Human Molecular Genetics, 2000, Vol. 9, No. 11 1641-1649
© 2000 Oxford University Press
Strong homophilic interactions of the Ig-like domains of polycystin-1, the protein product of an autosomal dominant polycystic kidney disease gene, PKD1
Genzyme Corporation, 1 Mountain Road, Framingham, MA 01701-9322, USA
Received 10 March 2000; Revised and Accepted 5 May 2000.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The 14 kb mRNA of the polycystic kidney disease gene PKD1 encodes a novel large (~460 kDa) protein, polycystin-1, of unknown function that is responsible for autosomal dominant polycystic kidney disease (ADPKD). The unique organization of multiple adhesive domains of polycystin-1, including 16 Ig-like domains (or PKD domains) suggests that it may play an important role in cell–cell/cell–matrix interactions. Here we demonstrate the localization of polycystin-1 to epithelial cell–cell contacts in culture. These results along with structural predictions prompted us to propose that polycystin-1 is involved in cell–cell adhesion through its cluster of Ig-like repeats. We show that Ig-like domains II–XVI are involved in strong calcium-independent homophilic interactions in vitro. Domains XI–XVI form interactions with high affinity (Kd = 60 nM) and domains II–V exhibit the lowest binding affinity (Kd = 730 nM) in these studies. Most importantly, we show that antibodies raised against Ig-like domains of polycystin-1 disrupt cell–cell interactions in MDCK cell monolayers, thus indicating that polycystin-1 is directly involved in the cell–cell adhesion process. Collectively, these data suggest that interactions of the Ig-like repeats of polycystin-1 play an important role in mediating intercellular adhesion. We suggest that the loss of these interactions due to mutations in polycystin-1 may be an important step in cystogenesis.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common genetic disorders, with an estimated incidence of 1/1000, accounting for 8–10% of all cases of end-stage renal disease (1–3). The disease is characterized by progressive development and enlargement of cysts in the kidney and other organs such as liver, pancreas and spleen (4,5). ADPKD is phenotypically and genetically heterogeneous with 85% of the cases caused by mutations in the polycystic kidney disease gene PKD1 (6–9). Most of the remaining ADPKD cases can be attributed to PKD2 mutations (10,11) with <1% of cases due to mutations in a third unmapped locus. In addition to the genes responsible for ADPKD, recent data indicate the existence of a family of polycystin-like proteins, whose role in renal disease is presently unknown (12–14).
The 14 kb PKD1 cDNA encodes a novel large (~460 kDa) protein, polycystin-1, of unknown function. The predicted extracellular N-terminus consists of two leucine-rich repeats (LRR), a C-type lectin domain, an LDL-A domain, multiple Ig-like domains (or PKD domains) and an REJ domain followed by multiple transmembrane domains and a cytoplasmic C-terminus (9,15,16). The 16 Ig-like domains are linearly segmented within the sequence such that the first Ig-like domain is localized between the LRRs and the C-type lectin domain while the remaining 15 Ig-like domains are tandemly clustered in the middle part of the molecule. Originally thought to be true members of the Ig superfamily, recent work suggests that while the PKD domains contain an Ig-like fold, they represent a novel family (17). Based on this unique arrangement of known structural motifs a predicted function of polycystin-1 is to mediate cell–cell/cell–matrix interactions. Recently, it has been shown that small peptides from the Ig-like repeats of polycystin-1 can interfere with branching morphogenesis of the ureteric bud (18). However, the precise function(s) of polycystin-1 in the normal state as well as how the mutated protein gives rise to the cystic phenotype of ADPKD remain unknown. Mutation analysis of the PKD1 gene has been complicated due to the presence of highly conserved homologous genes. No clear genotype–phenotype correlation can be seen with the reported mutations to date. The majority of mutations are inactivating, and they are scattered throughout the gene, with no obvious hot spots (reviewed in ref. 19). To begin to understand the cellular function of polycystin-1 and its role in pathogenesis, we have experimentally addressed one of the predicted roles of this protein: that of cell–cell adhesion.
The formation of intercellular contacts is a complex event mediated by several types of interaction. It has been shown that the Ig-like domains of the true members of the Ig superfamily (as well as Ig-like domains of numerous other proteins including cell surface receptors, matrix proteins and enzymes) are involved in binding functions with a number of different ligands and play a role in cell–cell interactions (17,20). Furthermore, homophilic interactions of Ig-like domains have been shown to contribute to cell–cell contact formation (21–24). These functional predictions of proteins with Ig-domains, in particular as they relate to cell–cell interactions, are consistent with the observed membrane accentuation of immunolocalized polycystin-1 to renal tubular epithelium, liver and pancreatic ductal epithelium (25–28).
Here we present data showing membrane localization of polycystin-1 to sites of cell–cell contacts of epithelial MDCK cells using antibodies against four distant regions. This suggests that polycystin-1 may contribute to cell–cell adhesion, possibly through homophilic interactions of its Ig-like domains. To test this hypothesis, we have chosen an in vitro binding assay for its ability to quantify and thus discriminate between meaningful and marginal interactions. The cluster of 15 Ig-like repeats was subdivided into three contiguous groups of four (IgII–V), five (IgVI–X) and six domains (IgXI–XVI). Domains XI–XVI demonstrated specific, saturable and high affinity interactions (Kd = 60 nM) while domains II–V demonstrated lower binding affinity. We suggest that cis interactions between polycystin-1 molecules on the same membrane might co-exist with trans interactions between opposing molecules at the site of cell–cell contact. Most importantly, we present the first evidence for direct involvement of polycystin-1 in cell–cell adhesion by demonstrating disruption of intercellular contacts in MDCK cell monolayers with antibody against the Ig-like cluster.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Anti-polycystin-1 antibodies specifically recognize transfected polycystin-1 constructs
The generation and rigorous characterization of specific antibodies against the potentially multifunctional protein polycystin-1 is a crucial prerequisite for addressing its role. For subcellular localization and structure–function analysis of endogenous polycystin-1 in epithelial cells, we raised antibodies against the following regions along the molecule: the N-terminal region (anti-LRR), C-terminal region (anti-BD3), the REJ domain (anti-L2) and the cluster of Ig-like domains (II–XVI) of polycystin-1. We have characterized the specificity of these antibodies utilizing recombinant polycystin-1. Three constructs (Fig. 1A), including full-length (PKD1-FL) and truncations (HTM3 and Nhe delta), were used for transient expression in cos1 cells (data not shown) and in the baculovirus/insect cell system. The two truncated polycystin-1 clones, HTM3 (~130 kDa) and Nhe delta (~170 kDa), were expressed at a high level in both systems as revealed by western analysis and immunofluorescence using anti-BD3 (Fig. 1B and C). Because expression of the full-length PKD1 construct was not successful in either eukaryotic expression system, we demonstrated anti-L2 and anti-IgPKD antibody specificity against corresponding fusion proteins expressed in bacterial cells (data not shown). In addition, all of these antibodies were able to precipitate in vitro translated polycystin-1 specifically (data not shown). Thus, the antibodies used in this study were rigorously characterized for their ability to immunoprecipitate in vitro translated polycystin-1 as well as by western and immunofluorescence analysis of recombinant polycystin-1.
|
Polycystin-1 localizes to cell–cell contacts
Several anti-polycystin-1 antibodies have been described by different groups; however, there is little consensus on the subcellular localization (19). Because some of the reported antibodies were raised against rather short synthetic peptides derived from human sequences, it is possible that they might not crossreact with different cell types and/or between species. Therefore, we have chosen to use several anti-fusion protein antibodies to avoid this problem. To address the subcellular localization of endogenous polycystin-1 in MDCK epithelial cells, we performed immunostaining of polycystin-1 with antibodies to the N-terminal region (anti-LRR), C-terminal region (anti-BD3) as well as to the REJ domain and Ig-like cluster of the protein (anti-L2 and anti-IgPKD, respectively). All antibodies showed clearly recognizable membrane staining at sites of cell–cell contact (Fig. 2A). No staining was observed with the secondary antibody alone or in the presence of the immunizing polypeptide (data not shown). It is important to note that isolated cells and free cell borders of contacting cells did not localize polycystin-1 at the membrane, although some intracellular staining can be seen (Fig. 2A). This cytoplasmic staining is specific, because it is eliminated by preincubating the antibody with the appropriate fusion protein (data not shown). These data are in agreement with the recent report by Peters et al. regarding polycystin-1 expression at sites of interaction between adjacent MDCK cells (29).
|
We have also examined polycystin-1 expression in membrane-enriched fractions of MDCK cells utilizing the N- and C-terminal antibodies (anti-LRR and anti-BD3, respectively; Fig. 2B). Both antibodies specifically recognized an ~400 kDa band predominantly in membrane fractions as well as some smaller proteins which might be the products of degradation (Fig. 2B). Similar size polycystin-1 protein (~400 kDa) was detected previously in the kidney by other groups (18,25,30). We have also observed the presence of anti-BD3 immunoreactive bands in the cytoplasmic fraction of MDCK cells (Fig. 2B). It remains to be determined whether anti-BD3 immunoreactive bands of similar size (~400 kDa) found in membrane and cytoplasmic fractions (Fig. 2B) are identical or might represent alternatively spliced isoforms of polycystin-1. Our observations suggest that the compartmentalization of polycystin-1 is dynamic and that trafficking of polycystin-1 between the cytoplasm and plasma membrane compartments is a function of cell contact.
Strong homophilic binding of Ig-like clusters of polycystin-1
The 15 Ig-like domains of polycystin-1 (II–XVI) are organized as a tandem array spanning exons 11–15, while the IgI domain, encoded by exon 5, is located separately. As shown above, polycystin-1 is localized to the lateral membranes of contacting MDCK cells (Fig. 2). These data suggest that polycystin-1 participates in cell–cell contacts and when considered along with the structural predictions it is reasonable to propose that this function of polycystin-1 is most likely mediated by homophilic interaction of its Ig-like-domains. To test this hypothesis, we used an in vitro binding assay that has been used by others to detect high affinity interactions such as the one between Ras and Raf-1 proteins (Kd = 50 nM) (31).
We cloned and expressed the Ig-like cluster as three non-overlapping regions, GST–Iga (II–V), GST–Igb (VI–X) and GST–Igc (XI–XVI) as shown in Figure 3A. The same regions were also in vitro translated as [35S]Iga, [35S]Igb and [35S]Igc polypeptides and incubated with each immobilized GST fusion protein (Fig. 3A). Beads were washed to remove unbound material, loaded on the gel along with starting (input) in vitro translated material, resolved electrophoretically and then exposed to X-ray film as shown in Figure 3B. All three regions of polycystin-1 appeared to interact with each other with the Igc region being the strongest ligand for Iga, Igb and especially itself. No binding of labeled Ig polypeptides was observed to the GST carrier (Fig. 3B). Similarly, a labeled irrelevant protein, luciferase, showed no binding with any of the Ig fusion proteins (data not shown). Moreover, the full-length polycystin-1 ([35S]PKD1-FL), which contains the complete contiguous Ig cluster, also specifically binds to all fusion proteins (Fig. 3B). These interactions are independent of calcium, since they were not inhibited by the presence of 10 mM EDTA (data not shown). To assess adequately the significance of Ig-like domain homophilic interactions under consideration, we compared them side-by-side with the functionally significant interaction between p53 and SV40 large T-antigen (32–34). As shown in Figure 3C, T-antigen is strongly and specifically bound to p53 beads in our assay.
|
Dissociation constants for Ig-like homophilic interactions
The binding properties of Iga, Igb and Igc regions were quantitatively characterized by measuring the affinity for each interaction (Table 1). Figure 4 illustrates the Kd measurements for the interaction of translated [35S]IgC with GST–Iga, GST–Igb and GST–Igc. The translated Igc region shows specific binding to increasing concentrations of each immobilized fusion protein in a saturable manner. The interaction Igc–Igc and Igb–Igc occurs with high affinity (60 and 80 nM, respectively), while the Iga–Iga interaction is of lower affinity (730 nM) as shown in Table 1. In comparison, the estimated Kd of rat NCAM Ig-domains homophilic binding is 69 nM (35). Iga–Igb and Igb–Igb combinations of polycystin-1 demonstrated intermediate affinity of 420 and 450 nM, respectively. Thus, Ig-like domains of polycystin-1 form specific, saturable interactions of high affinity.
|
|
Antibody to Ig-like domains perturb cell–cell adhesion
As a first step towards addressing the specific role of Ig-like domains of polycystin-1 in the cellular adhesion process in vivo, we have examined the direct effect of antibody against the Ig-like cluster (anti-IgPKD) on intact MDCK cell monolayers. If indeed Ig-like domains are mediating cell–cell adhesion through homophilic interactions and/or through heterophilic interaction with another yet unidentified cell surface molecule, anti-IgPKD antibody should perturb cell–cell interactions. A similar technique was employed to probe E-cadherin mediated cell–cell adhesion by Wheelock et al. (36). Figure 5A shows the normal appearance of MDCK monolayer islands with cells tightly attached to each other. The same typical epithelial morphology is displayed in the presence of preimmune serum (Fig. 5B). Moreover, no difference was seen in the presence of anti-LRR antiserum, which is specific to LRR, another potential adhesive domain of polycystin-1 (Fig. 5C). In contrast, cells grown in the presence of anti-IgPKD antiserum dissociated from each other as shown in Figure 5D. Three representative fields in Figure 5D demonstrate the dynamic process of loss of intercellular contacts, where some cell clusters are still intact at the time of analysis. This effect was dose-dependent with a 1:30 dilution being the minimal effective dose. Similar disruption of cell–cell contacts was also caused by the presence of 1 nM of GST–Iga, GST–Igb and GST–Igc soluble fusion proteins (data not shown). Importantly, to eliminate the possibility that the disruptive effect of the anti-Ig PKD antiserum may be a result of the presence of other antibodies in the preparation, we have tested the preimmune serum (Fig. 5B) of the same rabbit in this assay. The cell–cell disruption effect is reversible upon removal of anti-IgPKD antibody. In addition, we have demonstrated the specificity of the effect by preincubating anti-IgPKD antiserum with GST–Igabc fusion proteins. As shown in Figure 5E the disruptive effect of the anti-IgPKD antiserum (1:30) can be neutralized in the presence of GST–Iga, GST–Igb and GST–Igc fusion proteins (10 µg/ml each). The effect was dose-dependent with lower concentrations of fusion proteins causing partial neutralization of the anti-IgPKD effect on cell–cell dissociation (data not shown).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The Ig-like domain region of polycystin-1, also known as the PKD-domain region, consists of 16 copies of an ~80 amino acid repeat (9). The analysis of the three-dimensional structure of a single repeat showed that it is not a true member of the Ig superfamily, although it has a characteristic ß-sandwich topology (17). Domains with this Ig-like fold are present in proteins as diverse as matrix proteins, receptors and enzymes, and in each case they have been shown to interact with extremely different ligands varying from small peptides (e.g. HLA) to giant proteins (e.g. titin oligomer) (20). Moreover, each part of the surface of the domain can be used for interaction with a ligand. One known function of the Ig-like domain is the homophilic interaction with other Ig-like domains via their ß-sheets (21,22,37). These interactions were found to be important for cell–cell contacts or homodimerization. It has been shown that NCAM redistributes to intercellular contacts by homophilic interactions of the Ig-domains (21).
The primary structure of polycystin-1 suggested its likely role in cell–cell/cell–matrix interactions; however, this has not been demonstrated experimentally. Thus, we set out to examine the role of polycystin-1 in mediating cell–cell contacts. We examined the localization of polycystin-1 in MDCK cells, a canine kidney epithelial cell line, using antibodies against four different regions of polycystin-1: N-terminal (LRR), C-terminal and the middle region (REJ and Ig-like cluster). Using well-characterized antibodies, we clearly showed that polycystin-1 was predominantly expressed at sites of cell–cell contact. Similar findings with a different set of antibodies were recently reported by Peters et al. (29). Combining these data along with the predicted functional capability of Ig-like domains to be involved in cell–cell/cell–matrix interactions (reviewed in ref. 20), we hypothesized that homophilic interactions of Ig-like domains of polycystin-1 may play a role mediating intercellular adhesion.
To test this hypothesis, we analyzed the homophilic binding potential of several Ig-like domains as clusters. We engineered regions Iga, Igb and Igc, containing 4, 5 and 6 domains, respectively, for expression as fusion proteins in our binding assay. Each region was translated in vitro and tested for the ability to bind to each region including itself in the form of immobilized fusion protein. We showed that Ig-like domains form high affinity calcium-independent homophilic interactions with a Kd of 60 nM for domains XI–XVI and lower binding affinity for domains II–V (730 nM).
The observed difference in binding capacities could be partially explained by the different number of Ig-domains in each construct, so that the higher number of repeats results in stronger binding because of higher avidity. A pivotal role of a particular single repeat in binding cannot be excluded, but we feel that our approach of analyzing large blocks of Ig-repeats in vitro is the most adequate because of the potential cooperative nature of this interaction. Interestingly, the homophilic binding of polycystin-1 resembles that of chick NCAM where all of the five Ig-like domains are involved in homophilic interactions (38). Kiselyov et al. (24) demonstrated that there might be more than one mechanism of NCAM homophilic binding by showing double-reciprocal binding of IgI–IgII domains. It is possible that the homophilic interactions described in this study might mediate homodimerization in addition to homophilic adhesion at intercellular contacts. A similar mechanism was shown to be important in the functioning of the PECAM-1 protein (37). In addition, homotypic binding between the extracellular domains of cadherins mediates the formation of complexes between parallel-oriented molecules on single cells and between cells, which is thought to cooperatively enhance adhesion (39). Similarly, we suggest that cis interactions between polycystin-1 molecules, mediating homodimerization on the same membrane might coexist with trans interactions between opposing molecules at the site of cell–cell contact. The Ig-like regions used in this in vitro binding assay were produced in Escherichia coli and therefore are not glycosylated. As this part of the molecule contains several potential N-glycosylation sites, it is tempting to speculate that differential glycosylation of the Ig-like cluster in vivo might block some of the interaction sites and thus regulate the extent of homophilic interaction.
The importance of our biochemical binding assay results was tested in vivo by assessing the effect of anti-IgPKD antibody on MDCK cell monolayers using a well-established technique (36). We have shown that our anti-IgPKD antibody perturbs cell–cell interactions in MDCK monolayers, suggesting that the Ig-like cluster is directly involved in intercellular adhesion. It remains to be shown, however, whether the anti-IgPKD antibody interferes with the homophilic interaction of the Ig-like cluster itself and/or blocks the heterophilic interaction of the Ig-like cluster with another cell surface molecule.
In summary, we have identified and characterized high affinity specific homophilic interactions involving the Ig-like domains of polycystin-1 in vitro and showed that these domains are involved directly in the cellular adhesive process in culture. Indeed, the dramatic alterations in the epithelial architecture of the tubular/ductal structures of affected organs that accompany cystogenesis in ADPKD indicate that polycystin-1 has an important role in maintaining normal epithelial organization (reviewed in refs 40–42). The formation and progression of ADPKD cysts is characterized by increased cell proliferation, resulting in expansion of the epithelium, which displays a relatively undifferentiated appearance (42,43). The role of polycystin-1 in mediating cell–cell interactions, where such interactions are fundamental for cellular functions of proliferation, differentiation and maturation, is supported by a recent study of a targeted Pkd1 mutation in mice (44). This study demonstrates that polycystin-1 is critical in the establishment and maturation of normal tubular architecture (44). We and others have shown that the expression of polycystin-1 is continued into adult life at a lower level, where its functional activity might be required for cells to remain tightly associated in the epithelium (27,28,45,46). In addition, it is known that cell adhesion proteins play an important role in intercellular signaling (47). Interestingly, it has been shown that the C-terminal domain of polycystin-1 has the capacity to modulate Wnt signaling during renal development (48). We suggest that the loss of intercellular interactions due to a mutated polycystin-1 can be an important step in molecular cystogenesis.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Anti-polycystin-1 antibodies, cell fractionation and immunoblotting
All antibodies were raised in rabbits against fusion proteins representing different domains of polycystin-1. Anti-LRR (residues 27–360) and anti-BD3 (residues 4097–4302) were produced and described previously (28). Anti-L2 (residues 2714–3074) and anti-IgPKD (residues 843–2145) antibodies were produced against GST fusion proteins containing part of the REJ domain and Ig-like domains of polycystin-1, respectively. Crude membrane fractions from MDCK cells were prepared as described (49,50). Briefly, MDCK cell monolayers were harvested using cell scrapers and homogenized in 7 vol of homogenization buffer (10 mM HEPES, pH 7.4, 0.3 M sucrose, 0.5 mM EDTA) in the presence of a protease inhibitor cocktail (Boehringer Mannheim, Indianapolis, IN). Homogenate was centrifuged for 15 min at 1000 g and the supernatant centrifuged for 40 min at 150 000 g. The final membrane pellet and supernatant (cytosol) fractions were analyzed by immunoblotting. SDS–PAGE was carried out on 3–12 or 5–15% gradient gels in the presence of 1% 2-mercaptoethanol and transferred to nitrocellulose for immunoblot analysis. Primary affinity purified anti-polycystin-1 antibodies were used at a dilution of 1:100 and secondary goat anti-rabbit HRP antibodies (Boehringer Mannheim) were used at a dilution of 1:1000.
Expression of recombinant polycystin-1 in baculovirus/insect cell system
Truncated polycystin-1 was expressed by using BacPAK TM Baculovirus Expression System (Clontech, Palo Alto, CA) according to the manufacturer’s instructions. Briefly, PKD1 cDNA inserts HTM3 and Nhe delta were subcloned into pBacPAK9 transfer vector and co-transfected with BacPAK6 viral DNA into Sf21 insect cells. Individual plaques from the supernatant co-transfection medium were analyzed and selected for the high level of polycystin-1 protein production as assayed by western blotting.
Immunofluorescence
MDCK cells or baculovirus infected Sf21 cells were grown on glass coverslips and immunostained as described previously (28). The primary antibodies were used at a dilution of 1:100 followed by incubation with FITC-labeled goat anti-rabbit secondary antibody at a dilution of 1:200. Cells were examined using a Zeiss Axioplan microscope.
Production of fusion proteins for in vitro binding assay
The cluster of Ig-like domains of polycystin-1 was subdivided into three constructs: Iga (domains II–V), Igb (domains VI–X) and Igc (domains XI–XVI) and subcloned into pGEX-1 vector (Pharmacia, Piscataway, NJ) for production of GST fusion proteins designated GST–Iga, GST–Igb and GST–Igc, respectively. The cDNA fragments for each construct were synthesized by PCR using as template the full-length human PKD1 cDNA described previously (28). The GST–p53 construct (residues 73–390) was produced as GST fusion protein. The GST fusion proteins were purified only from soluble fractions of cellular extracts and not from inclusion bodies to ensure proper protein folding. Purification was performed by affinity chromatography on glutathione–Sepharose (Pharmacia) as recommended by the manufacturer.
In vitro translation probes
Translation of the PKD1 constructs in vitro was performed using the TNT Coupled Reticulocyte Lysate System (Promega, Madison, WI) as recommended by the manufacturer. The Ig-like domains of polycystin-1: Iga (domains II–V), Igb (domains VI–X) and Igc (domains XI–XVI) were subcloned downstream of the oligo GTAATACGACTCACTATAGGGCGAGCCACCATGG, containing the T7 RNA polymerase promoter (bold) followed by an AUG initiation codon in a Kozak consensus context (underlined). This oligo was inserted between the BamHI and EcoRI sites of the pGEX-4T-1 vector (Pharmacia) downstream of the GST coding region, such that the same construct could be used either for GST fusion protein production or for the in vitro translation of the insert without the GST portion.
In vitro binding assay and determining the affinity of the interaction
GST fusion proteins or GST alone were immobilized individually onto glutathione–Sepharose (Pharmacia). Twenty microliters of beads with ~10 µg of immobilized fusion proteins were used for each binding reaction. Approximately 10 µl of in vitro translated 35S-labeled protein was incubated for 3 h at room temperature with immobilized fusion proteins in 0.1 ml of binding buffer (10 mM HEPES, pH 7.4, 100 mM NaCl, 0.75 mM benzamidine, 0.1 mM PMSF) and washed with 20 column volumes of the same buffer. The [35S]translated material bound to the beads was resolved by SDS–PAGE with the input [35S]protein run in parallel. The gels were exposed to X-ray film (X-Omat AR; Kodak, Rochester, NY).
The affinity of interactions was determined as described (31,51). Briefly, the 10 µl of [35S]translated protein were incubated with six different concentrations (from 0 to 2000 nM) of immobilized GST fusion protein at room temperature for 3 h in 0.1 ml of binding buffer. After washing the beads from unbound material, the bound 35S-labeled fraction was resolved electrophoretically and then quantified relative to the input [35S]translated probe using a PhosphorImager with ImageQuant (v. 3.2) software (Molecular Dynamics, Sunnyvale, CA). The affinity of the interaction was calculated according to the equation Kd = [Pf][Lf]/[PL], where in our case, [Pf] and [Lf] refer to unbound (free) concentrations of GST fusion protein and 35S-labeled protein. As reviewed by Phizicky and Fields (51), when immobilized protein [Pt], total GST fusion protein, is in great excess of [L], then [Pt] 
[Pf] and accordingly the bound fraction of L equals [Pt]/(Kd + [Pt]). We presented the bound fraction of L as a ratio between the amount of L bound in a certain sample and the amount of L at saturation level. The bound fraction of L was plotted against different concentrations of GST fusion protein [Pt] as shown in Figure 4.
Disruption of cell–cell adhesion in cell monolayers
The disruption of intercellular adhesion was performed as described previously (36). MDCK cells were grown for 24 h to 70% confluency in media with 10% fetal bovine serum. The media were replaced with media containing either anti-IgPKD immune serum at dilutions ranging from 1:10 to 1:100 or with control media containing preimmune serum and anti-LRR serum with the same dilutions. Cells were incubated for 2 h and live cell images were collected using a Nikon Eclipse 200 microscope equipped with a Sony CCD/RGB camera DXC-151 and ScionImage 1.62 a software (Scion Corporation, Frederick, MD).
|
ACKNOWLEDGEMENTS |
|---|
We thank Drs M. Pragnell and P. Manavalan for helpful discussions.
|
FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +1 508 270 2134; Fax: +1 508 620 1203; Email: oxana.ibraghimov@genzyme.com
§ Deceased August 1999. This article is respectfully dedicated to his memory in recognition of his significant contribution to this study.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Friedman, J. (1983) Cystic diseases of the kidney. In Emery, A. and Rimoin, D. (eds), Principles and Practice of Medical Genetics. Churchill Livingstone, Edinburgh, pp. 1002–1010.
2 Striker, G.E. and Striker, L.J. (1986) Renal cysts in polycystic kidney disease. Am. J. Nephrol., 6, 161–164.[ISI][Medline]
3 Robinson, B.H.B. and Hawkins, J.B. (1981) Proc. Eur. Dial. Transplant. Assoc., 17, 20.
4 Franz, K.A. and Reubi, F.C. (1983) Rate of functional deterioration in polycystic kidney disease. Kidney Int., 23, 526–529.[ISI][Medline]
5 Grantham, J.J. (1983) Polycystic kidney disease: a predominance of giant nephrons. Am. J. Physiol., 244, F3–F10.
6 European Polycystic Kidney Disease Consortium (1994) The polycystic kidney disease 1 gene encodes a 14 kb transcript and lies within a duplicated region on chromosome 16. Cell, 77, 881–894.[ISI][Medline]
7 American PKD1 Consortium (1995) Analysis of the genomic sequence for the autosomal dominant polycystic kidney disease (PKD1) gene predicts the presence of a leucine-rich repeat. Hum. Mol. Genet., 4, 575–582.
8 International Polycystic Kidney Disease Consortium (1995) Polycystic Kidney Disease: the complete structure of the PKD1 gene and its protein. Cell, 81, 289–298.[ISI][Medline]
9 Hughes, J., Ward, C., Peral, B., Aspinwall, R., Clark, K., San Millan, J.L., Gamble, V. and Harris, P.C. (1995) The polycystic kidney disease 1 (PKD1) gene encodes a novel protein with multiple cell recognition domains. Nature Genet., 10, 151–160.[ISI][Medline]
10 Kimberling, W.J., Kumar, S., Gabow, P.A., Kenyon, J.B., Connolly, C.J. and Somlo, S. (1993) Autosomal dominant polycystic kidney disease: localization of the second gene to chromosome 4q13-q23. Genomics, 18, 467–472.[ISI][Medline]
11 Mochizuki, T., Wu, G., Hayashi, T., Xenophontos, S.L., Veldhuisen, B., Saris, J.J., Reynolds, D.M., Cai, Y., Gabow, P.A., Pierides, A. et al. (1996) PKD2, a gene for polycystic kidney disease that encodes an integral membrane protein. Science, 272, 1339–1342.[Abstract]
12 Veldhuisen, B., Spruit, L., Dauwerse, H.G., Breuning, M.G. and Peters, D.J.M. (1999) Genes homologous to the autosomal dominant polycystic kidney disease genes (PKD1 and PKD2). Eur. J. Hum. Genet., 7, 860–872.[ISI][Medline]
13 Nomura, H., Turco, A.E., Pei, Y., Kalaydjieva, L., Schiavello, T., Weremowicz, S., Ji, W., Morton, C.C., Meisler, M., Reeders, S.T. et al. (1998) Identification of PKDL, a novel polycystic kidney disease 2-like gene whose murine homologue is deleted in mice with kidney and retinal defects. J. Biol. Chem., 273, 25967–25973.
14 Wu, G., Hayashi, T., Park, J.H., Dixit, M., Reynolds, D.M., Li, L., Maeda, Y., Cai, Y., Coca-Prados, M. and Somlo, S. (1998) Identification of PKD2L, a human PKD2-related gene: tissue-specific expression and mapping to chromosome 10q25. Genomics, 54, 564–568.[ISI][Medline]
15 Moy, G.W., Mendoza, L.M., Schulz, J.R., Swanson, W.J., Glabe, C.G. and Vacquier, V.D. (1996) The sea urchin sperm receptor for egg jelly is a modular protein with extensive homology to the human polycystic kidney disease protein, PKD1. J. Cell Biol., 133, 809–817.
16 Sandford, R., Sgotto, B., Aparicio, S., Brenner, S., Vaudin, M., Wilson, R.K., Chissoe, S., Pepin, K., Bateman, A., Chothia, C. et al. (1997) Comparative analysis of the polycystic kidney disease 1 (PKD1) gene reveals an integral membrane glycoprotein with multiple evolutionary conserved domains. Hum. Mol. Genet., 9, 1483–1489.
17 Bycroft, M., Bateman, A., Clarke, J., Hamill, S.J., Sandford, R., Thomas, R.L. and Chothia, C. (1999) The structure of a PKD domain from polycystin-1: implications for polycystic kidney disease. EMBO J., 18, 297–305.[ISI][Medline]
18 Van Adelsberg, J. (1999) Peptides from the PKD repeats of polycystin, the PKD1 gene product, modulate pattern formation in the developing kidney. Dev. Genet., 24, 299–308.[ISI][Medline]
19 Harris, P.C. (1999) Autosomal dominant polycystic kidney disease: clues to pathogenesis. Hum. Mol. Genet., 8, 1861–1866.
20 Bork, A., Holm, L. and Sander, C. (1994) The immunoglobulin fold—structural classification, sequence patterns and common core. J. Mol. Biol., 242, 309–320.[ISI][Medline]
21 Sandig, M., Rao, Y., Kalnins, V.I. and Siu, C. (1996) Integrity of the homophilic binding site is required for the preferential localization of NCAM in intercellular contacts. Biochem. Cell Biol., 74, 373–381.[ISI][Medline]
22 Rao, Y., Wu, X.-F., Yip, P., Gariepy, J. and Siu, C.-H. (1993) Structural Characterization of a homophilic binding site in the neural cell adhesion molecule. J. Biol. Chem., 268, 20630–20638.
23 Sun, J., Williams, J., Yan, H.C., Amin, K.M., Albelda, S.M. and DeLisser, H.M. (1996) Platelet endothelial cell adhesion molecule-1 (PECAM-1) homophilic adhesion is mediated by immunoglobulin-like domains 1 and 2 and depends on the cytoplasmic domain and the level of surface expression. J. Biol. Chem., 271, 18561–18570.
24 Kiselyov, V.V., Berezin, V., Maar, T.E., Soroka, V., Edvardsen, K., Schousboe, A. and Bock, E. (1997) The first immunoglobulin-like neural cell adhesion molecule (NCAM) domain is involved in double-reciprocal interaction with the second immunoglobulin-like NCAM domain and in heparin binding. J. Biol. Chem., 272, 10125–10134.
25 Geng, L., Segal, Y., Peissel, B., Deng, N., Pei, Y., Carone, F., Rennke, H.G., Glucksmann-Kuis, A.M., Schneider, M.C., Ericsson, M. et al. (1996) Identification and localization of polycystin, the PKD1 gene product. J. Clin. Invest., 98, 2674–2682.[ISI][Medline]
26 Griffin, M.D., Torres, V.E., Grande, J.P. and Kumar, R. (1996) Immunolocolization of polycystin in human tissues and cultured cells. Proc. Assoc. Am. Phys., 108, 184–197.
27 Peters, D.J.M., Spruit, L., Klingel, R., Prins, F., Baelde, H.J., Giordano, P.C., Bernini, L.F., de Heer, E., Breuning, M.H. and Bruijn, J.A. (1996) Adult, fetal, and polycystic kidney expression of polycystin, the polycystic kidney disease-1 gene product. Lab. Invest., 75, 221–230.[ISI][Medline]
28 Ibraghimov-Beskrovnaya, O., Dackowski, W., Foggensteiner, L., Coleman, N., Thiru, S., Petry, L.R., Burn, T.C., Connors, T.D., Van Raay, T., Bradley, J. et al. (1997) Polycystin: in vitro synthesis, in vivo tissue expression, and subcellular localization identifies a large membrane-associated protein. Proc. Natl Acad. Sci. USA, 94, 6397–6402.
29 Peters, D.J.M., van de Wal, A., Spruit, L., Saris, J.J., Breuning, M.H., Bruijn, J.A. and de Heer, E. (1999) Cellular localization and tissue distribution of polycystin-1. J. Pathol., 188, 439–446.[ISI][Medline]
30 Griffin, M.D., O’Sullivan, D.A., Torres, V.E., Grande, J.P., Kanwar, Y.S. and Kumar, R. (1997) Expression of polycystin in mouse metanephrons and extra-metanephric tissues. Kidney Int., 52, 1196–1205.[ISI][Medline]
31 Warne, P.H., Viciana, P.R. and Downward, J. (1993) Direct interaction of Ras and the amino-terminal region of Raf-1 in vitro. Nature, 364, 352–355.[Medline]
32 Lane, D.P. and Crawford, L.V. (1979) T antigen is bound to a host protein in SV40-transformed cells. Nature, 278, 261–263.[Medline]
33 Jenkins, J.R., Chumakov, P., Addison, C., Sturzbecher, H.W. and Wade-Evans, A. (1988) Two distinct regions of the murine p53 primary amino acid sequence are implicated in stable complex formation with simian virus 40 T antigen. J. Virol., 62, 3903–3906.
34 Iwabuchi, K., Li, B., Bartel, P. and Fields, S. (1993) Use of the two-hybrid system to identify the domain of p53 involved in oligomerization. Oncogene, 8, 1693–1696.[ISI][Medline]
35 Moran, N. and Bock, E. (1988) Characterization of the kinetics of neural cell adhesion molecule homophilic binding. FEBS Lett., 242, 121–124.[ISI][Medline]
36 Wheelock, M.J., Buck, C.A., Bechtol, K.B. and Damsky, C.H. (1987) Soluble 80-kD fragment of Cell-Cam 120/80 disrupts cell–cell adhesion. J. Cell. Biochem., 34, 187–202.[ISI][Medline]
37 Sun, J., Williams, J., Yan, H., Amin, K.M., Albelda, S.M. and DeLisser, H.M. (1996) Platelet endothelial cell adhesion molecule-1 (Pecam-1) homophilic adhesion is mediated by immunoglobulin-like domains 1 and 2 and depends on the cytoplasmic domain and the level of surface expression. J. Biol. Chem., 271, 18561–18570.
38 Ranheim, T.S., Edelman, G.M. and Cunningham, B.A. (1996) Homophilic adhesion mediated by the neural cell adhesion molecule involves multiple immunoglobulin domains. Proc. Natl Acad. Sci. USA, 93, 4071–4075.
39 Brieher, W.M., Yap, A.S. and Gumbiner, B.M. (1996) Lateral dimerization is required for the homophilic binding activity of C-cadherin. J. Cell Biol., 135, 487–496.
40 Calvet, J.P. (1998) Molecular genetics of polycystic kidney disease. J. Nephrol., 11, 24–34.[ISI][Medline]
41 Carone, F.A., Bacallao, R. and Kanwar, Y. (1998) Role of the matrix in autosomal dominant polycystic kidney disease. Renal Failure, 20, 181–189.
42 Grantham, J. (1996) The etiology, pathogenesis, and treatment of autosomal dominant polycystic kidney disease: recent advances. Am. J. Kidney Dis., 28, 788–803.
43 Avner, E.D. (1993) Epithelial polarity and differentiation in polycystic kidney disease. J. Cell Sci., 17, 217–222.
44 Lu, W., Peissel, B., Babakhanlou, H., Pavlova, A., Geng, L., Fan, X., Larson, C., Brent, G. and Zhou, J. (1997) Perinatal lethality with kidney and pancreas defects in mice with a targetted Pkd1 mutation. Nature Genet., 17, 179–181.[ISI][Medline]
45 Weston, B.S., Jeffery, S., Jeffrey, I., Sharaf, S.F., Carter, N., Saggar-Malik, A. and Price, R.G. (1997) Polycystin expression during embryonic development of human kidney in adult tissues and ADPKD tissue. Histochem. J., 29, 847–856.[ISI][Medline]
46 Ward, C.J., Turley, H., Ong, A.C.M., Comley, M., Biddolph, S., Chetty, R., Ratcliffe, P.J., Gattner, K. and Harris, P.C. (1996) Polycystin, the polycystic kidney disease 1 protein, is expressed by epithelial cells in fetal, adult, and polycystic kidney. Proc. Natl Acad. Sci. USA, 93, 1524–1528.
47 Gumbiner, B.M. (1996) Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell, 84, 345–357.[ISI][Medline]
48 Kim, E., Arnould, T., Sellin, L.K., Benzing, T., Fan, M.J., Gruning, W., Sokol, S.Y., Drummond, I. and Walz, G. (1999) The polycystic kidney disease 1 gene product modulates Wnt signaling. J. Biol. Chem., 274, 4947–4953.
49 Ibraghimov-Beskrovnaya, O., Ervasti, J.M., Leveille, C.J., Slaughter, C.A., Sernett, S.W. and Campbell, K.P. (1992) Primary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix. Nature, 355, 696–702.[Medline]
50 Ohlendieck, K. and Campbell, K.P. (1991) Dystrophin-associated proteins are greatly reduced in skeletal muscle from mdx mice. J. Cell Biol., 115, 1685–1694.
51 Phizicky, E.M. and Fields, S. (1995) Protein–protein interactions: methods for detection and analysis. Microbiol. Rev., 59, 94–123.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  A. Velayos-Baeza, C. Toma, S. Paracchini, and A. P. Monaco The dyslexia-associated gene KIAA0319 encodes highly N- and O-glycosylated plasma membrane and secreted isoforms Hum. Mol. Genet., March 15, 2008; 17(6): 859 - 871. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Yu, K. Hackmann, J. Gao, X. He, K. Piontek, M. A. Garcia-Gonzalez, L. F. Menezes, H. Xu, G. G. Germino, J. Zuo, et al. Essential role of cleavage of Polycystin-1 at G protein-coupled receptor proteolytic site for kidney tubular structure PNAS, November 20, 2007; 104(47): 18688 - 18693. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Weimbs Polycystic kidney disease and renal injury repair: common pathways, fluid flow, and the function of polycystin-1 Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1423 - F1432. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Hassane, N. Claij, I. S. Lantinga-van Leeuwen, J. C. Van Munsteren, N. Van Lent, R. Hanemaaijer, M. H. Breuning, D. J.M. Peters, and M. C. DeRuiter Pathogenic Sequence for Dissecting Aneurysm Formation in a Hypomorphic Polycystic Kidney Disease 1 Mouse Model Arterioscler. Thromb. Vasc. Biol., October 1, 2007; 27(10): 2177 - 2183. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Bierne and P. Cossart Listeria monocytogenes Surface Proteins: from Genome Predictions to Function Microbiol. Mol. Biol. Rev., June 1, 2007; 71(2): 377 - 397. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Smith, N. O. Bukanov, H. Husson, R. J. Russo, T. C. Barry, A. L. Taylor, D. R. Beier, and O. Ibraghimov-Beskrovnaya Development of Polycystic Kidney Disease in Juvenile Cystic Kidney Mice: Insights into Pathogenesis, Ciliary Abnormalities, and Common Features with Human Disease J. Am. Soc. Nephrol., October 1, 2006; 17(10): 2821 - 2831. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Joly, S. Ishibe, C. Nickel, Z. Yu, S. Somlo, and L. G. Cantley The Polycystin 1-C-terminal Fragment Stimulates ERK-dependent Spreading of Renal Epithelial Cells J. Biol. Chem., September 8, 2006; 281(36): 26329 - 26339. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Paracchini, A. Thomas, S. Castro, C. Lai, M. Paramasivam, Y. Wang, B. J. Keating, J. M. Taylor, D. F. Hacking, T. Scerri, et al. The chromosome 6p22 haplotype associated with dyslexia reduces the expression of KIAA0319, a novel gene involved in neuronal migration Hum. Mol. Genet., May 15, 2006; 15(10): 1659 - 1666. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Najmudin, C. I. P. D. Guerreiro, A. L. Carvalho, J. A. M. Prates, M. A. S. Correia, V. D. Alves, L. M. A. Ferreira, M. J. Romao, H. J. Gilbert, D. N. Bolam, et al. Xyloglucan Is Recognized by Carbohydrate-binding Modules That Interact with beta-Glucan Chains J. Biol. Chem., March 31, 2006; 281(13): 8815 - 8828. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Boca, G. Distefano, F. Qian, A. K. Bhunia, G. G. Germino, and A. Boletta Polycystin-1 Induces Resistance to Apoptosis through the Phosphatidylinositol 3-Kinase/Akt Signaling Pathway J. Am. Soc. Nephrol., March 1, 2006; 17(3): 637 - 647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. B. N. Lee, E. Huang, and H. J. Ward Tight junction biology and kidney dysfunction Am J Physiol Renal Physiol, January 1, 2006; 290(1): F20 - F34. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Qian, W. Wei, G. Germino, and A. Oberhauser The Nanomechanics of Polycystin-1 Extracellular Region J. Biol. Chem., December 9, 2005; 280(49): 40723 - 40730. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Kim, W. Jeong, K. Ahn, C. Ahn, and S. Kang Siah-1 Interacts with the Intracellular Region of Polycystin-1 and Affects Its Stability via the Ubiquitin-Proteasome Pathway J. Am. Soc. Nephrol., August 1, 2004; 15(8): 2042 - 2049. [Abstract] [Full Text] [PDF]
|
|
|