Full Text]

51 Sambrook, J., Fritsch, E. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, NY.

52 Waterlow, J.C., Buzina, R., Keller, W., Lane, J.M., Nichaman, M.Z. and Tanner, J.M. (1977) The presentation and use of height and weight data for comparing the nutritional status of groups of children under the age of 10 years. Bull. World Health Organ., 55, 489–498.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
DiabetesHome page
M. Traurig, J. Mack, R. L. Hanson, M. Ghoussaini, D. Meyre, W. C. Knowler, S. Kobes, P. Froguel, C. Bogardus, and L. J. Baier
Common Variation in SIM1 Is Reproducibly Associated With BMI in Pi ma Indians
Diabetes, July 1, 2009; 58(7): 1682 - 1689.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Y.-C. L. Tung, M. Ma, S. Piper, A. Coll, S. O'Rahilly, and G. S. H. Yeo
Novel Leptin-Regulated Genes Revealed by Transcriptional Profiling of the Hypothalamic Paraventricular Nucleus
J. Neurosci., November 19, 2008; 28(47): 12419 - 12426.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. O'Rahilly and I. S. Farooqi
Human Obesity: A Heritable Neurobehavioral Disorder That Is Highly Sensitive to Environmental Conditions
Diabetes, November 1, 2008; 57(11): 2905 - 2910.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. I. F. Blakemore and P. Froguel
Is Obesity Our Genetic Legacy?
J. Clin. Endocrinol. Metab., November 1, 2008; 93(11_Supplement_1): s51 - s56.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. M. Kublaoui, T. Gemelli, K. P. Tolson, Y. Wang, and A. R. Zinn
Oxytocin Deficiency Mediates Hyperphagic Obesity of Sim1 Haploinsufficient Mice
Mol. Endocrinol., July 1, 2008; 22(7): 1723 - 1734.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
K. E. Foster-Schubert and D. E. Cummings
Emerging Therapeutic Strategies for Obesity
Endocr. Rev., December 1, 2006; 27(7): 779 - 793.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. G. Baskin
Single-minded view of melanocortin signaling in energy homeostasis.
Endocrinology, October 1, 2006; 147(10): 4539 - 4541.
[Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. M. Kublaoui, J. L. Holder Jr., T. Gemelli, and A. R. Zinn
Sim1 Haploinsufficiency Impairs Melanocortin-Mediated Anorexia and Activation of Paraventricular Nucleus Neurons
Mol. Endocrinol., October 1, 2006; 20(10): 2483 - 2492.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. M. Kublaoui, J. L. Holder Jr., K. P. Tolson, T. Gemelli, and A. R. Zinn
SIM1 Overexpression Partially Rescues Agouti Yellow and Diet-Induced Obesity by Normalizing Food Intake
Endocrinology, October 1, 2006; 147(10): 4542 - 4549.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
C. Yang, D. Gagnon, P. Vachon, A. Tremblay, E. Levy, B. Massie, and J. L. Michaud
Adenoviral-mediated modulation of Sim1 expression in the paraventricular nucleus affects food intake.
J. Neurosci., June 28, 2006; 26(26): 7116 - 7120.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S M Gribble, E Prigmore, D C Burford, K M Porter, B. L. Ng, E J Douglas, H Fiegler, P Carr, D Kalaitzopoulos, S Clegg, et al.
The complex nature of constitutional de novo apparently balanced translocations in patients presenting with abnormal phenotypes
J. Med. Genet., January 1, 2005; 42(1): 8 - 16.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
P. A. Gray, H. Fu, P. Luo, Q. Zhao, J. Yu, A. Ferrari, T. Tenzen, D.-i. Yuk, E. F. Tsung, Z. Cai, et al.
Mouse Brain Organization Revealed Through Direct Genome-Scale TF Expression Analysis
Science, December 24, 2004; 306(5705): 2255 - 2257.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
L. Bouchard, V. Drapeau, V. Provencher, S. Lemieux, Y. Chagnon, T. Rice, D. Rao, M.-C. Vohl, A. Tremblay, C. Bouchard, et al.
Neuromedin {beta}: a strong candidate gene linking eating behaviors and susceptibility to obesity
Am. J. Clinical Nutrition, December 1, 2004; 80(6): 1478 - 1486.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Shimba, T. Wada, S. Hara, and M. Tezuka
EPAS1 Promotes Adipose Differentiation in 3T3-L1 Cells
J. Biol. Chem., September 24, 2004; 279(39): 40946 - 40953.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. L. Holder Jr, L. Zhang, B. M. Kublaoui, R. J. DiLeone, O. K. Oz, C. H. Bair, Y.-H. Lee, and A. R. Zinn
Sim1 gene dosage modulates the homeostatic feeding response to increased dietary fat in mice
Am J Physiol Endocrinol Metab, July 1, 2004; 287(1): E105 - E113.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Yang, F. Boucher, A. Tremblay, and J. L. Michaud
Regulatory Interaction between Arylhydrocarbon Receptor and SIM1, Two Basic Helix-Loop-Helix PAS Proteins Involved in the Control of Food Intake
J. Biol. Chem., March 5, 2004; 279(10): 9306 - 9312.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. Meyre, C. Lecoeur, J. Delplanque, S. Francke, V. Vatin, E. Durand, J. Weill, C. Dina, and P. Froguel
A Genome-Wide Scan for Childhood Obesity-Associated Traits in French Families Shows Significant Linkage on Chromosome 6q22.31-q23.2
Diabetes, March 1, 2004; 53(3): 803 - 811.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K. Silander, L. J. Scott, T. T. Valle, K. L. Mohlke, H. M. Stringham, K. R. Wiles, W. L. Duren, K. F. Doheny, E. W. Pugh, P. Chines, et al.
A Large Set of Finnish Affected Sibling Pair Families With Type 2 Diabetes Suggests Susceptibility Loci on Chromosomes 6, 11, and 14
Diabetes, March 1, 2004; 53(3): 821 - 829.
[Abstract] [Full Text] [PDF]


Home page
Recent Prog Horm ResHome page
I.S. Farooqi and S. O'Rahilly
Monogenic Human Obesity Syndromes
Recent Prog. Horm. Res., January 1, 2004; 59(1): 409 - 424.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
C. Liu, E. Goshu, A. Wells, and C.-M. Fan
Identification of the Downstream Targets of SIM1 and ARNT2, a Pair of Transcription Factors Essential for Neuroendocrine Cell Differentiation
J. Biol. Chem., November 7, 2003; 278(45): 44857 - 44867.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. Lubrano-Berthelier, E. Durand, B. Dubern, A. Shapiro, P. Dazin, J. Weill, C. Ferron, P. Froguel, and C. Vaisse
Intracellular retention is a common characteristic of childhood obesity-associated MC4R mutations
Hum. Mol. Genet., January 15, 2003; 12(2): 145 - 153.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
L Faivre, V Cormier-Daire, J M Lapierre, L Colleaux, S Jacquemont, D Genevieve, P Saunier, A Munnich, C Turleau, S Romana, et al.
Deletion of the SIM1 gene (6q16.2) in a patient with a Prader-Willi-like phenotype
J. Med. Genet., August 1, 2002; 39(8): 594 - 596.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. L. Woods and M. L. Whitelaw
Differential Activities of Murine Single Minded 1 (SIM1) and SIM2 on a Hypoxic Response Element. CROSS-TALK BETWEEN BASIC HELIX-LOOP-HELIX/Per-Arnt-Sim HOMOLOGY TRANSCRIPTION FACTORS
J. Biol. Chem., March 15, 2002; 277(12): 10236 - 10243.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. L. Michaud, F. Boucher, A. Melnyk, F. Gauthier, E. Goshu, E. Levy, G. A. Mitchell, J. Himms-Hagen, and C.-M. Fan
Sim1 haploinsufficiency causes hyperphagia, obesity and reduction of the paraventricular nucleus of the hypothalamus
Hum. Mol. Genet., July 1, 2001; 10(14): 1465 - 1473.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. W. Sailer, H. Sano, Z. Zeng, T. P. McDonald, J. Pan, S.-S. Pong, S. D. Feighner, C. P. Tan, T. Fukami, H. Iwaasa, et al.
Identification and characterization of a second melanin-concentrating hormone receptor, MCH-2R
PNAS, June 7, 2001; (2001) 121170598.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. W. Sailer, H. Sano, Z. Zeng, T. P. McDonald, J. Pan, S.-S. Pong, S. D. Feighner, C. P. Tan, T. Fukami, H. Iwaasa, et al.
Identification and characterization of a second melanin-concentrating hormone receptor, MCH-2R
PNAS, June 19, 2001; 98(13): 7564 - 7569.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (86)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Holder, J. L.
Right arrow Articles by Zinn, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holder, J. L., Jr
Right arrow Articles by Zinn, A. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?