Human Molecular Genetics, 2000, Vol. 9, No. 1 79-85
© 2000 Oxford University Press
The sex-linked fidget mutation abolishes Brn4/Pou3f4 gene expression in the embryonic inner ear
Departments of Neuroscience and Otorhinolaryngology, 36th and Hamilton Walk, 1Head and Neck Surgery, University of Pennsylvania, Philadelphia, PA 19104-6074, USA and 2MRC Mammalian Genetics Unit, Harwell, Oxon OX11 0RD, UK
Received 6 August 1999; Revised and Accepted 14 October 1999.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
We have demonstrated that the phenotype of the mouse mutant sex-linked fidget (slf) is caused by developmental malformations of the inner ear that result in hearing loss and vestibular dysfunction. Recently, pilot mapping experiments suggested that the mouse Brn4/Pou3f4 gene co-segregated with the slf locus on the mouse X chromosome. These mapping data, in conjunction with the observation that the vertical head-shaking phenotype of slf mutants is identical to that observed in mice with a targeted deletion of the Brn4 gene, suggested that slf is a mutant allele of the Brn4 gene. In this paper, we have identified the nature of the slf mutation, and demonstrated that it is an X chromosomal inversion with one breakpoint close to Brn4. This inversion selectively eliminates the expression of the Brn4 gene in the developing inner ear, but not the neural tube. Finally, these results demonstrate that the slf mutation is a good mouse model for the most prevalent form of X-linked congenital deafness in man, which is associated with mutations in the human Brn4 ortholog, POU3F4.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
POU-domain genes have been shown to play important developmental roles in a number of organ systems and, often, mutations in these genes lead to congenital anomalies in man (for a review see ref. 1). These genes encode transcription factors that share a common homeodomain-related motif, referred to as the POU-domain. This domain represents a bipartite DNA-binding motif, consisting of the POU-homeodomain and an ~75 amino acid POU-specific domain. The POU-specific domain cooperates with the POU-homeodomain to enhance its binding affinity and specificity when compared with the classical homeodomain-containing Hox genes.
In the inner ear, POU-domain genes have been implicated in developmental anomalies associated with deafness in mice and man (2–6). For example, the mouse POU-domain gene, Brn3.1/Pou4f3, and its human ortholog, POU4F3, have been implicated in the ontogeny of hair cells (4–6). We have previously demonstrated that the Brn4/Pou3f4 gene plays an important role in the development of mouse inner ear, in particular those structures derived from the mesenchyme-derived otic capsule (2). Furthermore, mutations in the human ortholog of this gene, POU3F4, result in the most common form of X-linked non-syndromic deafness, DFN3 (3).
Analysis of both induced and naturally occurring mutations in mice provide the means to fully characterize the function and genetic regulation of a gene. To this end, we have characterized the mouse mutation, sex-linked fidget (slf), and our data indicate that slf is an allele of Brn4. The mouse mutant slf arose in a radiation mutagenesis experiment which made use of the In(X)1H inversion carrying the male prenatal lethal bare patches (Bpa) mutation to test for induced sex-linked lethals (7). Slf was discovered in the progeny of In(X)1H Bpa+/+++ females, who carried both the irradiated X chromosome and the In(X)1H inversion, and is inherited in a sex-linked recessive manner, with slf/Y males exhibiting a mild head-shaking which is most easily scored at weaning age. Early mapping experiments (8) indicated that slf showed close linkage to the tabby (Ta) locus, which lies in the central portion of the mouse X chromosome in a region homologous to Xq13.1 of the human X chromosome.
In this paper, we demonstrate that the slf mutation disrupts the genetic regulatory regions of the Brn4/Pou3f4 gene. This mutation abolishes the expression of the Brn4 gene in the developing otic capsule, but has no effect on the expression of this gene in the neural tube. These data represent the first direct demonstration of transcriptional regulatory elements required for expression during the ontogeny of the inner ear.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Genetic mapping analyses of the slf mutation
To position slf more precisely on the mouse X chromosome, an interspecific backcross was established by mating (slf/slf x Mus spretus)F1 hybrid female progeny to 3H1 males (3H1 is the background strain of M.musculus on which slf is carried; see Materials and Methods). During the course of pilot mapping studies, in which only animals that appeared to be slf/Y were analyzed, it became apparent that fewer recombination events than expected were observed in the DXMit8–DXMit79 interval (data not shown). Possible explanations for this observation include: (i) the expression of the slf phenotype required the presence of two disparate M.musculus loci and therefore a large region of the M.musculus X chromosome; or (ii) the presence of a chromosomal inversion which would lead to an apparent suppression of recombination due to the inviability of the products of a single chiasmata (9,10). If the latter explanation was valid, then all progeny from the slf/M.spretus female parent would have suppressed recombination in the region of the inversion irrespective of whether or not slf was present. To investigate this, 110 backcross males were genotyped for a range of markers covering the mouse X chromosome and the frequencies of recombination compared with data from a (3H1 x M.spretus)F1 female x 3H1 male control backcross which did not include slf (Table 1). The most striking difference between the two data sets was a complete absence of recombination in the central region of the X chromosome Pou3f4 in the backcross segregating slf (Fig. 1a). The non-recombinant region covers a genetic distance of ~18 cM in the control backcross, which is consistent with map distances published in other backcrosses (11–13).
|
|
A chromosomal rearrangement associated with the slf mutation
To examine whether this region of recombination suppression was associated with a visible genomic rearrangement, metaphases from slf/+, +/+, slf/Y and +/Y were examined by Giemsa (G)-banding. On the X chromosome in slf/Y and on one X chromosome in the slf/+ metaphase spreads, the width of band XA7 was considerably reduced and the width of band XE was slightly increased (Fig. 1b). These findings are consistent with the presence of an inversion with breakpoints in the center of XA7 and at the XD/XE boundary. This interpretation was confirmed by fluorescence in situ hybridization (FISH) experiments. Metaphase spreads were co-hybridized to DXWas70, a pericentric repeat used to unequivocally identify the X chromosomes, and to either a mouse BAC clone containing Atp7a, which lies 4 cM proximal to Pou3f4 (14), or to a mouse YAC clone that was known to contain Pou3f4 and two more proximal loci, DXMit65 and DXMit84 (V. Reed, unpublished data). The X chromosome signal detected by both genomic clones lay closer to the centromere on one of the two chromosomes in the metaphase spreads prepared from slf/+ females but not in those prepared from +/+ females (Fig. 2). To determine whether the distal inversion breakpoint disrupted the Brn4 gene, we examined the structure of this gene in slf/Y and control animals by Southern blot analysis. No gross structural rearrangements were found using restriction digests and probes that would detect alterations within 6–10 kb of the Brn4 coding sequences (Fig. 3). These data demonstrate that the coding sequence and the neural transcriptional regulatory elements, which have been mapped close to the structural gene (D. Lee, L.-C. Nguyen, L. Lug and E.B. Crenshaw III, unpublished data), were not disrupted in the slf mutant.
|
|
phage that encompass the ~1 kb intronless Brn4 coding sequences, 6 kb of 5' flanking sequences and 9 kb of 3' flanking sequences. Therefore, these data demonstrate that no structural rearrangements of the Brn4 gene are detected within 6–9 kb of the Brn4 coding sequences. Sizes of hybridized bands shown to the right of the figure are given in kilobases. Similarly, no differences were seen between the Brn4 loci in slf/Y and +/Y littermates when genomic DNA was digested with EcoRI, HindIII, PvuII, TaqI and MspI (data not shown).Functional and anatomical analyses of the slf mutant
Previously, we have shown that the targeted mutagenesis of the Brn4 gene resulted in hearing loss and a number of developmental anomalies in the inner ear, including hypoplasia of the cochlea, stapes malformations, dysplastic temporal bones and constriction of the superior semicircular canals (2). To test whether the slf mutation complements the mutant phenotype associated with the Brn4 knockout mutation, we established intercross matings between the slf mutants and the Brn4 knockout animals, and examined the function and structure of the inner ears. To assess the hearing ability in the mutant animals, we undertook an auditory startle (Preyer’s reflex) analysis. Figure 4 illustrates that a comparable hearing loss is detected in homozygous slf mice, hemizygous Brn4 null mice and experimental animals containing one slf allele and the Brn4 knockout allele (slf/Brn4KO). Analysis of the dysplastic phenotype of the inner ear demonstrates that the slf mutant does not complement the Brn4 knockout allele at the structural level. For example, the degree of constriction of the superior semicircular canals in slf homozygotes is similar to that observed in null Brn4 knockout animals and in slf/Brn4KO animals generated by the intercross mating (Fig. 5), and the abnormalities in the fibrocytes of the spiral ligament are identical in animals from the slf and Brn4KO pedigrees and the slf/Brn4KO intercross (Fig. 6). Other dysplastic features in the inner ear of slf/Brn4KO animals that are similar to those observed in the Brn4 knockout pedigree include cochlear hypoplasia and dysmorphology of the temporal bones (data not shown). Therefore, the slf mutation does not complement any aspect of the inner ear defects associated with null alleles of Brn4.
|
|
|
Immunohistochemical analyses of Brn4 expression in slf mutants
To determine whether the inversion in slf animals affected the expression of the Brn4 gene, we undertook an immuno- histochemical analysis of Brn4 protein expression in slf mutant animals. Female slf heterozygotes were mated with wild-type male mice, and the male embryos of this cross, which would be either slf/Y or +/Y, were examined for the expression of Brn4 protein at 12.5–16.5 days post-coitum (d.p.c.). Immuno- histochemical analyses of male embryos revealed two expression patterns for the Brn4 protein (Fig. 7). Half of the embryos (n = 3) demonstrated the pattern expected in wild-type animals (15), which includes expression in both the otic capsule and the neural tube. However, half of the embryos (n = 3), presumed to carry slf, express the Brn4 protein in the neural tube, but not in the otic capsule. These data indicate that the slf mutation has eliminated the function of the transcriptional regulatory elements in the Brn4 gene that direct expression to the otic capsule during development.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
In this paper, we have demonstrated that the slf mutation results from an X-chromosomal inversion that leads to the loss of Brn4 gene expression in the otic capsule. The loss of expression could result from a disruption of the otic enhancer elements themselves or by their transposition to a different region of the X chromosome such that they are no longer transcriptionally active. Alternatively, it has been demon- strated that translocation of regions next to heterochromatin can lead to a variegated phenotype due to propagation of the inactive chromatin structure into the gene (for reviews see refs 16,17). This alternative is unlikely to explain the slf phenotype, because we do not see variegation in the phenotype. Finally, because one of the X chromosomes would be inactivated in the females used in our genetic complementation experiment, we cannot rule out the formal possibility that the slf inversion breakpoint eliminates a gene whose function is epistatic to the expression of the Brn4 gene in the inner ear. Because the proximal 5' flanking regions of the Brn4 gene are intact in the slf mutants and the neural tube regulatory elements lie within 6 kb of the coding region (D. Lee, L.-C. Nguyen, L. Lug and E.B. Crenshaw III, unpublished data), we would expect that the neural tube expression would be unaffected, as observed.
Mutations in the human ortholog of the Brn4 gene, POU3F4, also result in hearing loss and cochlear/temporal bone dysplasias very similar to those observed in Brn4 mutant animals. Interestingly, a class of these mutations result from deletions that lie upstream of POU3F4, and result in phenotypes that are identical to point mutations in the POU3F4 coding region that would abrogate the function of this POU-domain transcription factor (3,18,19). The slf data indicate that mutations upstream of the Brn4 gene abolish its expression in mouse, and suggest that these upstream deletions in the human locus result in a loss of otic transcriptional regulatory elements in the POU3F4 gene. Therefore, we hypothesize that the architecture of transcriptional regulatory elements in the human and mouse genes has been evolutionarily conserved. Our results represent the first genetic characterization of inner ear-specific transcriptional regulation, and further analyses will inevitably lead to insights into the genetic mechanisms that regulate inner ear development.
We have observed malformations in the superior semicircular canal in slf and Brn4 knockout animals (Fig. 5), despite the fact that they are on very different genetic backgrounds. Minowa et al. (20) did not observe semicircular canal defects in a Brn4/Pou3f4 knockout generated in J1 embryonic stem (ES) cells. Although there is ample precedent for different genetic backgrounds affecting knockout phenotypes, it seems unlikely that genetic background can completely explain the difference observed between the various Brn4 null mutants. Furthermore, the slf mutation was originally identified by its vertical head-bobbing phenotype, which is also seen in Brn4 knockout animals examined in this study (2). Finally, vestibular dysfunction is observed in human patients with mutations in the human ortholog, POU3F4 (21). Therefore, vestibular dysfunction and semicircular canal malformations are a common feature of Brn4 null mutants in man and mouse.
During inner ear ontogeny, the Brn4 gene is expressed in the mesenchyme of the otic capsule. A majority of the developmental malformations in Brn4 mutant animals occur in tissues derived from the otic capsule mesenchyme, including malformations in the internal auditory meatus, the spiral limbus and the fibrocytes that underlie the stria vascularis (2,20). However, there is a number of malformations that occur in tissues that do not express the Brn4 gene product. With genes such as Brn4 that are expressed in both the neural tube and the inner ear, it can be difficult to determine whether inner ear dysplasias result from hindbrain induction defects or from the site of gene action in the inner ear (22). To date, our analyses have not revealed phenotypic differences in the inner ear of slf mutants and Brn4 knockout mutants, thereby substantiating the hypothesis (2) that defects observed in the Brn4 knockout pedigree are due to loss of Brn4 gene function in the otic mesenchyme.
Some of the malformations that occur in Brn4 null mutants, such as slf, suggest that the epithelial–mesenchymal interactions that regulate otic development are disrupted (see also ref. 2). For example, the constriction of the perilymphatic space surrounding the superior semicircular canal suggests that the signals from the otic epithelium of the semicircular canals are not communicating properly with the surrounding mesenchyme. Because Brn4 is expressed only in the mesenchyme of the inner ear, it seems likely that the mesenchyme is not receiving or properly interpreting the inductive signals generated by the otic epithelium. One could argue that the defect is restricted to the mesenchyme that expresses the Brn4 gene, and has nothing to do with the semicircular canal epithelium. However, we would argue that the semicircular canal epithelium normally dictates the size and location of the perilymphatic space that surrounds it, and that the semicircular canal epithelium is required for the perilymphatic space to form. This argument is based on the observation that perilymphatic spaces surrounding the semicircular canals do not form in mutants that are missing a semicircular canal (23, our unpublished data), and that the diameter of the perilymphatic space is reduced in mutants whose semicircular canal epithelium is reduced in size (24). Therefore, we are currently examining the signaling mechanisms in the mutant animals to address this hypothesis.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Mouse crosses and genetic mapping
The SLF stock was maintained at Harwell either as two parallel matings (3H1 females x slf/Y males; slf/+ females x 3H1 males) or as a homozygous stock (slf/slf females x slf/Y males). 3H1 is an F1 hybrid produced by mating C3H/HeH females to 101/H males. All animal work carried out in the UK was performed under the guidance issued by the Medical Research Council (25) and Home Office Project Licence PPL/30/1521. The Brn4/Pou3f4 knockout was generated in R1 ES cells, and has been maintained on a C57BL/6J background for several generations (2). All animal protocols employed in the USA have been approved by the Institutional Animal Care and Use Committee at the University of Pennsylvania. To position slf more precisely on the mouse X chromosome, an interspecific backcross was established by mating (slf/slf female x M.spretus male)F1 hybrid female progeny to 3H1 males. However, when 25 male mice thought to be slf because they exhibited head-shaking behavior were genotyped with a range of markers from the central region of the mouse X chromosome, three were discovered to have a non-recombinant X chromosome derived entirely from M.spretus (data not shown). Similar findings were obtained when mice were phenotyped by examination of the inner ear structure by dissection and therefore we were unable to score slf reliably on the M.spretus background and have not included it as a genetic marker.
Polymerase chain reaction (PCR)
Primers used in the detection of microsatellite loci were synthesized commercially (Genosys Biotechnologies, Cambridge, UK) using sequences published on the Research Genetics web site (http://www.resgen.com ). Perusal of the published sequence for Pou3f4/Brn4 (26) revealed the presence of a complex dinucleotide repeat in the 3' untranslated region and primers (5'
3') CACAGGGGTTTCTAACTTCT and TGTTTCAGAGTTGAGAAGCC were designed to amplify across this repeat (nucleotides 1715–1886). All PCR reactions were carried out at an annealing temperature of 55°C and a magnesium concentration of 1.5 mM.
Chromosome analysis
Metaphase spreads were prepared from spleen cultures stimulated with lipopolysaccharide and G-banded as described previously (10). FISH was undertaken by labeling probes with biotin-14-dATP and hybridizing at concentrations of 1, 10 and 40 ng/µl for DXWas70, BACA1 and YAC RG406e10, respectively, in a total volume of 10 µl. Bound probe was detected with avidin–Texas Red and chromosomes were stained with DAPI. Metaphases (10–20) were analyzed using an ultraviolet microscope with a dual band-pass filter.
Immunohistochemical analyses of mouse inner ears
Immunohistochemical analyses and production of antibodies directed against Brn4 were described in detail by Phippard et al. (15). Briefly, rabbit antibodies were directed against the entire coding region of a glutathione (GST)–Brn4 fusion protein, and purified on an immunoaffinity column containing a fusion protein between the GST moiety and the N-terminal regions of the Brn4 coding sequences that excluded the POU-domain. Prior to embedding in paraffin, the sex of the embryos were determined by dissection and examination of the genital ridge and/or by PCR analysis of the male-specific Sry gene, as described by Hogan et al. (27). Tissue sections were processed by immunoperoxidase labeling, using the Vectastain ABC kit (Vector Laboratories, Burlingame, CA). In most cases, the immunoperoxidase signal was amplified with the TSA Indirect Tyramide Signal Amplification kit (Dupont NEN, Boston, MA), according to the manufacturer’s instructions.
Anatomical analyses of mouse inner ears
These procedures were described in detail by Phippard et al. (2). Briefly, whole mount preparations of the bony labyrinth were generated by filling the processed temporal bone with 10% white latex paint primer. Temporal bones were isolated from the intact calvaria by boiling for 3 h, followed by treatment with 1% potassium hydroxide for 2–3 days. After neutralizing the sample in phosphate-buffered saline (PBS), the bony labyrinth was perfused via the oval window with 10% latex paint primer (Dutch Boy; white multi-purpose primer sealer) in PBS. The temporal bones were bleached for 30 min in 6% hydrogen peroxide, dehydrated through a graded series of ethanols and cleared in methyl salicylate.
Histological sections were prepared via standard paraffin sectioning, followed by staining with hematoxylin and eosin.
Determination of Preyer’s reflex thresholds
Auditory function was assessed in mutant mice or their wild-type control siblings by ascertaining the pinna (Preyer’s) reflex threshold, as described in detail elsewhere (2). Briefly, mice (n = 7–14 animals of each genotype) were placed in a glass chamber and stimulated with a burst of high frequency noise. The noise stimulus was calibrated at the bottom of the chamber using a 12.5 mm condenser microphone and the sound pressure level (SPL) was expressed as dB relative to 20 µPa. The occurrence of a Preyer’s reflex was determined by an observer who did not know the genotype of the mouse. A modified method of limits was used to measure the reflex threshold. Starting at a level of 90 dB SPL, a noise burst was presented. If a pinna or startle reflex was identified, the stimulus was attenuated 10 dB and another burst presented. This approach continued until no reflex could be identified. The stimulus level was then raised 5 dB and a final trial was run. The threshold was defined as that SPL value halfway between the noise burst levels that could or could not elicit a reflex, and the error is given as a standard deviation. If there was uncertainty in the threshold, the process was repeated. Care was taken to vary the interval between burst presentations (5–20 s) to avoid habituation. This assessment of the reflex threshold provided us with an estimate of the animals’ hearing ability in the noise-band frequency range.
|
ACKNOWLEDGEMENTS |
|---|
We would like to thank David Papworth for statistical advice, Debora Brooker for assistance with animal care, the MRC Photography Department for assistance with Figures 1 and 2, and Ted Parcel for help with the histological analyses of the mutants. This work was supported by NIH R01 NS-31674, R01 DC-03917, and the UK Medical Research Council.
|
FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +1 215 898 1998; Fax: +1 215 573 9050; Email: crenshab@mail.med.upenn.edu
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Ryan, A.K. and Rosenfeld, M.G. (1997) POU domain family values: flexibility, partnerships, and developmental codes. Genes Dev., 11, 1207–1225.
2 Phippard, D., Lu, L., Lee, D., Saunders, J.C. and Crenshaw III, E.B. (1999) Targeted mutagenesis of the POU-domain gene, Brn4/Pou3f4, causes development defects in the inner ear. J. Neurosci., 19, 5980–5989.
3 de Kok, Y.J., van der Maarel, S.M., Bitner-Glindzicz, M., Huber, I., Monaco, A.P., Malcolm, S., Pembrey, M.E., Ropers, H.H. and Cremers, F.P. (1995) Association between X-linked mixed deafness and mutations in the POU domain gene POU3F4. Science, 267, 685–688.
4 Erkman, L., McEvilly, R.J., Luo, L., Ryan, A.K., Hooshmand, F., O’Connell, S.M., Keithley, E.M., Rapaport, D.H., Ryan, A.F. and Rosenfeld, M.G. (1996) Role of transcription factors Brn-3.1 and Brn-3.2 in auditory and visual system development. Nature, 381, 603–606.[Medline]
5 Xiang, M., Gan, L., Li, D., Chen, Z.Y., Zhou, L., O’Malley Jr, B.W., Klein, W. and Nathans, J. (1997) Essential role of POU-domain factor Brn-3c in auditory and vestibular hair cell development. Proc. Natl Acad. Sci. USA, 94, 9445–9450.
6 Vahava, O., Morell, R., Lynch, E.D., Weiss, S., Kagan, M.E., Ahituv, N., Morrow, J.E., Lee, M.K., Skvorak, A.B., Morton, C.C. et al. (1998) Mutation in transcription factor POU4F3 associated with inherited progressive hearing loss in humans. Science, 279, 1950–1954.
7 Lyon, M.F., Phillips, R.J., and Fisher, G. (1982) Use of an inversion to test for induced X-linked lethals in mice. Mutat. Res., 92, 217–228.[Web of Science][Medline]
8 Phillips, R.J.S. and Fisher, G. (1978) A screen for X-ray induced mutations. Mouse News Lett., 58, 44.
9 Roderick, T.H. and Hawes, N.L. (1970) Two radiation-induced chromosomal inversions in mice (Mus musculus). Proc. Natl Acad. Sci. USA, 67, 961–967.
10 Evans, E.P. and Phillips, R.J. (1975) Inversion heterozygosity and the origin of XO daughters of Bpa/+ female mice. Nature, 256, 40–41.[Medline]
11 Dietrich, W.F., Miller, J., Steen, R., Merchant, M.A., Damron-Boles, D., Husain, Z., Dredge, R., Daly, M.J., Ingalls, K.A., O’Connor, T.J. et al. (1996) A comprehensive genetic map of the mouse genome. Nature, 380, 149–152 [Erratum (1996) Nature, 381, 172].[Medline]
12 Rowe, L.B., Nadeau, J.H., Turner, R., Frankel, W.N., Letts, V.A., Eppig, J.T., Ko, M.S., Thurston, S.J. and Birkenmeier, E.H. (1994) Maps from two interspecific backcross DNA panels available as a community genetic mapping resource. Mamm. Genome, 5, 253–274 [Erratum (1994) Mamm. Genome, 5, 463].[Web of Science][Medline]
13 Rhodes, M., Straw, R., Fernando, S., Evans, A., Lacey, T., Dearlove, A., Greystrong, J., Walker, J., Watson, P., Weston, P. et al. (1998) A high-resolution microsatellite map of the mouse genome. Genome Res., 8, 531–542.
14 Boyd, Y., Blair, H.J., Cunliffe, P., Denny, P., Gormally, E. and Herman, G.E. (1998) Encyclopedia of the mouse genome VII. Mouse chromosome X. Mamm. Genome, 8, S361–S377.
15 Phippard, D.J., Heydemann, A., Lechner, M., Lu, L., Lee, D., Kyin, T. and Crenshaw III, E.B. (1998) Changes in the subcellular localization of the Brn4 gene product precede mesenchymal remodeling of the otic capsule. Hear. Res., 120, 77–85.[Web of Science][Medline]
16 Bedell, M.A., Jenkins, N.A. and Copeland, N.G. (1996) Good genes in bad neighbourhoods. Nature Genet., 12, 229–232.[Web of Science][Medline]
17 Kleinjan, D.J. and van Heyningen, V. (1998) Position effect in human genetic disease. Hum. Mol. Genet., 7, 1611–1618.
18 de Kok, Y.J., Vossenaar, E.R., Cremers, C.W., Dahl, N., Laporte, J., Hu, L.J., Lacombe, D., Fischel-Ghodsian, N., Friedman, R.A., Parnes, L.S. et al. (1996) Identification of a hot spot for microdeletions in patients with X-linked deafness type 3 (DFN3) 900 kb proximal to the DFN3 gene POU3F4. Hum. Mol. Genet., 5, 1229–1235.
19 de Kok, Y.J., Merkx, G.F., van der Maarel, S.M., Huber, I., Malcolm, S., Ropers, H.H. and Cremers, F.P. (1995) A duplication/paracentric inversion associated with familial X-linked deafness (DFN3) suggests the presence of a regulatory element more than 400 kb upstream of the POU3F4 gene. Hum. Mol. Genet., 4, 2145–2150.
20 Minowa, O., Ikeda, K., Sugitani, Y., Oshima, T., Nakai, S., Katori, Y., Suzuki, M., Furukawa, M., Kawese, T., Zheng, Y. et al. (1999) Altered cochlear fibrocytes in a mouse model of DFN3 nonsyndromic deafness. Science, 285, 1408–1411.
21 Phelps, P.D., Reardon, W., Pembrey, M., Bellman, S. and Luxom, L. (1991) X-linked deafness, stapes gushers and a distinctive defect of the inner ear. Neuroradiology, 33, 326–330.[Web of Science][Medline]
22 Steel, K.P. and Brown, S.D. (1994) Genes and deafness [review]. Trends Genet., 10, 428–435.[Web of Science][Medline]
23 Nolan, P.M., Sollars, P.J., Bohne, B.A., Ewens, W.J., Pickard, G.E. and Bucan, M. (1995) Heterozygosity mapping of partially congenic lines: mapping of a semidominant neurological mutation, Wheels (Whl), on mouse chromosome 4. Genetics, 140, 245–254.[Abstract]
24 Crenshaw, E.B., Ryan, A., Dillon, S.R., Kalla, K. and Rosenfeld, M.G. (1991) Wocko, a neurological mutant generated in a transgenic mouse pedigree. J. Neurosci., 11, 1524–1530.[Abstract]
25. Medical Research Council (1993) Responsibility in the Use of Animals for Medical Research. MRC, London, UK.
26 Hara, Y., Rovescalli, A.C., Kim, Y. and Nirenberg, M. (1992) Structure and evolution of four POU domain genes expressed in mouse brain. Proc. Natl Acad. Sci. USA, 89, 3280–3284.
27 Hogan, B., Beddington, R., Costantini, F. and Lacy, E. (1994) Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Plainview, NY.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  S. E. Sobol, X. Teng, and E. B. Crenshaw III Abnormal Mesenchymal Differentiation in the Superior Semicircular Canal of Brn4/Pou3f4 Knockout Mice Arch Otolaryngol Head Neck Surg, January 1, 2005; 131(1): 41 - 45. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. C. Morton Genetics, genomics and gene discovery in the auditory system Hum. Mol. Genet., May 15, 2002; 11(10): 1229 - 1240. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Boyd, H. J. Blair, P. Cunliffe, W. K. Masson, and V. Reed A Phenotype Map of the Mouse X Chromosome: Models for Human X-linked Disease Genome Res., March 1, 2000; 10(3): 277 - 292. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||