Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (84)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Semina, E. V.
Right arrow Articles by Graw, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Semina, E. V.
Right arrow Articles by Graw, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2000, Vol. 9, No. 11 1575-1585
© 2000 Oxford University Press

Deletion in the promoter region and altered expression of Pitx3 homeobox gene in aphakia mice

Elena V. Semina1,+, Jeffrey C. Murray1,2, Rebecca Reiter2, Ronald F. Hrstka3 and Jochen Graw4

1Department of Pediatrics, 2Biological Sciences and 3Department of Obstetrics and Gynecology, University of Iowa, Iowa City, IA 52242, USA, 4GSF-National Research Center for Environment and Health, Institute of Mammalian Genetics, D-85764 Neuherberg, Germany

Received 4 February 2000; Revised and Accepted 14 April 2000.

DDBJ/EMBL/GenBank accession no. AF224268.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 GenBank submission
 REFERENCES
 
Mouse aphakia (ak) is a recessive phenotype that spontaneously occurs in the 129/Sv-SlJ strain and is characterized by small eyes that lack a lens. We have recently identified a homeobox-containing gene, Pitx3, and have shown that it is expressed in the developing lens and maps to chromosome 19 close to ak in mouse. Human PITX3 gene was found to underlie anterior segment dysgenesis and cataracts. We have now obtained the entire sequence of the mouse Pitx3 gene including 10 kb of the 5' region and 5 kb of the 3' region. Of several microsatellite repeat regions identified within the Pitx3 sequence, one was informative for linkage analysis. No recombination was observed between ak and the Pitx3 marker, indicating that these two loci are closely linked (0.2 ± 0.2 cM). Additionally, Pitx3 transcripts were not detected in the ak/ak mice either in the lens placode or at later developmental stages of the lens by in situ hybridization. Since no differences were previously found between ak/ak and wild-type sequences in the Pitx3 coding region, we hypothesized that an etiologic mutation is located in the promoter or other regulatory regions. To test this hypothesis we studied the 5' flanking region of the Pitx3 gene. This analysis revealed a deletion of 652 bp located 2.5 kb upstream from the start point of the Pitx3 5' UTR sequence in ak/ak mice. The deletion co-segregated with the ak mutation and was not detected in 16 samples from 10 different mouse strains including the founder strains. Analysis of the 652 bp region identified sequences similar to consensus binding sites for transcription factors AP-2 and Maf that were shown to play a critical role in lens determination. These lines of evidence suggest that the abnormal ocular development in the aphakia mouse is due to the deletion upstream of the Pitx3 gene.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 GenBank submission
 REFERENCES
 
Human cataracts represent one of the major causes of treatable blindness, accounting for nearly half of all vision impairment worldwide (1). Congenital cataracts are less common (the estimated prevalence is 1 to 6 cases per 10 000 live births) but are more difficult to treat and are therefore responsible for a significant number of blind individuals in the pediatric age group (2). Moreover, healthy lens embryology is essential for the normal development of other ocular structures, particularly in the anterior chamber of the eye, that play an important role in normal vision. Analysis of factors underlying normal lens development is difficult in humans; therefore mouse models are often used in these studies.

In addition, the embryonic lens of vertebrates provides a useful model for studying gene regulation of tissue development from tissue induction to maturation. During development, the vertebrate lens is induced upon contact between presumptive retina (optic vesicle) and surface ectoderm. As a result, the ectoderm thickens into a placode that will first form a vesicle and later differentiate into a lens. To date, more than 46 mouse mutations have been described that result in lens abnormalities with some that affect early lens development (reviewed in ref. 3). Genetic factors responsible for the majority of these phenotypes are still to be determined.

Mouse aphakia (ak) is a recessive phenotype that spontaneously occurred in the 129/Sv-SlJ strain and was first described by Varnum and Stevens in 1968 (4). The phenotype of ak/ak newborn mice is characterized by small eyes that lack a lens as well as anterior segment structures. These anomalies are caused by an arrest of lens development at the stage of lens vesicle formation around embryonic days 10.5–11 (4,5). In the ak/ak mutants, there is a persistence of the lens stalk at embryonic day 12.5 interrupting the corneal mesenchyme and leading to a permanent close contact between the developing cornea and other ocular tissues without the formation of an anterior chamber (5,6). There are no other systemic abnormalities reported in these mice.

Transcription factors in general and homeodomain-containing proteins in particular are fundamental for the genetic control of different basic developmental processes. We have recently identified a homeobox-containing gene, Pitx3, and showed that it is expressed in the developing lens and maps to chromosome 19 close to ak (7). The human homolog of this gene, PITX3, which maps to the 10q24–25 region, was found, when mutated, to cause anterior segment dysgenesis with cataract and congenital total cataract in two unrelated families (8). All these facts—location, expression pattern and conserved function of the PITX3/Pitx3 gene during mammalian lens development—implicated it as being a strong candidate for the ak phenotype. Surprisingly, a search for mutations failed to identify any significant differences in the coding and exon–intron junction regions of Pitx3 between ak and wild-type genomic DNA (7) as well as mRNA (J. Graw, unpublished results) sequences.

In this paper we report close linkage between ak and Pitx3 gene, altered expression of Pitx3 in ak/ak mice and identification of a deletion in a 5' flanking region of the Pitx3 gene, which is specific for ak mice and is not seen in two strains constituting the background of this mutation as well as eight other mouse strains. Therefore we suggest that altered expression of the Pitx3 gene in ak mice is most likely a result of the deletion and leads to an abnormal phenotype in these mice.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 GenBank submission
 REFERENCES
 
Genomic sequence of the mouse Pitx3 gene: analysis of the promoter region and identification of neighboring genes Gbf1 and Cig30
The genomic sequence of the Pitx3 gene was obtained by sequencing of BAC genomic clones: complete sequence of introns and ~10 kb of a 5' flanking region and ~5 kb of a 3' flanking region was identified. The gene was found to span 12.6 kb in genomic sequence and to consist of four exons of 125, 129, 210 and 927 bp for exons 1–4, respectively, and three introns of 10729, 196 and 379 bp for introns 1–3, respectively (Fig. 1A). The genomic structure of the Pitx3 gene resembles the other Pitx genes, Pitx1 and Pitx2, with the homeobox region being interrupted by an intron at position 46 of the homeodomain and the large first intron separating the first and second exons (9). Analysis of the Pitx3 genomic sequence was performed by comparison with other sequences in GenBank using the BLAST program (http://www.ncbi.nlm.nih.gov/blast/blast.cgi ). Identification of potential transcription units was performed by GRAIL analysis and identification of consensus binding sites for different transcription factors was performed using MatInspector Version 2.2 software (http://transfac.gbf-braunschweig.de/cgi-bin/matSearch/ matsearch.pl ) as well as manually.



View larger version (94K):
[in this window]
[in a new window]
 
Figure 1. (A) Structure of the Pitx3 genomic region. The Pitx3 exons are shown as boxes numbered 1–4; the coding region is shown in gray and the homeobox region in black. The Gbf1 and Cig30 exons are located in the regions that are 5' and 3' to the Pitx3 gene, respectively; the direction of expression of each gene is indicated by arrows. The {Delta}0.652 ak/ak deletion is shown as a striped box. (B) Nucleotide sequence of the 5' flanking region of the Pitx3 gene. The sequence of the first exon is shown in uppercase letters while the sequence of the 5' flanking region is in lowercase letters; the first initiation codon (Met) is indicated. The boxed area corresponds to the 652 bp deletion. The transcription initiation site is shown in bold and assumed to be +1. Sequences similar to consensus binding sites for several transcription factors are shown as follows: AP2, highlighted in light gray; Maf, boxed bold text; forkhead-7/FOXL1, boxed italicized text.

 
Analysis of the genomic sequence identified two murine genes in close proximity to the Pitx3 gene: the Gbf1 gene, a mouse homologue of the human GBF1, a ubiquitously expressed gene of the Sec7 domain family (10), and the Cig30 gene, encoding a brown adipose tissue membrane glycoprotein (11). The Gbf1 gene sequence was identified in the 5' flanking region of the Pitx3 gene at a distance of 4.2 kb from the Pitx3 5' UTR start point; the direction of the transcription of the Gbf1 gene is opposite to that of the Pitx3 gene, hence the 5' regions of these two genes overlap (Fig. 1A). Four exons of the Cig30 gene were identified in the 4.5 kb region immediately downstream of the Pitx3 gene but oriented in the opposite direction. In fact, the 3' UTR sequences of the Cig30 and Pitx3 genes are complementary over the last 10 nucleotides. This is in agreement with a previous report (12). No other existing or potential transcription units were identified within 22 kb of Pitx3 genomic sequence.

The DNA located upstream and surrounding the transcription initiation sites typically confers promoter activity for a gene. As a transcription start point (tsp), the exact 5' end of Pitx3 mRNA from mouse embryonic carcinoma was used (7). Analysis of the 5' flanking region upstream of this tsp identified the closest potential CAAT and TATA box sequences at positions –205 to –200 and –86 to –80, and at positions –1590 to –1584 and –1560 to –1552 (Fig. 1B). Also, sequences similar to consensus binding sites for some tissue-specific transcription factors were identified: several motifs similar to the AP-2 consensus sequence 5'-CCCCAGG-3' (13) or 5'-CCCAGCCC-3' (14); several sequences similar to the alphaCE2 element, 5'-TGCTGACC-3', that was originally identified in the alpha A-crystallin gene promoter and was shown to bind Maf transcription factors (13,15); and two motifs similar to binding sites for forkhead-7 (16) (Fig. 1B). The AP-2 and Maf proteins were found to be crucial for normal formation of the craniofacial region and play an important role in lens development (1722).

Pitx3 gene and aphakia are closely linked
In previous reports, a distance of 1.8 cM between ak and Pitx3 was deduced from two independent crosses (5). In order to perform a detailed linkage analysis of Pitx3 and ak/ak, we identified seven microsatellite repeat regions within the Pitx3 genomic sequence (Table 1) and tested five of them for polymorphisms between ak/ak and the two mouse strains, AKR and JF1, which were previously used for fine mapping of the ak mutation (5). Three markers did not reveal any differences between ak/ak, AKR and JF1 mice; only the Pitx3-CT marker was informative with the JF1 strain. Therefore this marker was used to search for recombination events in the existing backcross panel of 416 F2 animals from matings (ak/ak x JF1)F1 x ak/ak (5). In particular, all animals were checked for recombinations within the interval between the markers D19Mit19 and D19Mit38 spanning the entire ak-critical region of ~8 cM. No recombination was observed between ak and the Pitx3-CT marker placing them at a distance of 0.2 ± 0.2 cM from each other. In addition, the markers D19Mit7, D19Mit8 and D19Mit102 were used in the same set of animals to refine the previous mapping data. The results led us to conclude that the marker D19Mit8 is also very close to ak; however, D19Mit102 (one recombination) and D19Mit7 (six recombinations including one double crossover) have to be placed more proximal to ak (Fig. 2A). The actual mapping positions of ak and polymorphic markers are summarized in Figure 2B.


View this table:
[in this window]
[in a new window]
 
Table 1. The identified regions in the Pitx3 genomic sequence containing repeat units
 


View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. (A) Haplotype analysis of the ak backcross. Homozygous ak/ak mice were outcrossed to JF1 mice and the heterozygous mice were backcrossed to homozygous ak mice. The heterozygous offspring were analyzed for their parental phenotypes and for the size of several microsatellite and gene-specific markers. The same offspring were screened previously for other markers (5). The total number of progeny scored for each locus is given to the right of the boxes, including the calculated distances between the loci (in cM). The number of progeny that inherited each haplotype is given below the boxes. (B) High-resolution map surrounding the ak-critical region. A high-resolution map shows the location of ak in relation to relevant markers. The distances of the markers are given in cM.

 
Moreover, the markers Pitx3-CTT and CTAC did not give a signal in the ak/ak mutants, but yielded strong signals in all tested wild-type mice suggesting that an ak-specific deletion might be present in the corresponding region (see below). Therefore, another set of primers was designed spanning the entire region including both repetitive sequences. Using these novel primers, all the ak/ak mutants revealed a shorter fragment than the wild-types: heterozygotes showed the long wild-type band and the short ak band. This strain difference also segregated in the JF1 backcross together with the ak mutation; no recombination could be detected. In conclusion, all these mapping experiments demonstrated a close linkage of ak to Pitx3 and, moreover, suggested a deletion in the region of the CTAC and CTT repeats.

Expression of the Pitx3 gene is altered in aphakia mice
The aphakia mice are characterized by severe ocular abnormalities (Fig. 3). Varnum and Stevens originally reported in 1968 (3) that the first visible abnormalities in ak lens development are seen at the early lens vesicle stage in 10.5- to 11-day embryonic ak mice, with further development of the lens and the eye being grossly disturbed. Later, Zwaan and Kirkland (23) noted that distinct anomalies are already seen at the lens placode stage in 10- to 10.5-day embryonic ak mice. Therefore, we studied expression of the Pitx3 gene in the eye in detail to see whether its expression coincides with the onset of anomalies in ak mice and to better assess the role of Pitx3.





View larger version (432K):
[in this window]
[in a new window]
 
Figure 3. Picture of ak/ak mouse (A) and histological sections of day 10.5 (B) and day 18.5 (C) ak/ak eye. Note the absence of the eye in adult mice (A) and the malformed lens vesicle with persisting lens stalk in the day 10.5 developing eye (B) as well as the absence of lens structures and anterior chamber in the day 18.5 eye (C). C, cornea; LV, lens vesicle; LS, lens stalk; OV, optic vesicle; R, retina. Bar, 100 µm.

 
Sections at the level of the eye from embryonic day 10 to postnatal day 1 were studied by in situ hybridization in wild-type mice. Adult eye RNA was analyzed by RT–PCR. Expression was first strongly detected in the late lens placode stage shortly before the start of its invagination towards the optic cup (Fig. 4). Later in development expression was seen in the lens pit and in the primary fiber cells that obliterate the lumen of the lens vesicle (Fig. 4). In the maturing lens of day 13–15 embryos the most abundant transcript is present at the equator regions as described previously (7). In the postnatal and in the adult mouse eye, Pitx3 expression is still present at low levels (data not shown).



View larger version (115K):
[in this window]
[in a new window]
 
Figure 4. Results of the in situ hybridization with Pitx3 and Pitx1 radioactive probes on sections of wild-type (left) and ak/ak embryos (right); bright and dark field photographs of every slide are presented. (AC) Day-10 embryos, (EH) day 10.25 embryos, (IL) day 11 embryos and (MT) day 14 embryos. Slides (AP) were hybridized with Pitx3 and (QT) were hybridized with Pitx1 antisense riboprobes. ov, optic vesicle; lp, lens placode; lpt, lens pit; l, lens; nr, neural retina; m, head muscles; mb, midbrain region; t, tongue; mes, gut mesenchyme; pt, pituitary; rpe, retina pigment epithelium. Bars in (A), (E) and (I), 115 µm; bars in (M) and (Q), = 0.5 mm.

 
RT–PCR analysis of Pitx3 expression was performed using total RNA extracted from whole day 10 and day 15 embryos of wild-type, ak/+ and ak/ak mice. Pitx3-specific primers were used with forward and reverse primers located in exons 1 and 2, respectively, in order to eliminate false positives from genomic DNA (see Materials and Methods). Pitx3 expression was detected in day 15 wild-type and ak/+ embryos while it was altered in three ak/ak embryos studied: completely absent in one ak/ak embryo (data not shown) and largely diminished in two (Fig. 5A). Both Cig30 and Gbf1 RNAs were detected in the day 15 embryos at a level indistinguishable between ak/ak and wild-type mice. Northern blot analysis of the Pitx3 expression was performed on the day 15 total RNA by hybridization with a radioactive probe containing partial Pitx3 cDNA sequence. Distinct signal corresponding to the Pitx3 transcript was detected in wild-type RNA but not in the ak/ak RNA after a 5-day exposure (Fig. 5B). Longer exposure allowed weak detection of the Pitx3 transcript in ak/ak RNA but its level was largely diminished in comparison with the wild-type (Fig. 5B).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. Altered expression of the Pitx3 gene and localization of the {Delta}652 deletion in the 5' region of the Pitx3 gene in ak/ak mice. (A) The RT–PCR results: lanes 1–5 represent results of PCR amplification with the Pitx3- (lanes 1–5), Cig-30- (lanes 6 and 7), Gbf1- (lanes 8 and 9) and GADPH-specific primers and cDNAs extracted from day 15 embryos. Lane 1, H2O; lane 2, wild type; lane 3, ak/+; lanes 4 and 5, ak/ak; lane 6, wild-type; lane 7, ak/ak; lane 8, wild-type; lane 9, ak/ak. (B) Northern blot results: 1 (5 days exposure) and 2 (14 days exposure), hybridization with the Pitx3 probe (nucleotides 1–1392 of Pitx3 sequence, GenBank accession no. AF005772); 3, hybridization with GADPH gene probe. (C) Picture of an agarose gel showing results of PCR amplification with {Delta}652 forward and reverse primers (see Materials and Methods) from genomic DNA from different ak/ak animals (lanes 1–3), ak/+ (lane 4), C57B6KS (lane 5), 129/Sv-SlJ (lane 6), M.spretus (lane 7), CAST (lane 8). (D) Nucleotide sequence of the {Delta}652 region obtained from ak/ak (1) and wild-type (2) genomic DNA.

 
In order to assess specific sites of Pitx3 expression in ak/ak embryos, in situ hybridization on sections was performed on day 10–16 ak/ak and wild-type embryos. While expression was missing in ak/ak embryos (Fig. 4A–P: embryonic days 10 and 14 are shown), in the wild-type embryos Pitx3 expression was detected in the lens placode and, at later stages of lens development, in the head muscles, tongue, midbrain region, mesenchyme and around the vertebrae and sternum. These observations were all in good agreement with the pattern described previously (7,8).

In order to see whether expression of other Pitx genes is altered in ak/ak embryos, expression of Pitx1 and Pitx2 was studied by RT–PCR (Pitx1, Pitx2) and in situ hybridization (Pitx1). The Pitx1 and Pitx2 genes demonstrate overlapping patterns of expression with the Pitx3 gene as has been shown for many homeobox genes belonging to the same family (7,24). Transcripts for both genes were found to be present at indistinguishable levels in the total RNA extracted from embryonic day 15 ak/ak and wild-type mice (RT–PCR data not shown). There were also no significant differences in the Pitx1 gene expression studied by in situ hybridization in embryos ranging from embryonic days 10–16 between ak and wild-type mice (Figure 4Q–T: day 12.5 is shown). Pitx1 was present in all of the sites of its normal expression and without any visible difference in the amount of transcript between the two mice: tongue, midbrain, developing pituitary and gut region. The only expression that appeared to be altered was expression in the developing lens where the Pitx1 gene is normally co-expressed with Pitx3 gene starting from the late lens vesicle stage around embryonic days 11.5–12 (E.V. Semina and R. Reiter, unpublished results). The ak/ak embryos did not show any detectable Pitx1 expression in the lens, which is most likely attributable to the evidently disturbed lens development in ak/ak embryos by this stage and therefore the lack of cells that would normally express the Pitx1 gene. It is also possible that the Pitx3 and Pitx1 genes are involved in a cascade of mutual activation in the lens as has been shown for some other paralogous homeobox genes (2527).

Identification of a deletion in the 5' region of Pitx3 gene in aphakia mice
Detailed sequence analysis of the Pitx3 5' sequence in the ak/ak mice identified a 652 bp deletion located ~2.5 kb from the start point of Pitx3 cDNA (Fig. 5C and D). This deletion was not detected in the DNA from mouse strains 129/Sv-SlJ (129S1/Sv-+p +Tyr-c MgfSl-J/+ according to the new nomenclature) and C57BLKS representing the genetic background of this mutation (4; B.A. Richards-Smith and D. Schroeder, personal communication) as well as eight other strains tested to date (Fig. 5C). Analysis of the 652 bp region revealed several motifs similar to the AP-2, Maf and forkhead 7 [now referred to as FOXL1 (28)] binding site consensus sequences (1316) (Fig. 1B) that play a crucial role during early ocular development. This suggests that the loss of binding capacity for at least some of these transcription factors might lead to a loss of Pitx3 transcripts, at least at the time during development when the eyes are being formed.

Other possible upstream regulators of Pitx3 ocular expression include Pax6, Six3, Eya1, Eya2 and Sox1–3 genes (2934). No binding sites for Pax6 or Sox proteins were found in the 652 bp deletion fragment by either MatInspector program or visual examination.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 GenBank submission
 REFERENCES
 
Over the past few years, significant advances have been made in understanding the biology of eye development and in unraveling its molecular basis (3436). Studies of mouse ocular mutants were particularly useful for the identification of genes that control these diverse morphogenetic processes (6,36).

Development of the vertebrate eye is dependent upon the complex interaction and coordinated development of tissues deriving from surface ectoderm, neural ectoderm, neural crest and mesodermal mesenchyme (35,37,38). The eye field is one of the first regions to be defined in the anterior neural plate. This region evaginates from the forebrain during the neural folding process to become the optic vesicle, which contacts with the overlying ectoderm and induces it to develop into the lens placode, which, in turn, invaginates and separates from the ectoderm to form the lens vesicle. Structures of the anterior segment of the eye such as the corneal stroma bounded by an endothelium, iris, ciliary body, trabecular meshwork and sclera are developed upon separation of the lens vesicle from the corneal ectoderm and include large contributions from neural crest mesenchyme cells (39).

In the aphakia mice, the first lens abnormalities are seen at the late lens placode–early lens vesicle stage at days 10.5–11.0 of embryonic life (4,23). The lumen of the mutant lens vesicle fills up with cells released from the lens epithelium (4). Abnormal lens morphogenesis in ak mice results in a club-shaped elongated lens structure that remains attached to the surface epithelium by a persistent connecting stalk. Failure of the lens to separate from the cornea arrests the development of the anterior chamber, which is never formed in ak mice. In ak mice the primary and secondary lens fiber cells are not produced and thus the abnormal lens structure dissolves with time so that the lumen of the eye globe becomes filled with the folding retinal tissue.

By analysis of the ak/or and ak/fi compound mutants, it was suggested that the ak gene exerts its function exclusively in the lens (40). Several candidate genes were studied for their potential role in the ak phenotype including Pax2, Fgf8 and Chuk1 and were excluded either by linkage or sequence analysis (5). Previously, we mapped the homeodomain-containing transcription factor gene Pitx3 to the vicinity of ak, but failed to identify any mutations in the Pitx3 coding region by sequencing analysis of the ak genomic DNA (7) or RT–PCR analysis of its mRNA (J. Graw, unpublished results). Subsequently, the human PITX3 gene was found to be involved in anterior segment dysgenesis with cataracts in one family and dominant congenital cataracts in another (8).

In this study, we report an analysis of the entire sequence of the Pitx3 gene, which comprises 12.6 kb in genomic sequence. The Pitx3-containing region on mouse chromosome 19 was found to be extremely gene-rich as two other genes were identified in a partially overlapping tail-to-tail (Cig30) and head-to-head (Gbf1) orientation to the Pitx3 gene at a distance of –10 bp and +4.2 kb, respectively, from the known Pitx3 cDNA sequences. The GBF1 gene encodes a putative guanine nucleo­tide exchange factor that is likely to play a housekeeping role and is ubiquitously expressed in humans (10), while the Cig30 gene encodes the membrane glycoprotein, which appears to have a role in the recruitment of brown adipose tissue and shows a restricted expression pattern (11,12). Both GBF1 and Cig30 genes are expressed during embryonic development, as is the Pitx3 gene, therefore their transcripts may form RNA duplexes, if present in the same cell.

We identified several repetitive elements in the Pitx3 genomic sequence that enabled us to map the Pitx3 gene directly in the ak backcross. No recombination events were found between ak and Pitx3 in 416 animals, placing them at distance of 0.2 ± 0.2 cM. Additionally, Pitx3 expression was found to be largely diminished in ak/ak mice affecting all of the sites in which it is normally present. No expression was detected in the lens placode and lens pit or later in the lens remnants by in situ hybridization in the ak/ak animals. This led us to suggest that the etiologic mutation might be located in the 5' region of the gene and that it affects a promoter or other regulatory elements. Such mutations were described for a variety of human and mouse phenotypes (4144). Therefore we studied the Pitx3 promoter region in the ak/ak genomic DNA and identified a deletion of 652 nucleotides ({Delta}652) residing at a distance of 2.5 kb from the start of the Pitx3 cDNA. Multiple mouse strains were tested for the presence of this deletion including 129/Sv-SlJ and C57B6KS, which represent the background of this mutation. The original ak mutation occurred spontaneously in the 129/Sv-SlJ strain, which was later crossed to C57B6KS several times to obtain more viable mice (4) and was maintained as such in the Jackson Laboratory. None of the 10 mouse strains was found to have the deletion.

The deleted 652 bp fragment contains several sequences that are similar to binding sites for ocular transcription factors. Combining the sequence analysis of the deleted region with the Pitx3 expression data in the ak/ak mice, there is striking evidence for enhancer/promoter activity in this particular region. Several motifs similar to binding consensus sequences for AP-2 and Maf transcription factors were identified in this region. The AP-2 transcription factors belong to a family of retinoic acid-responsive proteins and were shown to be required for early morphogenesis of the lens vesicle (21). A pan-specific antibody that recognizes all three AP-2 proteins detected a strong signal in the developing lens starting from the lens placode stage and in neural-crest-derived mesenchymal cells around the developing eye (21). This expression pattern resembles that of the Pitx family homeodomain transcription factor genes—developing lens for Pitx3 and Pitx1 genes, and neural-crest-derived mesenchyme for Pitx2 and Pitx1—indicating that AP-2 transcription factors might be involved in regulation of the Pitx genes during ocular development. Moreover, the AP-2{alpha}-deficient mice exhibit ocular phenotypes ranging from anophthalmia to defects in the developing lens involving persistent adhesion of the lens to the overlying surface ectoderm, which is similar to the aphakia phenotype.

The Maf family genes encode transcription factors containing a basic region/leucine zipper domain; these proteins play an important role in lens development as supported by expression and mutant studies in mice (4548). The L-maf products are first seen in the lens placode and are restricted to lens cells, which is similar to Pitx3 expression (47). Ectopic expression of L-maf converts chick embryonic ectodermal cells and cultured cells into lens fibers suggesting that this factor regulates the expression of multiple genes expressed in the lens. It was also recently shown that in the C-maf-deficient mice, lens fiber cells fail to elongate resulting in a small and hollow lens cavity and a microphthalmia phenotype (45). Both AP-2 and Maf proteins represent good candidates for upstream regulators of Pitx3 expression in the developing lens. Hence, removal of their binding sites from the Pitx3 promoter region in ak/ak mice, as a result of the {Delta}652 deletion, may be responsible for altered expression of Pitx3 in these animals. It would be interesting to investigate whether Pitx3 expression is altered in the AP-2- and Maf-deficient mice.

Also, putative binding sites were identified for proteins of the forkhead/winged-helix family of transcription factors in the deleted region (16). The forkhead genes serve as regulatory keys in embryogenesis (49); their role in ocular development has just started to be elucidated (50,51).

There are several mouse mutations that result in the formation of an abnormal lens vesicle that often remains attached to the corneal ectoderm leading to an overall disorganized eye development (3,6). In addition to the Ap-2-deficient and ak/ak mice mentioned above, this phenotype is also present in at least five other independent mutations in the mouse: dominant mouse mutations Small eye = Pax6 (52), Coloboma (53), Cat4a (54), recessive mutations dysgenetic lens (55) and lens aplasia (56,57). In humans, anterior segment dysgenesis and particularly Peters’ anomaly disorders resemble these mouse phenotypes. These disorders are characterized by corneal defects sometimes associated with keratolenticular adhesion, cataract or even aphakia (5860). Both PITX3/Pitx3 and PAX6/Pax6 genes in mouse, which are involved in aphakia and small eye, respectively (this paper and ref. 61), were found to be involved in related disorders in humans (8,62), suggesting conservation of the gene function in ocular development. Identification of cellular partners of the Pitx3 gene may reveal genes responsible for similar murine phenotypes and may also lead to the isolation of human genes responsible for defects in the anterior segment of the eye and lens development.

Conclusion
In this paper we present several lines of evidence suggesting that abnormal ocular development in mouse aphakia is caused by a mutation in the promoter region of the Pitx3 gene. First, we show that the ak and Pitx3 genes are closely linked; second, we demonstrate that the expression of Pitx3 gene is altered in ak/ak mice; third, analysis of the promoter region of the Pitx3 gene identified a deletion in ak/ak DNA, which is not present in the parental strains of ak/ak as well as eight other mouse strains tested; and fourth, several sequences similar to consensus binding sites for AP-2 and Maf transcription factors that were shown to regulate a cascade of genes involved in lens development, were identified in the deleted region. It further implicates the Pitx family of homeodomain-containing transcription factors as important determinants of lens and anterior segment development in mammals (8,9,6366).

This investigation also demonstrates that extended mutational analysis of an appropriate candidate gene may disclose etiologic mutations in regulatory regions well outside traditional gene boundaries. The mutation now provides a substrate for the investigation of the role of other factors in lens and anterior segment development.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 GenBank submission
 REFERENCES
 
Animal care
The ak/ak mice used in this study were obtained from the Jackson Laboratory and then housed by the Transgenic Core Facility at the University of Iowa, which employs an animal management program that is recommended by the American Association for Accreditation of Laboratory Animal Care and meets NIH guidelines regarding the care and use of laboratory animals. The original breeding pair, consisting of a heterozygous ak/+ female and homozygous ak/ak male, were bred with each other several times to obtain homozygous animals. They were outcrossed to C57BL/6 mice several times in order to obtain more viable animals and then crossed with each other to obtain ak/ak mice. The ak/ak embryos were collected at embryonic days 9–16 from ak/ak females impregnated by ak/ak males.

Histology
For histological analysis, embryos from a homozygous ak line were fixed in Carnoy solution and embedded in JB4 (Polysciences Europe, Eppelheim, Germany). Sections (2 µm) were cut and stained with 0.013% methylene blue and 0.035% basic fuchsin in 20% ethanol. Sections were analyzed under a Zeiss Axioplan microscope and documented with a high-resolution CCD camera (ProGres 3008; Carl Zeiss Jena, Jena, Germany). Pictures were adjusted for brightness, contrast and color balance in Adobe Photoshop 5.0.

Identification and analysis of genomic sequence
The BAC genomic clone carrying an insert that contained the entire Pitx3 gene was identified by screening the Mouse BAC Library (Research Genetics) clones for the presence of the Pitx3-specific product. The product was obtained by PCR-amplification of the library’s DNA using standard conditions (7) and specific primers that corresponded to the 5' and 3' regions of the gene: Pitx3-5'F, ctgcctgcgctccagaa; Pitx3-5'R, agtgcgtcccgcagcag; Pitx3-3'F, gcaggtctgtggatccatc; Pitx3-3'R, tgcgagggaaaaggccctct. The BAC DNA was isolated using a Qiagen plasmid DNA isolation kit following the manufacturer’s protocols (Qiagen). Sequencing of the introns and the 5' and 3' regions was performed automatically using an ABM Sequencer and Pitx3-specific primers were designed from the cDNA sequence. Contigs were assembled using Sequencer 3.0 software.

Linkage analysis
Female homozygous ak mice were mated to male JF1 mice and the heterozygous outcross animals were backcrossed to homozygous ak mice (5). The resulting backcross mice were classified for the absence or presence of the ak phenotype and genotyped for the Pitx3 polymorphic markers (see Table 1). Genomic DNA was isolated from tail clips of the backcross offspring. For comparison, genomic DNA was also isolated from wild-type AKR and JF1 mice. Hot-start PCR was performed as described previously (5). Additionally, in all cases 2 µl DMSO were added to the reaction mixture; final MgCl2 concentration and annealing temperature were as indicated in Table 1. Pitx3-CT products were analyzed using 15% polyacrylamide gel. Primers for PCR amplification of the markers D19Mit7, D19Mit8 and D19Mit102 were obtained from the NCBI homepage (http://www.ncbi.nlm.nih.gov/dbSTS/index.html ) and applied in the existing (ak/ak x JF1)F1 x ak/ak backcross (5). Annealing temperature of the markers D19Mit7 and D19Mit102 was 50°C, and 55°C for D19Mit8.

Expression studies: RT–PCR, northern blot and in situ hybridization analyses
Total RNA was prepared from embryos using the RNA extraction kit from Qiagen in accordance with the protocols supplied by the manufacturer. Total RNA (5 µg) was transcribed to the first strand of cDNA using Advantage RT-for-PCR kit from Clontech. PCR cycling after the RT step was performed with primers specific for the gene of interest and designed to flank the intron region in order to assure specific amplification of the cDNA. Products were analyzed by electrophoresis on a 1.5% agarose gel and, if needed, extracted from the gel using the gel-extraction kit from Qiagen and sequenced. Total RNA (15 µg) extracted from the day 15 wild-type and ak/ak embryos was denatured, separated on 1.2% formaldehyde gel and blotted onto Hybond N membrane (Amersham). To prepare a probe for hybridization, DNA insert containing nucleotides 30–716 of Pitx3 cDNA (7) was released from the plasmid vector by digestion with NotI and EcoRI, isolated by electrophoresis in agarose gels and subsequently purified using a column gel purification kit from Qiagen. DNA fragments were radioactively labeled with [32P]dCTP using random-primed DNA labeling kit (Boehringer Mannheim) and hybridized with the blot using conditions recommended by the manufacturer (Amersham). The in situ hybridization on embryos and sections was performed as described previously (7).

Screening of the genomic sequence for mutations
Approximately 4 kb of the 5' region of the Pitx3 gene was PCR amplified from the genomic DNA of wild-type, ak/+ and ak/ak mice using extended PCR conditions as described previously (9) and the following specific primers: Pitx3-5'-set1 (PCR product = 1140 bp), forward, aattcggcccgtgcaatctt, and reverse, taatcccagcacttgagagg; Pitx3-5'-set2 (PCR product = 1183 bp), forward, ctcgaactcaggtctgtctg, and reverse, gtgccctgatttgtcttcat; Pitx3-set3 (PCR product = 971 bp), forward, attagaggtcgttcaggatg, and reverse, taattgaggccttgggctct; Pitx3-set4 (PCR product = 701 bp), forward, aagacagacagcgacaagtg, and reverse, aaactccatggagggaggtc. The DNA fragments were prepared for automated sequencing by separation of the PCR products on 1% agarose gel, followed by extraction using a Gel Extraction kit (Qiagen) as described previously (9).

The following mouse strains were tested: AKR, JF1 (GSF, National Research Center for Environment and Health, Institute of Mammalian Genetics, Neuherberg, Germany), C57B6J, Mus spretus, CAST, B33alpha, 129/Sv-SlJ, C57B6KS, DBA, B1 (University of Iowa).


    GenBank submission
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 GenBank submission
 REFERENCES
 
The 5' region sequence of Pitx3 gene was submitted to GenBank under accession no. AF224268.


    ACKNOWLEDGEMENTS
 
We would like to thank Bonnie Ludwig for help with sequencing, Karmen Munson and Dawn Cady for animal care and Erika Bürkle for expert technical assistance during PCR-based linkage analysis. We are also grateful to B.A. Richards-Smith and D. Schroeder from the Jackson Laboratory for providing us with DNA samples and information about mouse strains used in this study. This work was supported by NIH-NEI grant EY12384 to J.C.M.


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +1 319 335 6566; Fax: +1 319 335 6970; Email: esemina@blue.weeg.uiowa.edu Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 GenBank submission
 REFERENCES
 
1 Livingston, P.M., Carson, C.A. and Taylor, H.R. (1995) The epidemiology of cataract: a review of the literature. Ophthalmol. Epidemiol., 2, 151–164.

2 Taylor, D. (1998) The Doyne Lecture. Congenital cataract: the history, the nature and the practice. Eye, 12, 9–36.

3 Smith, R.S., Sundberg, J.P. and Linder, C.C. (1997) Mouse mutations as models for studying cataracts. Pathobiology, 65, 146–154.

4 Varnum, D.S. and Stevens, L.C. (1968) Aphakia, a new mutation in the mouse. J. Hered., 59, 147–150.

5 Grimm, C., Chatterjee, B., Favor, J., Immervoll, T., Loster, J., Klopp, N., Sandulache, R. and Graw, J. (1998) Aphakia (ak), a mouse mutation affecting early eye development: fine mapping, consideration of candidate genes and altered Pax6 and Six3 gene expression pattern. Dev. Genet., 23, 299–316.

6 Graw, J. (1999) Cataract mutations and lens development. Prog. Retin. Eye Res., 18, 235–267.

7 Semina, E.V., Reiter, R.S. and Murray, J.C. (1997) Isolation of a new homeobox gene belonging to the Pitx/Rieg family: expression during lens development and mapping to the aphakia region on mouse chromosome 19. Hum. Mol. Genet., 6, 2109–2116.

8 Semina, E.V., Ferrell, R.E., Mintz-Hittner, H.A., Bitoun, P., Alward, W.L., Reiter, R.S., Funkhauser, C., Daack-Hirsch, S. and Murray, J.C. (1998) A novel homeobox gene PITX3 is mutated in families with autosomal-dominant cataracts and ASMD. Nature Genet., 19, 167–170.

9 Semina, E.V., Reiter, R., Leysens, N.J., Alward, W.L., Small, K.W., Datson, N.A., Siegel-Bartelt, J., Bierke-Nelson, D., Bitoun, P., Zabel, B.U. et al. (1996) Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nature Genet., 14, 392–399.

10 Mansour, S.J., Herbrick, J.A., Scherer, S.W. and Melancon, P. (1998) Human GBF1 is a ubiquitously expressed gene of the sec7 domain family mapping to 10q24. Genomics, 54, 323–327.

11 Tvrdik, P., Asadi, A., Kozak, L.P., Nedergaard, J., Cannon, B. and Jacobsson, A. (1997) Cig30, a mouse member of a novel membrane protein gene family, is involved in the recruitment of brown adipose tissue. J. Biol. Chem., 272, 31738–31746.

12 Tvrdik, P., Asadi, A., Kozak, L.P., Nuglozeh, E., Parente, F., Nedergaard, J. and Jacobsson, A. (1999) Cig30 and Pitx3 genes are arranged in a partially overlapping tail-to-tail array resulting in complementary transcripts. J. Biol. Chem., 274, 26387–26392.

13 Matsuo, I. and Yasuda, K. (1992) The cooperative interaction between two motifs of an enhancer element of the chicken alpha A-crystallin gene, alpha CE1 and alpha CE2, confers lens-specific expression. Nucleic Acids Res., 20, 3701–3712.

14 Mitsuda, N., Roses, A.D. and Vitek, M.P. (1997) Transcriptional regulation of the mouse presenilin-1 gene. J. Biol. Chem., 272, 23489–23497.

15 Matsuo, I., Takeuchi, M. and Yasuda, K. (1992) Identification of the contact sites of a factor that interacts with motif I (alphaCE1) of the chicken alpha A-crystallin lens-specific enhancer. Biochem. Biophys. Res. Commun., 184, 24–30.

16 Pierrou, S., Hellqvist, M., Samuelsson, L., Enerback, S. and Carlsson, P. (1994) Cloning and characterization of seven human forkhead proteins: binding site specificity and DNA bending. EMBO J., 13, 5002–5012.

17 Mitchell, P.J., Timmons, P.M., Hebert, J.M., Rigby, P.W. and Tjian, R. (1991) Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes Dev., 5, 105–119.

18 Funahashi, J., Sekido, R., Murai, K., Kamachi, Y. and Kondoh, H. (1993) Delta-crystallin enhancer binding protein delta EF1 is a zinc finger-homeodomain protein implicated in postgastrulation embryogenesis. Development, 119, 433–446.

19 Tomarev, S.I., Duncan, M.K., Roth, H.J., Cvekl, A. and Piatigorsky, J. (1994) Convergent evolution of crystallin gene regulation in squid and chicken: the AP-1/ARE connection. J. Mol. Evol., 39, 134–143.

20 Morriss-Kay, G.M. (1996) Craniofacial defects in AP-2 null mutant mice. Bioessays, 18, 785–788.

21 West-Mays, J.A., Zhang, J., Nottoli, T., Hagopian-Donaldson, S., Libby, D., Strissel, K.J. and Williams, T. (1999) AP-2alpha transcription factor is required for early morphogenesis of the lens vesicle. Dev. Biol., 206, 46–62.

22 Ring, B.Z., Cordes, S.P., Overbeek, P.A. and Barsh, G.S. (2000) Regulation of mouse lens fiber cell development and differentiation by the Maf gene. Development, 127, 307–317.

23 Zwaan, J. and Kirkland, B.M. (1975) Malorientation of mitotic figures in the early lens rudiment of aphakia mouse embryos. Anat. Rec., 182, 345–354.

24 Lanctot, C., Lamolet, B. and Drouin, J. (1997) The bicoid-related homeoprotein Ptx1 defines the most anterior domain of the embryo and differentiates posterior from anterior lateral mesoderm. Development, 124, 2807–2817.

25 Zerucha, T., Muller, J.P., Chartrand, N. and Ekker, M. (1997) Cross-interactions between two members of the Dlx family of homeobox-containing genes during zebrafish development. Biochem. Cell Biol., 75, 613–622.

26 Wang, W., Van De Water, T. and Lufkin, T. (1998) Inner ear and maternal reproductive defects in mice lacking the Hmx3 homeobox gene. Development, 125, 621–634.

27 Qu, S., Tucker, S.C., Zhao, Q., deCrombrugghe, B. and Wisdom, R. (1999) Physical and genetic interactions between Alx4 and Cart1. Development, 126, 359–369.

28 Kaestner, K.H., Knöchel, W. and Martinez, D.E. (2000) Unified nomenclature for the winged helix/forkhead transcription factors. Genes Dev., 14, 142–146.

29 Oliver, G., Loosli, F., Koster, R., Wittbrodt, J. and Gruss, P. (1996) Ectopic lens induction in fish in response to the murine homeobox gene Six3. Mech. Dev., 60, 233–239.

30 Zygar, C.A., Cook, T.L. and Grainger Jr, R.M. (1998) Gene activation during early stages of lens induction in Xenopus. Development, 125, 3509–3519.

31 Epstein, J., Cai, J., Glaser, T., Jepeal, L. and Maas, R. (1994) Identification of a Pax paired domain recognition sequence and evidence for DNA-dependent conformational changes. J. Biol. Chem., 269, 8355–8361.

32 Xu, P.X., Woo, I., Her, H., Beier, D.R. and Maas, R.L. (1997) Mouse Eya homologues of the Drosophila eyes absent gene require Pax6 for expression in lens and nasal placode. Development, 124, 219–231.

33 Kamachi, Y., Uchikawa, M., Collignon, J., Lovell-Badge, R. and Kondoh, H. (1998) Involvement of Sox1, 2 and 3 in the early and subsequent molecular events of lens induction. Development, 125, 2521–2532.

34 Gehring, W.J. and Ikeo, K. (1999) Pax 6: mastering eye morphogenesis and eye evolution. Trends Genet., 15, 371–377.

35 Jean, D., Ewan, K. and Gruss, P. (1998) Molecular regulators involved in vertebrate eye development. Mech. Dev., 76, 3–18.

36 Fini, M.E., Strissel, K.J. and West-Mays, J.A. (1997) Perspectives on eye development. Dev. Genet., 20, 175–185.

37 Saha, M.S., Servetnick, M. and Grainger, R.M. (1992) Vertebrate eye development. Curr. Opin. Genet. Dev., 2, 582–588.

38 Graw, J. (1996) Genetic aspects of embryonic eye development in vertebrates. Dev. Genet., 18, 181–197.

39 Haustein, J. (1983) On the ultrastructure of the developing and adult mouse corneal stroma. Anat. Embryol., 168, 291–305.

40 Koniukhov, B.V. and Nonchev, S.G. (1982) Interaction of the mutant aphakia, fidget and ocular retardation genes in mice. Genetika, 18, 1107–1114.

41 Bushby, K.M., Cleghorn, N.J., Curtis, A., Haggerty, I.D., Nicholson, L.V., Johnson, M.A., Harris, J.B. and Bhattacharya, S.S. (1991) Identification of a mutation in the promoter region of the dystrophin gene in a patient with atypical Becker muscular dystrophy. Hum. Genet., 88, 195–199.

42 Héon, E., Priston, M., Schorderet, D.F., Billingsley, G.D., Girard, P.O., Lubsen, N. and Munier, F.L. (1999) The {gamma}-crystallins and human cataracts: a puzzle made clearer. Am. J. Hum. Genet., 65, 1261–1267.

43 Levinson, B., Conant, R., Schnur, R., Das, S., Packman, S. and Gitschier, J. (1996) A repeated element in the regulatory region of the MNK gene and its deletion in a patient with occipital horn syndrome. Hum. Mol. Genet., 5, 1737–1742.

44 Timms, K.M., Huckett, L.E., Belmont, J.W., Shapira, S.K. and Gibbs, R.A. (1998) DNA deletion confined to the iduronate-2-sulfatase promoter abolishes IDS gene expression. Hum. Mutat., 11, 121–126.

45 Kim, J.I., Li, T., Ho, I.C., Grusby, M.J. and Glimcher, L.H. (1999) Requirement for the c-Maf transcription factor in crystallin gene regulation and lens development. Proc. Natl Acad. Sci. USA, 96, 3781–3785.

46 Kawauchi, S., Takahashi, S., Nakajima, O., Ogino, H., Morita, M., Nishizawa, M., Yasuda, K. and Yamamoto, M. (1999) Regulation of lens fiber cell differentiation by transcription factor c-Maf. J. Biol. Chem., 274, 19254–19260.

47 Ogino, H. and Yasuda, K. (1998) Induction of lens differentiation by activation of a bZIP transcription factor, L-Maf. Science, 280, 115–118.

48 Yoshida, K., Imaki, J., Koyama, Y., Harada, T., Shinmei, Y., Oishi, C., Matsushima-Hibiya, Y., Matsuda, A., Nishi, S., Matsuda, H. et al. (1997) Differential expression of maf-1 and maf-2 genes in the developing rat lens. Invest. Ophthalmol. Vis. Sci., 38, 2679–2683.

49 Kaufmann, E. and Knochel, W. (1996) Five years on the wings of fork head. Mech. Dev., 57, 3–20.

50 Kenyon, K.L., Moody, S.A. and Jamrich, M. (1999) A novel fork head gene mediates early steps during Xenopus lens formation. Development, 126, 5107–5116.

51 Kidson, S.H., Kume, T., Deng, K., Winfrey, V. and Hogan, B.L. (1999) The forkhead/winged-helix gene, Mf1, is necessary for the normal development of the cornea and formation of the anterior chamber in the mouse eye. Dev. Biol., 211, 306–322.

52 Hogan, B.L., Hirst, E.M., Horsburgh, G. and Hetherington, C.M. (1988) Small eye (Sey): a mouse model for the genetic analysis of craniofacial abnormalities. Development, 103 (suppl.), 115–119.

53 Theiler, K. and Varnum, D.S. (1981) Development of coloboma (Cm/+), a mutation with anterior lens adhesion. Anat. Embryol., 162, 121–126.

54 Grimes, P.A., Koeberlein, B., Favor, J., Neuhauser-Klaus, A. and Stambolian, D. (1998) Abnormal eye development associated with Cat4a, a dominant mouse cataract mutation on chromosome 8. Invest. Ophthalmol. Vis. Sci., 39, 1863–1869.

55 Sanyal, S. and Hawkins, R.K. (1979) Dysgenetic lens (dyl)—a new gene in the mouse. Invest. Ophthalmol. Vis. Sci., 18, 642–645.

56 Aso, S., Horiwaki, S. and Noda, S. (1995) Lens aplasia: a new mutation producing lens abnormality in the mouse. Lab. Anim. Sci., 45, 41–46.

57 Aso, S., Tashiro, M., Baba, R., Sawaki, M., Noda, S. and Fujita, M. (1998) Apoptosis in the lens anlage of the heritable lens aplastic mouse (lap mouse). Teratology, 58, 44–53.

58 Trabucchi, G., Piantanida, A., Bandello, F., Freschi, M., Nucci, P. and Brancato, R. (1997) Congenital aphakia in Peters’ anomaly syndrome. A case report. Acta Ophthalmol. Scand., 75, 595–597.

59 Myles, W.M., Flanders, M.E., Chitayat, D. and Brownstein, S. (1992) Peters’ anomaly: a clinicopathologic study. J. Pediatr. Ophthalmol. Strabismus, 29, 374–381.

60 Beauchamp, G.R. (1980) Anterior segment dysgenesis keratolenticular adhesion and aniridia. J. Pediatr. Ophthalmol. Strabismus, 17, 55–58.

61 Hill, R.E., Favor, J., Hogan, B.L., Ton, C.C., Saunders, G.F., Hanson, I.M., Prosser, J., Jordan, T., Hastie, N.D. and van Heyningen, V. (1991) Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature, 354, 522–525.

62 Hanson, I.M., Fletcher, J.M., Jordan, T., Brown, A., Taylor, D., Adams, R.J., Punnett, H.H. and van Heyningen, V. (1994) Mutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters’ anomaly. Nature Genet., 6, 168–173.

63 Gage, P.J., Suh, H. and Camper, S.A. (1999) Dosage requirement of Pitx2 for development of multiple organs. Development, 126, 4643–4651.

64 Kitamura, K., Miura, H., Miyagawa-Tomita, S., Yanazawa, M., Katoh-Fukui, Y., Suzuki, R., Ohuchi, H., Suehiro, A., Motegi, Y., Nakahara, Y. et al. (1999) Mouse pitx2 deficiency leads to anomalies of the ventral body wall, heart, extra- and periocular mesoderm and right pulmonary isomerism. Development, 126, 5749–5758.

65 Lin, C.R., Kioussi, C., O’Connell, S., Briata, P., Szeto, D., Liu, F., Izpisua-Belmonte, J.C. and Rosenfeld, M.G. (1999) Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and tooth morphogenesis. Nature, 401, 279–282.

66 Lu, M.F., Pressman, C., Dyer, R., Johnson, R.L. and Martin, J.F. (1999) Function of Rieger syndrome gene in left-right asymmetry and craniofacial development. Nature, 401, 276–278.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
V. Coulon, A. L'Honore, J.-F. Ouimette, E. Dumontier, P. van den Munckhof, and J. Drouin
A Muscle-specific Promoter Directs Pitx3 Gene Expression in Skeletal Muscle Cells
J. Biol. Chem., November 9, 2007; 282(45): 33192 - 33200.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
F. M. J. Jacobs, S. M. Smits, C. W. Noorlander, L. von Oerthel, A. J. A. van der Linden, J. P. H. Burbach, and M. P. Smidt
Retinoic acid counteracts developmental defects in the substantia nigra caused by Pitx3 deficiency
Development, July 15, 2007; 134(14): 2673 - 2684.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
R. Perveen, J. Favor, R.V. Jamieson, D.W. Ray, and G.C.M. Black
A heterozygous c-Maf transactivation domain mutation causes congenital cataract and enhances target gene activation
Hum. Mol. Genet., May 1, 2007; 16(9): 1030 - 1038.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
M. de Rover, J. C. Lodder, M. P. Smidt, and A. B. Brussaard
Pitx3 Deficiency in Mice Affects Cholinergic Modulation of GABAergic Synapses in the Nucleus Accumbens
J Neurophysiol, October 1, 2006; 96(4): 2034 - 2041.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
C. Bidinost, M. Matsumoto, D. Chung, N. Salem, K. Zhang, D. W. Stockton, A. Khoury, A. Megarbane, B. A. Bejjani, and E. I. Traboulsi
Heterozygous and Homozygous Mutations in PITX3 in a Large Lebanese Family with Posterior Polar Cataracts and Neurodevelopmental Abnormalities.
Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1274 - 1280.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. Dutta, J.-E. Dietrich, G. Aspock, R. D. Burdine, A. Schier, M. Westerfield, and Z. M. Varga
pitx3 defines an equivalence domain for lens and anterior pituitary placode
Development, April 1, 2005; 132(7): 1579 - 1590.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
V Berry, Z Yang, P K F Addison, P J Francis, A Ionides, G Karan, L Jiang, W Lin, J Hu, R Yang, et al.
Recurrent 17 bp duplication in PITX3 is primarily associated with posterior polar cataract (CPP4)
J. Med. Genet., August 1, 2004; 41(8): e109 - e109.
[Full Text] [PDF]


Home page
DevelopmentHome page
L. Alberi, P. Sgado, and H. H. Simon
Engrailed genes are cell-autonomously required to prevent apoptosis in mesencephalic dopaminergic neurons
Development, July 1, 2004; 131(13): 3229 - 3236.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. P. Smidt, S. M. Smits, H. Bouwmeester, F. P. T. Hamers, A. J. A. van der Linden, A. J. C. G. M. Hellemons, J. Graw, and J. P. H. Burbach
Early developmental failure of substantia nigra dopamine neurons in mice lacking the homeodomain gene Pitx3
Development, March 1, 2004; 131(5): 1145 - 1155.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
P. van den Munckhof, K. C. Luk, L. Ste-Marie, J. Montgomery, P. J. Blanchet, A. F. Sadikot, and J. Drouin
Pitx3 is required for motor activity and for survival of a subset of midbrain dopaminergic neurons
Development, June 1, 2003; 130(11): 2535 - 2542.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
R. Yamada, Y. Mizutani-Koseki, T. Hasegawa, N. Osumi, H. Koseki, and N. Takahashi
Cell-autonomous involvement of Mab21l1 is essential for lens placode development
Development, May 1, 2003; 130(9): 1759 - 1770.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Nunes, L. T. Tovmasian, R. M. Silva, R. E. Burke, and S. P. Goff
Pitx3 is required for development of substantia nigra dopaminergic neurons
PNAS, April 1, 2003; 100(7): 4245 - 4250.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Suh, P. J. Gage, J. Drouin, and S. A. Camper
Pitx2 is required at multiple stages of pituitary organogenesis: pituitary primordium formation and cell specification
Development, March 3, 2003; 129(2): 329 - 337.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. A. Lines, K. Kozlowski, and M. A. Walter
Molecular genetics of Axenfeld-Rieger malformations
Hum. Mol. Genet., May 15, 2002; 11(10): 1177 - 1187.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
D. B. Gould and S. W. M. John
Anterior segment dysgenesis and the developmental glaucomas are complex traits
Hum. Mol. Genet., May 15, 2002; 11(10): 1185 - 1193.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
R. V. Jamieson, R. Perveen, B. Kerr, M. Carette, J. Yardley, E. Heon, M. G. Wirth, V. van Heyningen, D. Donnai, F. Munier, et al.
Domain disruption and mutation of the bZIP transcription factor, MAF,associated with cataract, ocular anterior segment dysgenesis and coloboma
Hum. Mol. Genet., January 1, 2002; 11(1): 33 - 42.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. V. Semina, I. Brownell, H. A. Mintz-Hittner, J. C. Murray, and M. Jamrich
Mutations in the human forkhead transcription factor FOXE3 associated with anterior segment ocular dysgenesis and cataracts
Hum. Mol. Genet., February 1, 2001; 10(3): 231 - 236.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (84)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Semina, E. V.
Right arrow Articles by Graw, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Semina, E. V.
Right arrow Articles by Graw, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?