Human Molecular Genetics, 2000, Vol. 9, No. 11 1651-1663
© 2000 Oxford University Press
Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells
1Department of Cytogenetics and Molecular Genetics, Womens and Childrens Hospital, Adelaide, South Australia 5006, Australia, 2Peter MacCallum Cancer Institute, East Melbourne, Victoria 3002, Australia and 3Department of Pediatrics and 4Department of Genetics, The University of Adelaide, South Australia 5000, Australia
Received 13 March 2000; Revised and Accepted 27 April 2000.
DDBJ/EMBL/GenBank accession nos AF217490AF217492 and AF227526AF227529.
| ABSTRACT |
|---|
|
|
|---|
Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.
| INTRODUCTION |
|---|
|
|
|---|
Chromosomal instability is a feature of certain types of cancer. It is not yet clear whether such instability represents the outcome of a selection process involving the gain, loss or alteration of specific genetic material or whether certain regions of the genome are predisposed to instability. Fragile sites are chromosomal structures which have been proposed to have a determining role in cancer-associated chromosomal instability (1). There are in excess of 100 fragile sites in the human genome (2), of which the fragile site FRA11B is located within the CBL2 proto-oncogene (3,4) and the FRA3B, FRA7G and FRA16D sites have been located within or adjacent to regions of instability in cancer cells (511).
There are two distinct forms of chromosomal anomaly referred to as fragile sites (12). The rare form is polymorphic in the population and is accounted for by the expansion of repeat DNA sequences beyond a copy number limit. The common form is present at many loci in all individuals. Despite determination of the complete sequence of the common fragile site FRA3B (1315) and partial sequence analysis of the common fragile sites FRA7G (8,9) and FRA7H (16), the molecular basis for common fragile sites is not yet understood. Fragile sites are also distinguished by the culture conditions required for their induction. Common fragile sites are (mainly) induced by aphidicolin, whereas the rare fragile sites are induced by either high or low concentrations of folate, AT-rich binding chemicals such as distamycin A or by bromodeoxyuridine. The role of chromosomal fragile sites in human genetic disease was thought to be restricted to fragile X syndrome caused by the FRAXA fragile site; however, a mild form of mental retardation has been associated with FRAXE (17). In addition, the FRA11B fragile site appears to predispose to 11q breakage leading to some cases of Jacobsen syndrome (3,4), raising the possibility of other diseases of diverse phenotypes being associated with other fragile sites.
Recent detailed molecular analysis of fragile site loci has demonstrated that the common fragile site FRA3B is located within a region subject to localized deletion and that this deletion is frequently observed in certain forms of cancer (5,6). FRA3B lies proximal to the major region of loss of heterozygosity (LOH) on chromosome 3p previously shown to be responsible for deletion of the VHL tumour suppressor (18). The cancer-associated FRA3B deletions can result in inactivation of a gene (FHIT for fragile histidine triad) which spans the fragile site. The FHIT gene product has been shown to have a role in tumour growth (19); however, there has been a great deal of controversy over the functional significance of FHIT loss to the tumorigenic process (20,21).
The sequence of the region containing FRA3B has been determined; however, neither the molecular basis for expression of the fragile site nor the cancer-associated instability is clearly resolved (1315). The FRA3B region sequence has an abundance of the L1 type of long interspersed nuclear element (LINE) DNA repeats. It may be that these elements constitute the molecular basis for fragile site expression, as the expansion of repeat elements is the only known cause for rare fragile sites. The L1 elements are frequently found at or near the boundaries of FRA3B/FHIT deletions in cancer cell DNA (14,15) and have therefore been proposed to facilitate the deletion process.
Analysis of the common fragile site FRA7G has also demonstrated that this fragile site is located within a region of frequent deletion in breast and prostate cancer (8,9). This region contains two members of the caveolin gene family the deletion of which may play an important role in tumorigenesis (7,22). Only a partial sequence for this fragile site is available and so it is not clear whether other genes may be affected by FRA7G-associated chromosomal instability. Molecular studies have also been undertaken at the FRA7H fragile site and the region around an SV40 integration site at this locus has been sequenced (16). No genes were identified in this 161 kb sequence; however, this sequence does not appear to span the entire fragile site and further analysis may reveal associated genes.
We have previously localized the minimum region required for cytogenetic expression of FRA16D by establishing a contig of subclones across the region and determining their position with respect to FRA16D by fluorescence in situ hybridization (10). DNA markers from within this region were used to detect instability in tumour cell lines that had previously been shown to exhibit instability at the FRA3B locus. One of these cell lines, the gastric adenocarcinoma AGS, was shown to have a homozygously deleted region that spanned the FRA16D fragile site. Using representational difference and PCR deletion analysis Paige et al. (11) have identified the FRA16D region as a site of homozygous deletion in three additional tumours (from ovary, lung and colon).
We have determined the complete DNA sequence of a minimal tile path of subclones spanning FRA16D to define the molecular limits of this common fragile site region. Within this sequence genetic and/or physical markers have been identified that delineate the boundaries of the observed DNA instability in cancer cells. The FRA16D region sequence also allowed identification of potential genes as expressed sequence tags (ESTs) as likely candidate targets for instability and found no evidence for a transcript within the 270 kb containing FRA16D. Instead, a transcript (FOR for fragile site FRA16D oxidoreductase) was identified which spans the FRA16D fragile site, the common minimal region of homozygous deletion found in adenocarcinomas and three out of five translocation breakpoints in multiple myeloma. Transcripts from the alternatively spliced FOR gene encode proteins with common N-terminal WW domains and variable homology to the oxidoreductase family of proteins. FOR is therefore the most likely gene to convey any biological consequences of DNA instability at the FRA16D locus.
| RESULTS |
|---|
|
|
|---|
DNA sequence spanning FRA16D
The DNA sequence spanning FRA16D was determined by a combination of approaches. Firstly, a tile path of
subclones of YAC My801B6 and BAC 325M3 was restriction mapped with restriction endonucleases EcoRI, HindIII, BamHI and SacI in order to provide a reference framework with which to anchor the DNA sequence (10). Secondly, either whole BAC DNA preparations of BAC325M3 or BAC353B15 or specific restriction fragments from the
subclone tile path were used as feedstock DNA for construction of random insert plasmid libraries. Sequences from the region between BAC325M3 and BAC353B15 [
subclone tile path
32
191 (10)] were subjected to long range PCR and restriction digest analysis in order to verify the integrity of this sequence. Sequenced subclones were also ordered by hybridization with individual
subclones from the minimal tile path. The DNA sequences were therefore assembled in a directed rather than random manner. This approach greatly assisted in the assembly of those regions that were rich in DNA repeats. The 270 kb contiguous sequence spanning FRA16D, with an average 4-fold sequence coverage, has been deposited in GenBank (accession no. AF217490) (Fig. 1).
|
Relationship between deletion and translocation breakpoints and FRA16D
PCR analysis of sequence tags across the FRA16D region was used to refine the location of deletion breakpoints in the AGS and HCT116 tumour cell lines (Fig. 1 and Table 1). Both cell lines showed at least two distinct regions of homozygous deletion, indicating a minimum of three deletion events on the two chromosomes 16 in each cell line. Four regions of the FRA16D-spanning sequence were particularly difficult to determine because of their composition (as evident by DNA polymerase pausing in sequencing). Each of these sequences coincided with breakpoint regions in HCT116 or AGS tumour cell lines (Fig. 1, and referred to as pause sites in Table 1). The unstable regions consisted of: (i) a poly(A) homopolymer region at 144145 kb of DNA sequence AF217490; (ii) an imperfect CT repeat of 320 bp at positions 177178 kb; (iii) an 8 kb region at positions 191199 kb encompassing a poly(A) homopolymer region followed by an AT repeat, a poly(T) homopolymer repeat and two inverted (hairpin-forming) repeats; (iv) a TG repeat followed by a homopolymer region [poly(T)] at 212213 kb. This fourth sequence is located within a common breakpoint region for the AGS and HCT116 cell lines at 211.7219.9 kb of AF217490. PCR across each of the breakpoint regions in the AGS and HCT116 cell lines using primers from positive flanking STSs failed to produce products, suggesting that additional cryptic instability (e.g. inversions or amplifications) may also be present.
|
The locations of three previously identified multiple myeloma breakpoints (23) were determined by either BLAST scanning of partial database sequences or by PCR of STSs on the tile path of
subclones spanning FRA16D. The location of MM1 was verified by PCR of
subclone
131 (which also contained the STS IM7). The locations of JJN3 and ANBL6 are based on their presence or absence in the BAC sequences GenBank accession nos AC027279 and AC009145 and the relative position of these BAC sequences with respect to the marker D16S504. The location of the translocation breakpoints (Fig. 1) is in agreement with that published by Chesi et al. (23).
Repeat elements and DNA flexibility in the FRA16D-spanning sequence
The DNA sequence spanning FRA16D was analysed for type and quantity of DNA repeats since DNA repeats are known to be the molecular basis for the rare fragile sites and have been proposed to have a role in common fragile site instability (15). Comparison of the FRA16D-spanning sequence with that of other common fragile sites, FRA3B and the partially sequenced FRA7H and FRA6E regions (Fig. 2A), gave a surprising degree of variation in the type and quantity of repeat DNA sequences. LINE-1 elements, which have been proposed to play a major role in the DNA instability seen at the FRA3B locus, were significantly under-represented at the FRA16D locus when compared with not only the other fragile site loci but also the human genome in general (Fig. 2A).
|
Common fragile site DNA sequences have been identified as containing regions of flexibility as determined by the computer program FlexStab (16). This program was obtained from the website of Dr B. Kerem (http://leonardo.ls.huji.ac.il/departments/genesite/faculty/bkerem.htm ) and was used to analyse the FRA16D DNA sequence. Six regions of flexibility were identified (Fig. 2B), two of which (peaks 1 and 4) coincide with breakpoints of homozygously deleted regions in the HCT116 and AGS cell lines, respectively. A third peak (peak 5) maps in the vicinity of another breakpoint in the AGS cell line (Fig. 2B).
The alternatively spliced FOR gene spans fragile site FRA16D
Scanning of the 270 kb sequence spanning FRA16D by BLAST homology searches revealed a paucity of EST homologies, almost all of which could be accounted for as illegitimate (Table 2). The exceptions were consecutive exons corresponding to sequences from the EST qg88f04.x1 (Fig. 1). These exons therefore locate FRA16D within a 260 kb intron. BLAST searches with the qg88f04.x1 EST sequence revealed considerable overlap with clusters of ESTs, the longest available sequence of which was HHCMA56 (U13395). Part of the HHCMA56 sequence has been mapped previously ~700 kb distal to FRA16D (11). ESTs qg88f04 and HHCMA56 clearly have distinct 3' end sequences and were therefore referred to as transcripts I and II. Another cluster of ESTs (transcript III) was found to share 5' but not 3' end sequences with transcripts I and II. A fourth cluster of ESTs (transcript IV) was found to share sequence homology; however, this overlap is between the 5' most sequences of transcripts IIII and the 3' end of the EST cluster, suggesting that it represents an overlapping gene rather than another alternatively spliced transcript.
|
All other ESTs with homology to the FRA16D-spanning sequence exhibit features which discount them as likely to represent authentic transcripts. In most cases the homology between the EST and the chromosomal DNA sequence was collinear and therefore not interrupted by introns. The exceptions (Table 2) were chimeric, having either additional unique sequences from elsewhere in the genome than 16q23.2 or Alu sequences of unattributable origin. The 3' end sequences that had poly(A) tails also had poly(A) sequences in the chromosomal DNA, indicating that the poly(A) sequence in the EST was not a post-transcriptional addition. In addition, there were no expected polyadenylation signal sequences (AATAAA) located ~20 bp upstream of the poly(A) tracts. A single exception was qz19h11, where the EST has a poly(A) segment while the genomic DNA does not; however, there is no poly(A) signal and no intron boundaries are evident. The majority of the ESTs were singletons indicative of rare events and are most likely due to rare oligo(dT) priming from a chromosomal DNA contaminant in the cDNA library preparations. ESTs that are in the same transcriptional orientation as the FOR gene could represent 3' exons of yet additional alternatively spliced forms of FOR gene transcripts.
The 270 kb FRA16D-spanning sequence was also subjected to GenScan gene prediction analysis. This analysis revealed only three likely exons, one of which (at positions 42164621) was exon 8 of the FOR gene. The others (at 81347818 and 225 339225 270) were both in the opposite orientation to the FOR gene and neither corresponded to any of the EST homologies that were detected in the BLAST searches. The GenScan analysis did not identify exon 9 of the FOR I transcript. This is consistent with this exon (which contains mainly 3' untranslated region) being a poorly utilized alternative splice pathway giving rise to the low abundance FOR I mRNA. The remainder of the FOR I mRNA 3' untranslated region (consisting of an AT-rich sequence of only 30 bases) is thought to be encoded by an additional exon (exon 10) (Fig. 1); however, this exon is yet to be located in the chromosomal DNA sequence.
5'-RACE experiments using mRNA from normal (HS578BST) and tumour (T47D) cells were utilized to extend and confirm the sequences of the clusters of GenBank EST sequences of transcripts IIV and to determine the organization of the alternatively spliced mRNAs which they represent (Fig. 3). Transcripts IIII were found to have a common 5' end, indicating a common promoter. The exons shared and utilized in the alternatively spliced mRNAs were identified in BAC sequences AF217491, AF217492, AC009044, AC009280 and AC009129 (Fig. 1). The confinement of distribution of EST sequences amongst exons confirmed that the different transcripts were due to alternative splicing. Transcripts IIII share a common initiation methionine with an adjacent 5' Kozak translation initiation sequence and an upstream in-phase termination codon. The open reading frames code for proteins of 41.2, 46.7 and 21.5 kDa, respectively. Each of these open reading frames shares homology with the oxidoreductase family of proteins and therefore the gene has been named FOR (fragile site FRA16D oxidoreductase), with the alternatively spliced transcripts IIII referred to as FOR I, FOR II and FOR III, respectively.
|
Northern blot analysis with various FOR exon probes identified the 2.3 kb FOR II transcript as the predominant and ubiquitously expressed mRNA, with FOR I and FOR II mRNAs showing a similar pattern of expression (Fig. 4). A DNA probe spanning the 5' exons detected additional RNAs with a different tissue-specific pattern. A cluster of ESTs (Fig. 1) with homology limited to exon 1 of the FOR gene was found from a BLAST search of the databases. This suggests that these transcripts (referred to as FOR IV) might arise from a different promoter and may well constitute a different gene, the 3' end of which overlaps with the 5' end of FOR (Fig. 1). The 3' end sequences of these ESTs contain a very short open reading frame (4.1 kDa) which is truncated with respect to that seen in the FOR transcripts. The complete FOR IFOR III mRNA and partial related transcript sequence (FOR IV) were determined from 5'-RACE and RTPCR products and deposited in GenBank (accession nos AF227526, AF227527, AF227528 and AF227529). An mRNA of ~2.7 kb in length of unknown identity was detected with probe B in the kidney and three RNAs (~5.5, ~8 and ~11 kb) were found in various tissues (Fig. 4), indicating that additional alternatively spliced FOR transcripts are likely. The complete length of the FOR IV mRNA is yet to be determined and may account for one or more unidentified transcripts.
|
FOR mRNA in normal and tumour cells
RTPCR and 5'-RACE were used to detect the various FOR transcripts in normal and tumour cells. Striking differences between the presence/absence of FOR I and FOR III transcripts was noted for the normal fibroblast-like cell line HS578BST and various tumour cell lines (Fig. 5). 5'-RACE and RTPCR products for transcript-specific PCR were sequenced to confirm the identity of the respective products. The sequence of the aberrant RTPCR product from cell line MDA-MB-453 generated using a FOR III-specific primer contains a retroviral element (HERV-H) 5' of exons 5 and 6A of FOR (GenBank accession no. AF239665). In addition, one EST (qz23c04.x1) identified in database BLAST searches contains exons 13 of FOR spliced at the 3' end to another retroviral element, LTR13.
|
Homozygous deletion of FOR I exon 9 detected in AGS tumour cells suggests that the gain of FOR I transcript will not be a common event in tumour cells. Similarly, the loss of FOR III transcript is not common to all tumour cells as FOR III-specific RTPCR products were readily detected in both AGS and HCT116 cells (Fig. 5).
FOR-encoded proteins
The alternatively spliced mRNAs transcribed from the gene each show homology to the oxidoreductase superfamily of proteins. The open reading frames of the alternatively spliced FOR gene mRNAs IIII have a common N-terminus which contains two WW domains (Fig. 3). The first WW domain is truncated in the FOR IV open reading frame; however, since this mRNA appears to originate from a distinct promoter it may well be that an upstream reading frame is utilized in this mRNA. The open reading frame from the FOR III transcript retains the WW domains; however, it is truncated for approximately half the length of the oxidoreductase homology (Fig. 3).
| DISCUSSION |
|---|
|
|
|---|
Structure/composition of common fragile sites
A principle aim of the current study was to compare the DNA sequence spanning the FRA16D fragile site with that of other common fragile site sequences in order to identify possible shared sequence elements which might account for common properties. Given that it is DNA repeat sequences that constitute the molecular basis of rare chromosomal fragile sites, the overall repeat composition of the FRA16D-spanning DNA sequence was strikingly different to other common fragile site sequences (Fig. 2), although those from the vicinity of FRA7H and FRA6E have not been shown to span the fragile site. A further difference was noted with respect to LINE elements, which have been proposed to play a role in the DNA instability seen at the FRA3B common fragile site (15). No consistent association was seen between LINE elements and the FRA16D breakpoints in AGS and HCT116 tumour cell DNAs, suggesting that LINE elements are not an essential feature of common fragile site-associated DNA instability in cancer. Instead, Alu repeats were more common in FRA16D than LINE elements. These differences suggest that it is not the broad composition of the region which gives rise to chromosomal fragility and, therefore, it is more likely that localized sequence elements (such as DNA polymerase pause sites) play the determining role.
Analysis of the FRA16D sequence using the FlexStab program supports the proposal that regions of flexibility contribute to DNA instability in the vicinity of fragile sites (16) as two peaks of flexibility correspond to homozygous deletion breakpoints in tumour cells. These DNA sequences contain the simple AT dinucleotide repeat which is capable of forming secondary structures. The AT-rich DNA sequences at nucleotide positions 191.6198.4 kb of AF217490 are also capable of forming hairpin structures in vitro and are therefore similar to the AT-rich DNA repeats associated with the FRA10B and FRA16B rare fragile sites. These DNA polymerase pause sites coincide with some of the breakpoint locations in AGS and HCT116 tumour cells. Given that DNA breakage is a form of chromosome fragility, then the coincidence of cancer cell breakpoints with these AT-rich secondary structures suggests that the latter may have a role in cytogenetic expression of the FRA16D fragile site. While FRA16D is a common fragile site and is therefore expressed in all individuals, there is a possibility that polyporphism in the vicinity of FRA16D may contribute to differences in the percentage of metaphases which exhibit cytogenetic expression of the fragile site.
Fragile site DNA sequences have been found to act as regions of delayed replication (2426) and in so doing may contribute to the coupling of DNA replication with cell division. Deletion of fragile site sequences in cancer cells may therefore confer a selective advantage to the tumour cell in a manner which is otherwise independent of the gene in which the fragile site is located. Alternatively, given the coupling of replication with transcription, the deletion of a sequence which normally delays replication may have an effect on the expression of genes in the vicinity.
Identification of the FOR gene spanning FRA16D
Given the proposed role of the FHIT gene in mediating the biological consequences of FRA3B-associated DNA instability in cancer cells we sought to identify the closest gene to FRA16D which might mediate the biological effects of FRA16D-associated DNA instability in cancer (10,11). Sequence analysis of the FRA16D-spanning DNA sequence revealed the FOR gene as the sole transcript in the immediate vicinity of the minimal region of homozygous deletion in cancer cells. Alternative exons of this gene were found to flank both the FRA16D fragile site and the tumour cell deleted regions, the alternative exon 9 being deleted in the AGS cell line. No additional authentic transcripts from within the FOR gene intron were evident. In an analogous situation to that seen at the FRA3B locus, deletions at FRA16D appear to be largely intronic to the major alternatively spliced transcript (FOR II). Studies on the FHIT gene spanning FRA3B have given contradictory results in terms of the possible role of FHIT in neoplasia. Therefore, it will be of interest to determine the effect of deletions at FRA16D on the FOR gene transcripts and whether any of the FOR-encoded proteins and their dysfunction brought about by FRA16D-associated deletion have a role to play in cancer.
The finding that the FOR gene spans FRA16D represents a shared feature of common fragile sites FRA3B and FRA16D in that they are both unstable regions located within large introns of large genes; FHIT (>1 Mb) and FOR (>1 Mb). The sequences determined at the FRA7G, FRA7H and FRA6E loci may be of insufficient length to identify the respective spanning genes.
Differential expression of alternatively spliced and aberrant FOR transcripts in normal and tumour cells
RTPCR and 5'-RACE gave differing patterns of FOR transcript expression in various normal and tumour cell lines. It will be of interest to determine whether there are differences in the ratio of FOR transcripts which are consistent with the biological characteristics of various cell types, e.g. neoplastic state or metastatic potential. It is unlikely that the presence of FOR I transcripts will be a common property of tumour cells since at least the AGS cell line is homozygously deleted for FOR I exon 9. Additional aberrant FOR transcripts, including sequences fused to retroviral LTRs, were detected in tumour cells. Extensive studies on the FHIT gene at the FRA3B locus have yet to resolve the role (if any) of aberrant transcripts of this gene in neoplasia. It is likely that extensive functional studies of alternative FOR transcript expression will be needed in order to determine what contribution (if any) this phenomenon contributes to the biological characteristics of the cells where it is observed.
It may well be that the ratio of the various FOR transcripts is perturbed by DNA instability in the region and that it is the resultant alteration in relative abundance of the various FOR-encoded proteins which mediates the biological consequences of DNA instability at FRA16D. For example, the homozygous deletion in AGS cells deletes exon 9 of the FOR I transcript and may have an effect on the stability of the FOR II transcript; however, this deletion is unlikely to have any effect on the FOR III transcript, which terminates well outside the homozygously deleted region.
Possible function of FOR and role in neoplasia
The FOR-encoded proteins show sequence homology to the oxidoreductase family of proteins and contain WW domains. Other members of this family of proteins include the YES proto-oncogene-associated proteins and NEDD ubiquitin ligases.
The open reading frame from the FOR III transcript retains the WW domains; however, it is truncated for approximately half the length of the oxidoreductase/ubiquitin ligase homology (Fig. 3). The FOR III protein is therefore likely to be able to bind proteins that recognize the common FOR I and FOR II WW domains but not be able to perform the enzymatic function encoded by the FOR I and FOR II proteins (possibly ubiquitination). Such characteristics make the FOR III protein a likely competitor of FOR I and/or FOR II. Since ubiquitination facilitates the process of specific protein turnover, FOR III could therefore act to prolong the half-life of its substrate by competing with FOR I and/or FOR II.
WW domains are regions of proteinprotein interaction that bind polyproline-rich motifs (PY domains) in specific partner proteins. Specificity in this interaction is determined by differences in particular amino acids in the various WW domains. Proteins known to bind to WW domains include the YES proto-oncogene product and p53 binding protein-2 (27). Alteration in the relative levels of the FOR-encoded proteins as a consequence of FRA16D-associated instability is therefore likely to influence the biological function of the PY motif-containing protein(s), which is (are) the normal binding partner that the FOR proteins share through their WW domain.
The majority of deletions in the 16q23.2 region are heterozygous, with the homozygous deletions being confined and limited in number (11). Cells which still have the capacity to produce FOR II protein (from a normal chromosome 16 FOR allele) might have an elevated level of FOR III (through FRA16D-associated deletion of the other chromosome 16 allele) and therefore have a selective heterozygote advantage.
The finding of aberrant FOR-related transcripts spliced to retroviral RNA sequences in tumour cells that do not necessarily exhibit FRA16D homozygous deletion (e.g. MDA-MB-453, Fig. 4) suggests that dysfunction of the pathway involving the FOR WW domain could be a common event in neoplasia, perhaps through other forms of FRA16D-related DNA instability such as DNA insertion or translocation. Three out of five previously mapped multiple myeloma translocations (23) map within the FOR gene, suggesting that DNA instability at the FRA16D locus and aberrant expression of the FOR gene may have a variety of roles to play in various forms of cancer.
The c-MAF oncogene is also located in the vicinity of FRA16D (Fig. 1) and has been identified as a target for multiple myeloma translocations, exhibiting dysregulation of expression of the translocated allele (23). It is not yet clear whether deletions in the FRA16D region, such as the LOH often seen in breast cancer or the homozygous deletions seen in certain adenocarcinomas, have an effect on c-MAF expression. The location of the various forms of DNA instability in this region with respect to the FOR gene suggest that this gene may also be affected; it is a distinct possibility that both c-MAF and FOR have a role to play in mediating the biological consequences of FRA16D-associated DNA instability.
It will be of interest to determine whether there is a general relationship between common chromosomal fragile sites and DNA instability in cancer. In this regard it is noteworthy that there are two other common regions of cancer cell LOH on 16q in addition to that involving FRA16D (28). One of these at 16q24.3 maps near the telomere while the other at 16q22.1 maps near another common fragile site, FRA16C.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell lines
Cell lines AGS, HCT116, HS578BST, HS578T, LS180, MDA-MB-453 and T47D are from the Department of Cytogenetics and Molecular Genetics, WCH collection, and were originally obtained from the American Type Culture Collection or the European Collection of Cell Cultures. AGS and LS180 cells were grown as described previously (10). HS578BST cells were grown in OPTI-MEM with L-glutamine, 0.01 µg/ml epidermal growth factor, 0.5 µg/ml hydrocortisone, 8% fetal calf serum in 5% CO2. T47D, MDA-MB-453 and HS578T cells were grown in RPMI 1640 with L-glutamine, 10% fetal calf serum in 5% CO2.
Large-scale sequencing of FRA16D
Sequencing of the 270 kb region spanning FRA16D consisted of: (i) sonication libraries; (ii) nebulization libraries of BAC clones 325M3 and 353B15; and (iii) restriction fragments of
clones (for sequencing between BAC 325M3 and BAC 353B15).
Construction of sonication libraries.
For DNA sonication and cloning we modified the protocol from the Sanger Centre (http://www.sanger.ac.uk/Teams/Team53/sonication.shtml ). Aliquots of 1 µg of each BAC DNA were sonicated in 300 µl H2O and 8 µl 10x mung bean buffer (500 mM Na acetate, 300 mM NaCl, 10 mM ZnSO4, pH 5.0) on ice for 20 s using a Heat Systems Sonicator W-225 (50% duty, 3.5 power) (Ultrasonic, Farmingdale, NY). After reducing the volume to 80 µl, blunt ends were created by adding 40 U of mung bean nucleases (Biolabs, Beverly, MA) and incubating the mixture at 30°C for 25 min. The products were size fractioned on a 1% agarose gel and fragments ranging from 0.7 to 2 kb were extracted with the QiaQuick Gel Extraction kit (Qiagen, Hilden, Germany). Samples of 1500 ng sonicated DNA (used in 500 ng aliquots) were ligated into vector pUC18-Sma (Amersham Pharmacia, Uppsala, Sweden) at 16°C overnight and transformed into electroporation-competent Sure cells (Stratagene, La Jolla, CA). Samples of 600 and 1500 clones, respectively, of the sonication libraries of BAC 325M3 and 353B15 were gridded on 96-well plates and sequenced in one direction using the M13-forward primer. Sequences were assembled into contigs using the Staden Package (MRC, Cambridge, UK) on a UNIX computer and edited in LASERGENE (Macintosh). For a selected number of clones additional sequences with the M13-reverse primer were retrieved and assembled. Additional sequencing primers were designed and PCR products sequenced to close the gaps between contigs.
Construction of nebulization libraries.
Aliquots of 10 µg of each BAC DNA were mixed with 200 µl 10x TM buffer (500 mM TrisHCl, pH 7.5, 150 mM MgCl2) and 1 ml sterile glycerol and H2O added to 2 ml. The mixture was pipetted into an IPI nebulizer and nebulized at 10 p.s.i. for 45 s. The nebulized DNA was then precipitated, end repaired, size fractionated and cloned as described for the sonicated DNA. Samples of 300 and 500 nebulized clones, respectively, of BAC 325M3 and 353B15 were sequenced as described above and included in the assemblies. Subclones for sequencing of BAC 353B15 were picked randomly, whereas BAC 325M3 subclones were selected after hybridization of specific
clones of the tile path made from BAC 325M3 (10).
Subcloning of restriction fragments of
-clones between
-32 and
-191 in vector pUC19. Clones were sequenced with M13-forward and M13-reverse primers as well as with sequence-specific primers. In some cases subclones derived from specific restriction fragments were also subject to sonication, shotgun cloning and sequencing.
Sequencing was performed with the ABI Big Dye Terminator kit from Perkin Elmer (Foster City, CA). In cases where sequencing with the Big Dye Terminator kit failed, a dRhodamine Terminator kit (ABI) was used, as recommended for GT-rich and homopolymeric regions by the ABI DNA sequencing guide.
Long range PCRs were performed on ~70 kb of DNA sequence in the region between BACs 325M3 and 353B15. Blood bank DNA was used as template. The remaining tile path of
subclones (10) was subjected to restriction analysis to give a redundant restriction map of the FRA16D region.
The final sequence was analysed using BLAST (http://www.ncbi.nlm.nih.gov/BLAST ), REPEATMASKER (http://ftp.genome.washington.edu/cgi-bin/RepeatMasker ), GENSCAN (http://CCR-081.mit.edu/GENSCAN.html ) and FLEXSTAB (http://leonardo.ls.huji.ac.il/departments/genesite/faculty/bkerem.htm ).
Northern blot hybridization
Probes for hybridization on multiple tissue northern blots from Clontech were: probe A, part of exon 1A (163 bp), positions 298461 of AF227529; probe B, exons 36A (366 bp), positions 291657 of AF227528; probe C, exon 7 (186 bp), positions 690876 of AF227526; probe D, part of exon 9A (779 bp), positions 11821961 of AF227527.
RNA extraction
RNA was extracted from 1 x 107 cells for each of the cell lines using the RNeasy Mini Kit from Qiagen. The cells were disrupted by addition of 600 µl of lysis buffer RLT (supplied with the kit). The lysed cells were homogenized by passing 510 times through a 21G (0.8 x 38 mm) needle attached to a 5 ml syringe. Aliquots of 600 µl of 70% ethanol were added and the samples were applied to RNeasy Mini Spin columns. Purification and elution of the samples were carried out according to the kit manual. A total of 3598 µg of RNA was obtained.
RTPCR
Reverse transcription was carried out in a 40 µl reaction volume using 1233 µg of total RNA from cell lines AGS, HCT116, MDA.MB.453, LS180, T47D, HS578T and HS578BST, respectively, according to the product sheet of the Gibco BRL Superscript RNAse H Reverse Transcriptase kit (Gibco BRL, Gaithersburg, MD) except for the addition of 20 U RNase inhibitor (Rnasin; Promega, Madison, WI) to the mixture.
Aliquots of 100 ng of cDNA were amplified in PCRs using various cDNA primer combinations under standard PCR conditions (10 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 30 s; then 25 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 30 s).
Primers (5'
3') used in RTPCR were: HHCMA-F (ATCTTGGCCTGCAGGAACATGGCA) and wb85-F (TTATTCTGCACTTTTCTGGCGGAG), FOR III-specific; FOR-ex3 (GAACAAGAAACTGATGAGAACGGA) and wb85-F, FOR III-specific; wb85-E12 (TTACTACGCCAATCACACCGAGGA) and wb85-A (TGAATTAGCTCCAGTGACCACAAC), common for FORI, FOR II and FOR III.
5'-RACE
Complete 5' ends of transcripts FOR I, FOR II and FOR III were determined by 5'-RACE experiments including first strand cDNA synthesis, purification, TdT tailing of the cDNA, PCR of dC-tailed cDNA and nested amplification according to the Gibco BRL instruction manual.
Aliquots of 1 µg of total RNA of cell lines HS578BST (normal) and T47D (tumour) were taken as templates. First strand cDNA synthesis was conducted with the following specific GSP1 primers: FOR I, coxido-R, 5'-TTATTTCAGCACTCAGCTCAAAGTCAC-3'; FOR II, HHCMA-B, 5'-AGCAAAGAGACCTATGCCTAGCCCA-3'; FOR III, wb85-F, 5'-TTATTCTGCACTTTTCTGGCGGAG-3'.
PCR of the dC-tailed cDNA was carried out with the GSP2 primers: FOR I and FOR II, coxido-32, 5'-ATATCTGTAAATCGATGGGACTCTG-3'; FOR III, wb85-A, 5'-TGAATTAGCTCCAGTGACCACAAC-3'.
Nested amplification was done with 5 µl of a 1:100 dilution of GSP2 PCR products and the GSP3 primers: FOR I and FOR II, coxido-21, 5'-ACATGAAGAGGCACATTCTTGGCCT-3'; FOR III, wb85-E, 5'-TCCTCGGTGTGATTGGCGTAGTAA-3' in combination with the AUAP primer (Gibco BRL).
PCR products were extracted with a QiaQuick kit from agarose gels after electrophoresis and sequenced directly with GSP3 primers and primer tj96-C (5'-GGAGGCAGCTCGTCCTCACTG-3').
cDNA sequence of FOR IV (GenBank accession no. AF227529)
The preliminary cDNA sequence of the FOR IV transcript is incomplete at its 5' end at this stage. The sequence determined so far derives from overlapping EST clones qf42f03.x1 (AI149681) and tm79c11.x1 (AI570665). The latter was sequenced additionally with the internal primer tj96-C (5'-GGAGGCAGCTCGTCCTCACTG-3').
Determination of breakpoints in cell lines AGS and HCT116
Deletions in cell lines AGS and HCT116 were determined in duplex STSPCRs as described in Mangelsdorf et al. (10). All primers are listed 5'
3' in Table 1.
Four regions of homozygous deletion (referred to as HZD IHZD IV) were detected in the AGS cell line. The proximal breakpoint for HZD I in AGS was narrowed down to 654 bp between STSs 16D-15/16D-36 (+) and 16D-1/16D-60 (); the distal breakpoint of HZD I of 3962 bp is between STS 16D-70 () and 16D-47 (+). The proximal breakpoint for HZD II in AGS was narrowed down to 3030 bp between STSs 16D-57 (+) and 16D-67 (); the distal breakpoint of HZD II of 1720 bp is between STS 16D-68 () and 16D-54 (+). The proximal breakpoint for HZD III in AGS was narrowed down to 209 bp between STSs 16D-51 (+) and 16D-55 (); the distal breakpoint of HZD III of 5690 bp is between STS 16D-202 () and 16D-69 (+). The proximal breakpoint for HZD IV in AGS was narrowed down to 5179 bp between STSs 16D-30/16D-44 (+) and ETA1 (); the distal breakpoint of HZD IV of ~1500 bp is between STS IM7 () and 410S1A (+).
Two regions of homozygous deletion (referred to as HZD I and HZD II) were detected in the HCT116 cell line. The proximal breakpoint for HZD I in HCT116 was narrowed down to 1835 bp between STSs 16D-19 (+) and 16D-61 (); the distal breakpoint of HZD I of 1549 bp is between STS 16D-62 () and qz19h11 (+). The proximal breakpoint for HZD II in HCT116 was narrowed down to 422 bp between STSs 16D-63 (+) and 16D-30 (); the distal breakpoint of HZD II of 1513 bp is between STS 16D-66 () and 801A (+).
For determining the presence of exon 9 of FOR I (51 bp) in the AGS cell line a duplex PCR with genomic primers from the dystrophin gene (DMD) as described in example 1 was carried out with primers 8040/8041 (Table 1).
| ACKNOWLEDGEMENTS |
|---|
We thank Oliva Handt for comments on the manuscript and Shirley Richardson for excellent technical assistance. R.I.R. thanks Shelley Richards for support and encouragement. K.R. was supported by a post-doctoral fellowship from Deutscher Akademischer Austausch Dienst (Germany). This work was supported by grants from the National Health and Medical Research Council of Australia, the Womens and Childrens Hospital Research Foundation and the Anti-Cancer Foundation of the Universities of South Australia.
| FOOTNOTES |
|---|
+ To whom correspondence should be addressed at: Department of Cytogenetics and Molecular Genetics, Womens and Childrens Hospital, Adelaide, South Australia 5006, Australia. Tel: +61 8 8204 7111; Fax: +61 8 8204 7342; Email: rrichard@medicine.adelaide.edu.au
| REFERENCES |
|---|
|
|
|---|
1 Yunis, J.J. and Soreng, A.L. (1984) Constitutive fragile sites and cancer. Science, 226, 11991204.
2 Sutherland, G.R. and Richards, R.I. (1995) The molecular basis of fragile sites in human chromosomes. Curr. Opin. Genet. Dev., 5, 323327.[ISI][Medline]
3 Jones, C., Slijepcevic, P., Marsh, S., Baker, E., Langdon, W.Y., Richards, R.I. and Tunnacliffe, A. (1994) Physical linkage of the fragile site FRA11B and a Jacobsen syndrome chromosome deletion breakpoint in 11q23.3. Hum. Mol. Genet., 3, 21232130.
4 Jones, C., Penny, L., Mattina, T., Yu, S., Baker, E., Voullaire, L., Langdon, W.Y., Sutherland, G.R., Richards, R.I. and Tunnacliffe, A. (1995) Association of a chromosome deletion syndrome with a fragile site within the proto-oncogene CBL2. Nature, 376, 145149.[Medline]
5 Ohta, M., Inoue, H., Cotticelli, M.G., Kastury, K., Baffa, R., Palazzo, J., Siprashvilli, Z., Mori, M., McCue, P., Druck, T., Croce, C.M. and Huebner, K. (1996) The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell, 84, 587597.[ISI][Medline]
6 Sozzi, G., Veronese, M.L., Negrini, M., Baffa, R., Cotticelli, M.G., Inoue, H., Tornielli, S., Pilotti, S., De Gregorio, L., Pastorino, U. et al. (1996) The FHIT gene at 3p14.2 is abnormal in lung cancer. Cell, 85, 1726.[ISI][Medline]
7 Engelman, J.A., Zhang, X.L. and Lisanti, M.P. (1998) Genes encoding human caveolin-1 and -2 are co-localized to the D7S522 locus (7q31.1), a known fragile site (FRA7G) that is frequently deleted in human cancers. FEBS Lett., 436, 403410.[ISI][Medline]
8 Huang, H., Qian, C., Jenkins, R.B. and Smith, D.I. (1998) Fish mapping of YAC clones at human chromosomal band 7q31.2: identification of YACs spanning FRA7G within the common region of LOH in breast and prostate cancer. Genes Chromosomes Cancer, 21, 152159.[ISI][Medline]
9 Huang, H., Qian, C., Profit, J., Wilber, K., Jenkins, R.B. and Smith, D.I. (1998) FRA7G extends over a broad region: coincidence of human endogenous retroviral sequences (HERV-H) and small polydispersed circular DNAs (spcDNA) and fragile sites. Oncogene, 16, 23112319.[ISI][Medline]
10 Mangelsdorf, M., Ried, K., Woollatt, E., Dayan, S., Eyre, H., Finnis, M., Hobson, L., Nancarrow, J., Venter, D., Baker, E. and Richards, R.I. (2000) Chromosomal fragile site FRA16D and DNA instability in cancer. Cancer Res., 60, 16831689.
11 Paige, A.J.W., Taylor, K.J., Stewart, A., Sgouros, J., Gabra, H., Smyth, J.F., Porteous, D.J. and Watson, J.E.V. (2000) A 700kb physical map of a region of 16q23.2 homozygously deleted in multiple cancers and spanning the common fragile site FRA16D. Cancer Res., 60, 16901696.
12 Sutherland, G.R., Baker, E. and Richards, R.I. (1998) Fragile sites still breaking. Trends Genet., 14, 501506.[ISI][Medline]
13 Boldog, F., Gemmill, R.M., West, J., Robinson, M., Robinson, L., Li, E., Roche, J., Todd, S., Waggoner, B., Lundstrom, R. et al. (1997) Chromosome 3p14 homozygous deletions and sequence analysis of FRA3B. Hum. Mol. Genet., 6, 193203.
14 Inoue, H., Ishii, H., Alder, H., Snyder, E., Druck, T., Huebner, K. and Croce, C.M. (1997) Sequence of the FRA3B common fragile site: implications for the mechanism of FHIT deletion. Proc. Natl Acad. Sci. USA, 94, 1458414589.
15 Mimori, K., Druck, T., Inoue, H., Alder, H., Berk, L., Mori, M., Huebner, K. and Croce, C.M. (1999) Cancer-specific chromosome alterations in the constitutive fragile region FRA3B. Proc. Natl Acad. Sci. USA, 96, 74567461.
16 Mishmar, D., Rahat, A., Scherer, S.W., Nyakatura, G., Hinzman, B., Kohwi, Y., Mandel-Gutfroind, Y., Lee, J.R., Drescher, B., Sas, D.E., Margalit, H., Platzer, M., Weiss, A., Tsui, L.-C., Rosenthal, A. and Kerem, B. (1998) Molecular characterisation of a common fragile site (FRA7H) on human chromosome 7 by the cloning of an SV40 integration site. Proc. Natl Acad. Sci. USA, 95, 81418146.
17 Knight, S.J.L., Flannery, A.V., Hirst, M.C., Campbell, L., Christodoulou, Z., Phelps, S.R., Pointon, J., Middleton-Price, H.R., Barnicoat, A., Pembrey, M.E. et al. (1993) Trinucleotide repeat amplification and hypermethylation of a CpG island in FRAXE mental retardation. Cell, 74, 127134.[ISI][Medline]
18 Gnarra, J.R., Tory, K., Weng, Y., Schmidt, L., Wei, M.H., Li, H., Latif, F., Liu, S., Chen, F., Duh, F.M. et al. (1994) Mutations in the VHL tumour suppressor gene in renal carcinoma. Nature Genet., 7, 8590.[ISI][Medline]
19 Siprashvilli, Z., Sozzi, G., Barnes, L.D., McCue, P., Robinson, A.K., Eryomin, V., Sard, L., Tagliabue, E., Greco, A., Fusetti, L. et al. (1997) Replacement of Fhit in cancer cells suppresses tumorigenicity. Proc. Natl Acad. Sci. USA, 94, 1377113776.
20 Huebner, K., Garrison, P.N., Barnes, L.D. and Croce, C.M. (1998) The role of the FHIT/FRA3B locus in cancer. Annu. Rev. Genet., 32, 731.[ISI][Medline]
21 Le Beau, M.M., Drabkin, H., Glover, T.W., Gemmill, R., Rassool, F.V., McKeithen, T.W. and Smith, D.I. (1998) An FHIT tumour suppressor gene? Genes Chromosomes Cancer, 21, 281289.[ISI][Medline]
22 Galbiati, F., Volonte, D., Engelman, J.A., Watanabe, G., Burk, R., Pestell, R.G. and Lisanti, M.P. (1998) Targeted downregulation of caveolin-1 is sufficient to drive cell transformation and hyperactivate the p42/44 MAP kinase cascade. EMBO J., 17, 66336648.[ISI][Medline]
23 Chesi, M., Bergsagel, P.L., Shonukan, O.O., Martelli, M.L., Brents, L.A., Chen, T., Schrok, E., Ried, T. and Kuehl, W.M. (1998) Frequent dysregulation of the c-MAF proto-oncogene at 16q23 by translocation to an Ig locus in multiple myeloma. Blood, 91, 44574463.
24 Hansen, R.S., Canfield, T.K., Field, A.D., Mumm, S., Laird, C.D. and Gartler, S.M. (1997) A variable domain of delayed replication in FRAXA fragile X chromosomes: X inactivation-like spread of late replication. Proc. Natl Acad. Sci. USA, 94, 45874592.
25 Subramanian, P.S., Nelson, D.L. and Chinault, A.C. (1996) Large domains of apparent delayed replication timing associated with triplet repeat expansion at FRAXA and FRAXE. Am. J. Hum. Genet., 59, 407416.[ISI][Medline]
26 Le Beau, M.M., Rassool, F.V., Neilly, M.E., Espinosa III, R., Glover, T.W., Smith, D.I. and McKeithan, T.W (1998) Replication of a common fragile site, FRA3B, occurs late in S phase and is delayed further upon induction: implications for the mechanism of fragile site induction. Hum. Mol. Genet., 7, 755761.
27 Pirozzi, G., McConnell, S.J., Uveges, A.J., Carter, J.M., Sparks, A.B., Kay, B.K. and Fowlkes, D.M. (1997) Identification of novel human WW domain-containing proteins by cloning of ligand targets. J. Biol. Chem., 272, 1461114616.
28 Latil, A., Cussenot, O., Fournier, G., Driouch, K. and Lidereau, R. (1997) Loss of heterozygosity at chromosome 16q in prostate adenocarcinoma: identification of three independent regions. Cancer Res., 57, 10581062.
29 Chen, T., Sahin, A. and Aldaz, C.M. (1996) Deletion mapping of chromosome 16q in ductal carcinoma in situ of the breast: refining a putative tumor suppressor gene region. Cancer Res., 56, 56055609.
30 Smit, A. (1996) The origin of interspersed repeats in the human genome. Curr. Opin. Genet. Dev., 6, 743748.[ISI][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R. I. Aqeilan, M. Q. Hassan, A. de Bruin, J. P. Hagan, S. Volinia, T. Palumbo, S. Hussain, S.-H. Lee, T. Gaur, G. S. Stein, et al. The WWOX Tumor Suppressor Is Essential for Postnatal Survival and Normal Bone Metabolism J. Biol. Chem., August 1, 2008; 283(31): 21629 - 21639. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Durkin, R. L. Ragland, M. F. Arlt, J. G. Mulle, S. T. Warren, and T. W. Glover Replication stress induces tumor-like microdeletions in FHIT/FRA3B PNAS, January 8, 2008; 105(1): 246 - 251. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Jenner, P. E. Leone, B. A. Walker, F. M. Ross, D. C. Johnson, D. Gonzalez, L. Chiecchio, E. Dachs Cabanas, G. Paolo Dagrada, M. Nightingale, et al. Gene mapping and expression analysis of 16q loss of heterozygosity identifies WWOX and CYLD as being important in determining clinical outcome in multiple myeloma Blood, November 1, 2007; 110(9): 3291 - 3300. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Debacker and R.F. Kooy Fragile sites and human disease Hum. Mol. Genet., October 15, 2007; 16(R2): R150 - R158. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. I. Aqeilan, J. P. Hagan, H. A. Aqeilan, F. Pichiorri, L. Y.Y. Fong, and C. M. Croce Inactivation of the Wwox Gene Accelerates Forestomach Tumor Progression In vivo Cancer Res., June 15, 2007; 67(12): 5606 - 5610. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kurahashi, H. Inagaki, E. Hosoba, T. Kato, T. Ohye, H. Kogo, and B. S. Emanuel Molecular cloning of a translocation breakpoint hotspot in 22q11 Genome Res., April 1, 2007; 17(4): 461 - 469. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. I. Aqeilan, F. Trapasso, S. Hussain, S. Costinean, D. Marshall, Y. Pekarsky, J. P. Hagan, N. Zanesi, M. Kaou, G. S. Stein, et al. Targeted deletion of Wwox reveals a tumor suppressor function PNAS, March 6, 2007; 104(10): 3949 - 3954. [Abstract] [Full Text] [PDF] |











