Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (45)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lonka, L.
Right arrow Articles by Lehesjoki, A.-E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lonka, L.
Right arrow Articles by Lehesjoki, A.-E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2000, Vol. 9, No. 11 1691-1697
© 2000 Oxford University Press

The neuronal ceroid lipofuscinosis CLN8 membrane protein is a resident of the endoplasmic reticulum

Liina Lonka1,2, Aija Kyttälä3, Susanna Ranta1,2, Anu Jalanko3,+ and Anna-Elina Lehesjoki1,2

1Department of Molecular Genetics, Folkhälsan Institute of Genetics, 00280 Helsinki, Finland, 2Department of Medical Genetics, Haartman Institute, University of Helsinki, 00014 Helsinki, Finland and 3National Public Health Institute, Department of Human Molecular Genetics, Mannerheimintie 166, 00300 Helsinki, Finland

Received 29 March 2000; Revised and Accepted 5 May 2000.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Progressive epilepsy with mental retardation (EPMR) is a new member of the neuronal ceroid lipofuscinoses (NCLs). The CLN8 gene underlying EPMR was recently identified. It encodes a novel 286 amino acid transmembrane protein that contains an endoplasmic reticulum (ER)-retrieval signal (KKRP) in its C-terminus. A homozygous mutation in the orthologous mouse gene (Cln8) underlies the phenotype of a naturally occurring NCL model, the motor neuron degeneration mouse (mnd). To characterize the product of the CLN8 gene and to determine its intracellular localization, we expressed CLN8 cDNA in BHK, HeLa and CHO cell lines. In western blotting and pulse–chase analyses an ~33 kDa protein that does not undergo proteolytic processing steps was detected. Using CLN8 and cell organelle specific antibodies with confocal immunofluorescence microscopy the CLN8 protein was shown to localize in the ER. Partial localization to the ER–Golgi intermediate compartment (ERGIC) was also observed. The ER–ERGIC localization was not altered in the CLN8 protein representing the EPMR mutation. However, mnd mutant protein was only found in the ER. Mutations in the ER retrieval signal KKRP resulted in localization of CLN8 to the Golgi apparatus. Taken together, these data strongly suggest that CLN8 is an ER resident protein that recycles between ER and ERGIC.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The neuronal ceroid lipofuscinoses (NCLs) comprise a group of inherited neurodegenerative disorders characterized by psychomotor deterioration, visual failure and the accumulation of autofluorescent lipopigment in many cell types, notably in neurons (1). The NCLs are clinically and genetically heterogeneous and several subtypes have been recognized based on the age of onset, clinical phenotype and ultrastructural characterization of the storage material (1,2). During the last few years, significant progress has been made in elucidating their molecular background. At least eight genes underlie the NCLs, five of which have been cloned (37). Two of the NCL proteins are lysosomal enzymes and one is likely to be a lysosomal membrane protein (4,5,8), suggesting that the basic defect in the NCLs is associated with lysosomal function (9).

Progressive epilepsy with mental retardation (EPMR, MIM 600143), also called Northern epilepsy, was recently identified as one of the NCLs by demonstration of autofluorescent intracytoplasmic storage material in most neurons in the central nervous system. By electron microscopy the storage material showed curvilinear-like profiles and granular material, and it consisted mostly of subunit c of the mitochondrial ATP synthase (10). Clinically, EPMR is characterized by generalized seizures with onset at the age of 5–10 years and subsequent progressive mental retardation (11). So far, EPMR has only been described in a large pedigree originating from a small rural region in northern Finland.

The CLN8 gene underlying EPMR was recently identified by a positional cloning strategy (7). It encodes a novel protein of predicted 286 amino acids (aa) and an estimated molecular weight of 30 kDa. Based on hydrophobicity characteristics, CLN8 is likely to be a membrane protein with several transmembrane domains, but its localization within the cell could not be predicted. EPMR patients are homozygous due to a missense mutation resulting in an arginine to glycine substitution in codon 24 located at the border of the first putative transmembrane domain. The hydrophobicity predictions are not significantly altered as a result of this missense change. A homozygous mutation in the orthologous mouse gene (Cln8) underlies the phenotype of a naturally occurring NCL model, the motor neuron degeneration (mnd) mouse (7,12,13). The mnd mutation, a 1 bp insertion in codon 90, predicts a frameshift and a truncated protein. The human EPMR and mouse mnd phenotypes differ considerably, possibly reflecting the difference in the nature of the underlying mutations. Moreover, as the clinical phenotype of mnd is known to depend on the genetic background (14) the different phenotypes in man and mouse may also be due to the presence of modifier genes.

In this study, we have used transiently and stable transfected cells to characterize the CLN8 gene product and to study its intracellular localization. We show that the human wild-type CLN8 protein is a polypeptide of ~33 kDa that localizes to the endoplasmic reticulum (ER) and to the ER–Golgi intermediate compartment (ERGIC) implying that it is an ER resident protein with a novel function distinct from the lysosomal NCL proteins previously identified


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The CLN8 gene product is an ~33 kDa protein that does not undergo proteolytic processing steps
To characterize the product of the CLN8 gene, COS-1 cells were transiently transfected with a SvPoly-CLN8 construct and the expressed polypeptide was analyzed by western blot. The CLN8 polypeptide was immunologically detected with a polyclonal peptide antibody (391/CLN8) recognizing the C-terminus of CLN8. Compatible with predictions from the amino acid sequence encoded by the CLN8 gene, one CLN8- specific band of ~33 kDa, that was absent in non-transfected cells, was detected (Fig. 1A).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. (A) Western blot analysis of the CLN8 polypeptide using the polyclonal 391/CLN8 peptide antibody. Polypeptides from COS-1 cells transfected with the SvPoly-CLN8 construct (CLN8) and non-transfected COS-1 cells as a control (C) were resolved on 14 % SDS–PAGE. The molecular weights of the low range marker (BioRad) are indicated on the left. (B) Pulse–chase analysis of the CLN8 polypeptide expressed in COS-1 cells. Cells were transiently transfected with the SvPoly-CLN8-FLAG construct, pulse labelled with [35S]cysteine and [35S]methionine for 1 h and chased for 0, 1, 3, 6 or 24 h. The polypeptide was immunoprecipitated, resolved on 14% SDS–PAGE and visualized by fluorography. The molecular weights of the low range marker (BioRad) are indicated on the left. EndoH treated cells were chased for 3 and 6 h. C denotes the non-transfected COS-1 cells as a control.

 
To ensure the detection of possible N-terminal processing, a CLN8 polypeptide with an N-terminal FLAG-epitope tag was also expressed and analyzed. In pulse–chase analysis the size of the CLN8-FLAG polypeptide corresponded approximately to the size of the wild-type CLN8 in every chase, suggesting that the protein is not being processed during its maturation (Fig. 1B). The computer motif analysis of the CLN8 polypeptide predicts one potential N-glycosylation site (NATY) at aa 50–53. To analyze the possibility of N-linked glycosylation of CLN8 in transfected cells, the immunoprecipited protein from chases 1 h and 3 h were also treated with endoglycosidase H (EndoH). The migration of the CLN8-FLAG polypeptide in SDS–PAGE remained unchanged despite the EndoH treatment, indicating that N-glycosylation is not likely to occur in the CLN8 polypeptide (Fig. 1B).

The CLN8 protein localizes to ER and partially to ERGIC
The main goal of this study was to determine the intracellular localization of the CLN8 protein. For this purpose, indirect immunofluorescence analysis and confocal microscopy were performed. Transiently transfected BHK and HeLa cells, as well as stable transfected CHO-CLN8 cells were labelled with the 391/CLN8 peptide antibody and three different markers for subcellular compartments: anti-PDI (protein disulphide isomerase) for ER, anti-CTR433 for Golgi and anti-Lamp1 for lysosomes and late endosomes (Fig. 2). HeLa cells were also labelled with anti-ERGIC-53, a marker for ERGIC (Fig. 2). Immunostaining for the recombinant CLN8 protein revealed a reticular labelling pattern typical of ER. Strong co-localization of CLN8 with PDI was detected in all cell types, whereas no notable co-localization with either Golgi or the late endosomes/lysosomes was observed. CLN8 co-localized partly with ERGIC-53, but complete overlap was not observed. These findings imply that not only does the CLN8 protein reside in the ER, but that it also recycles between the ER and the ERGIC.



View larger version (79K):
[in this window]
[in a new window]
 
Figure 2. Distribution of the wild-type CLN8 protein in transiently transfected BHK cells (AF), transiently transfected HeLa cells (GL) and stable transfected CHO cells (MO). Double immunofluorescence staining of the CLN8 protein (red in A, D, G, J, M and C, F, I, L, O) with endoplasmic reticulum (green in B, N and C, O), Golgi (green in E and F), lysosomes and late endosomes (green in H and I) or ERGIC (green in K and L) using the following antibodies:391/CLN8 for CLN8 (CLN8), anti-PDI for endoplasmic reticulum (ER), anti-CTR433 for Golgi (Golgi), anti-Lamp1 for lysosomes–late endosomes (Lyso), and anti-ERGIC-53 for ERGIC. Yellow indicates an overlap of the CLN8 protein (red) and subcellular markers (green) (C, F, I, L, O). Scalebar = 8 µm.

 
The CLN8 protein has a functional ER-retrieval signal KKRP
As the first immunofluorescence studies suggested a localization of CLN8 in ER and partially in ERGIC, potential transport and retention signals from the primary sequence were sought. The CLN8 polypeptide was found to contain an ER-retrieval signal KKRP in the C-terminus (aa 283–286). The two lysines in the KKXX motif are known to be critical for Golgi-to-ER retrieval (15) and for coat protein I (COPI) coatomer binding (16). To assess the function of the KKRP signal in the CLN8 protein, two cDNA constructs were prepared with site-directed mutagenesis: in one construct (K283R/K284R) both lysines were replaced with arginines, and in the other (K283S) the first lysine was replaced with serine. The subcellular localization of these two mutant CLN8 polypeptides was analyzed in transiently transfected BHK cells (Fig. 3). In cells transfected with the K283R/K284R construct, the CLN8 protein was found to co-localize almost entirely with marker CTR433 indicating the Golgi complex. The K283S construct protein co-localized partly with marker CTR433 in the Golgi and partly with marker PDI in the ER. These data strongly suggest that the KKRP motif of the CLN8 polypeptide functions as an ER-retrieval signal and they further strengthen the hypothesis that CLN8 is an ER resident that recycles between the ER and the ERGIC.



View larger version (75K):
[in this window]
[in a new window]
 
Figure 3. Subcellular localization of the two mutated CLN8 proteins CLN8(K283R/K284R) and CLN8(K283S) in transiently transfected BHK cells. Double immunofluorescence staining of the CLN8(K283R/K284R) protein (red in A, D and C, F) or the CLN8(K283S) protein (red in G, J and I, L) with endoplasmic reticulum (green in B, H and C, I) or Golgi (green in E, K and F, L) using the following antibodies: 391/CLN8 for the mutated CLN8 proteins, anti-PDI for ER (ER), and anti-CTR433 for Golgi (Golgi). Yellow indicates an overlap of the mutated CLN8 protein (red) and subcellular markers (green). Scalebar = 10 µm

 
Intracellular localization of mutated human CLN8 representing the EPMR and mnd mutations
To determine the intracellular localization of altered forms of the CLN8 protein, BHK cells (Fig. 4) and HeLa cells (data not shown) were transfected with constructs SvPoly-CLN8(R24G) and SvPoly-CLN8(267–268insC)-FLAG representing mutations found in human EPMR and mouse mnd, respectively. In the latter construct, a FLAG-epitope tag was added to the N-terminus, as the mutation corresponding to the mnd mutation predicts a truncated protein, which would not be detectable with the C-terminal 391/CLN8 peptide antibody. In the experiments using the FLAG construct the BHK cells were double transfected with SvPoly-CLN8 and SvPoly-CLN8 (267–268 insC)-FLAG and double labelled with the CLN8/391 and anti-FLAG antibodies. Both wild-type CLN8 and the truncated CLN8(267–268insC) protein co-localized to the ER. The CLN8(R24G) protein was detected in the ER and also in the ERGIC (data not shown). These data indicate that the primary defect in EPMR results in disturbed functional properties of the protein other than disturbed trafficking within ER–ERGIC, whereas in mnd the trafficking is also defective.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 4. Subcellular localization of altered forms of the CLN8 protein resulting from mutations found in human EPMR [CLN8(R24G)] and mouse mnd [CLN8(267–268insC)] in transiently transfected BHK cells. (A and B)Double immunofluorescence staining of the CLN8(R24G) protein using 391/CLN8 with either the ER proteins using anti-PDI (A) or the Golgi proteins using anti-CTR433 (B). Double immunofluorescence staining of the CLN8(267–268insC) protein using anti-FLAG M2Ab (green in C and D) with the CLN8 protein using 391/CLN8 (red in D). Scalebar = 8 µm

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
EPMR is a new member of the NCL group of disorders for which five genes have now been identified. Previously, a lysosomal localization for three NCL protein has been suggested. The CLN1 gene defective in infantile NCL, encodes palmitoyl protein thioesterase (PPT) (4), a lysosomal enzyme which removes palmitate residues from various S-acetylated proteins in vitro (1719). The CLN2 gene for classical late infantile NCL encodes tripeptidyl peptidase 1 (TPP1), a lysosomal enzyme that processively removes tripeptides from the N-terminus of polypeptides (5,20,21). The CLN3 gene for juvenile NCL encodes a novel membrane protein of unknown function (3). Available evidence from cell biological studies suggest lysosomes/endosomes as the most likely localization for CLN3 (8,22), although other localizations have also been documented (23). The CLN5 gene for the Finnish variant late NCL encodes a novel transmembrane protein with unknown cellular localization (6). In the present study we show evidence for a localization of CLN8, the third NCL membrane protein, in the ER and the ERGIC, the earliest compartments of the secretory pathway.

Evidence for ER and ERGIC localization for CLN8 was initially obtained by transient expressions in BHK and HeLa cells. As overexpression of a cDNA in cell lines may disturb intracellular transport and block the membrane traffic out of the ER, we also studied CLN8 expression in stable transfected CHO-CLN8 cells. In these, the localization coincided with ER, in addition to showing partial co-localization with ERGIC. Confidence in these observations is strengthened by their reliance on co-localization with cell organelle specific markers rather than morphological criteria alone. Moreover, the data are based on peptide antibodies to CLN8 rather than identification of fluorescent FLAG fusion proteins that may affect the targeting and processing of the protein, giving further support to our conclusions.

Mutated CLN8 protein representing the human EPMR mutation (R24G) showed no deviation from the wild-type protein. Therefore the primary defect of this mutated protein is likely to be due to disturbed functional properties other than trafficking of CLN8 between ER and ERGIC (see below). The amino acid altered by the EPMR mutation is located at the border of the first transmembrane domain, but it does not result in significantly altered hydrophobicity characteristics (7). The mutated CLN8 protein representing the mouse mnd mutation (267–268insC) that predicts a truncated polypeptide of 117 aa was only detected in ER. Such a severe truncation is likely to result in misfolding and rapid degradation of the mutant protein after its synthesis in the rough ER.

Coatomer-coated vesicles are known to play an essential role in many steps of intracellular transport. Anterograde vesicle transport from ER to Golgi has been shown to require coat protein II (COPII) coatomer (24,25), and retrograde vesicles delivering cargo from the cis Golgi to the ER coat protein I (COPI) coatomer (26). Available evidence implicates COPI in the recognition of the dilysine ER-retrieval signal in the KKXX motif, as membrane proteins with the cytosolic dilysine signal have been shown to bind COPI (16,27). The two lysines occur either at positions –2 and –4 or –2 and –5 from the C-terminus of the polypeptide exposed to the cytosolic side of the ER membrane (15). This dilysine signal confers ER-localization by mediating transfer of proteins back from post-ER compartments of the early secretory pathway. In addition to retrieval, it has also been suggested to operate in ER-retention (28). The substitution of lysines with arginines or histidines in the KKXX motif has been shown to lead to loss of ER localization as well as loss of COPI binding (16), whereas their substitution with serines significantly reduces COPI binding (29). Not surprisingly, the CLN8 protein in which both lysines of the KKRP motif were changed to arginines lost its capacity for ER-retrieval almost entirely and was mostly localized in the Golgi complex. When only the first lysine of KKRP was substituted with serine, the protein partially lost its ability to return to the ER and was localized in both ER and Golgi indicating partly operating ER-retrieval and/or retention. Some ER proteins have a C-terminal cytoplasmic di-phenylalanine motif that mediates COPII binding (25). This motif does not exist in CLN8. However, this does not preclude a role for CLN8 in anterograde transport mediated by an as yet unidentified signal. These data combined with the co-localization data strongly suggest that CLN8 is primarily a resident of ER and that it recycles between ER and ERGIC through the KKRP/COPI ER-retrieval signal mediated mechanism, characteristic for several ER resident membrane proteins. Whether the purpose of this ER-retrieval is merely transfer of CLN8 back from ERGIC, or whether CLN8 performs a specific function en route to the ER remains unknown.

The present study does not suggest a specific function for CLN8. However, given that CLN8 is an ER resident, several putative functions can be proposed. Resident ER proteins have been implicated in a variety of roles such as aiding translocation or dislocation of proteins across the ER membrane as well as folding, assembling and targeting of proteins destined for other cellular compartments. As CLN8 is a membrane protein with several putative transmembrane domains, it may participate in channel formation, consequently having a role in the transfer of proteins across or integration of newly synthesized proteins in the ER membrane. Moreover, CLN8 may act as an accessory protein that mediates the secretion of proteins from ER by interacting with and facilitating the uptake of specific protein(s) into transport vesicles destined for the Golgi apparatus. Several examples of such proteins have recently been identified and characterized (30). Interestingly, two accessory proteins, primarily localized in the ERGIC but also found in the ER, ERGIC-53 and presenilin 1 (3133), have been implicated in human disease. ERGIC-53 gene mutations have been shown to be responsible for the primary defect in an autosomal recessive bleeding disorder, combined deficiency of coagulation factors V and VIII, suggesting that the lectin ERGIC-53 is required for efficient secretion of these coagulation factors (34). ERGIC-53 may act as a transport receptor to these and other glycoproteins (31). Presenilin 1 was recently suggested to be a membrane receptor for rab GDP dissociation inhibitor, a regulatory factor in vesicle transport (35), implicating membrane transport as a key factor in the pathogenesis of Alzheimer’s disease. Moreover, disturbed ER processing of aberrant cargo and subsequent accumulation of proteins in the ER has been linked to the pathophysiology of several diseases (36).

Interestingly, our data on CLN8 suggest that NCLs may be caused not only by defects in lysosomal proteins but also by impaired function of proteins localized in the early secretory pathway. Whether the localization of NCL proteins in successive compartments of the secretory pathway reflects a common function remains to be examined. At present, there is no unifying hypothesis to explain the molecular mechanisms leading from defects in the spectrum of NCL proteins to a relatively uniform cellular phenotype. Clearly, intracellular membrane transport and the identification of specific proteins that CLN8 may interact with will be the key issues in revealing the molecular pathogenesis of EPMR.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction of expression plasmids
The coding region of the CLN8 cDNA (GenBank accession no. AF123757) was PCR amplified from reverse transcribed human lymphoblastoid total RNA (primers 3'-CATGTGAAGCTTATGAATCCTGCGAGCGATGGGG-5' and 5'-ACCATGGAATTCCTATGGCCTCTTTTCCGCAG-3'), cleaved with restriction enzymes HindIII and EcoRI (BioLab Albany, Auckland, New Zealand) and ligated into an SvPoly expression vector (37) cleaved with the same restriction enzymes. The insert was sequenced with an ABI 373 or ABI 377 sequencer using Dye Terminator Kit or Big Dye Terminator Kit (PE Applied Biosystems, Warrington, UK) according to the manufacturer’s instructions.

Site directed mutagenesis
Five different mutations were introduced into the wild-type SvPoly-CLN8 construct (see above) sequence with site directed mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). (i) A FLAG-epitope tag (GACTACAAGGACGACGATGACAAG) was inserted between aa 1 and 2 in the N-terminus of CLN8 (SvPoly-CLN8-FLAG). (ii) Both lysines of the KKRP motif (aa 283–284) were substituted with arginines [(SvPoly-CLN8(K283R/K284R)]. (iii) The first lysine of the KKRP motif (aa 283) was substituted with serine [SvPoly-CLN8(K283S)]. (iv) The human EPMR 70C->G mutation [(SvPoly-CLN8(R24G)] was constructed. (v) The mnd mouse 267–268insC mutation was constructed and a FLAG-epitope tag was inserted between aa 1 and 2 in N-terminus [SvPoly-CLN8(267–268insC)-FLAG]. The sequences of the mutation constructs were verified using ABI chemistry as described above.

Cell culture and transfection
COS-1, HeLa and BHK cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum (FCS) and antibiotics. For transfection, the cells were seeded on 3 cm plates at a density of 250 000 cells (BHK) and 300 000 cells (COS-1 and HeLa) per well. BHK cells were seeded on coverslips and HeLa cells were plated on coverslips on the day following the transfection. The cells were transfected with 1.6 µg of the wild type CLN8 and mutant constructs per well using the Fugene transfection method (Boehringer Mannheim, Mannheim, Germany) as suggested by the manufacturer. All cells were prepared for analysis 48 h after transfection.

For the generation of the stable CHO-CLN8 cell line, CHO dhFr cells (ATCC CRL-9096) were grown on 10 cm plates overnight to 50% confluency in Iscove’s Modified Dulbecco's Medium (IMDM) supplemented with 100 µM hypoxanthine and 10 µM thymidine, 10% FCS and antibiotics. The cells were transfected with 8 µg of the CLN8-SvPoly construct and 0.8 µg of pMMTV-dhfr using the Fugene-transfection method (38). The transfected cells were selected with IMDM medium without hypoxanthine and thymidine. Resistant cell clones were isolated and assayed for the CLN8 polypeptide in immunofluorescence assay. The stable CHO cell line was cultured in IMDM.

Antibodies
A polyclonal antibody against human CLN8 (391/CLN8) was produced by immunizing rabbits with a synthetic polypeptide (PEAKSRPEGNGQLLRKKRP) corresponding to aa 268–286, a predicted hydrophilic region of the CLN8 polypeptide. One cysteine residue was added to the N-terminus of the peptide and it was coupled to keyhole limpet hemocyanin (KLH) using 3-maleimidobenzoic acid N-hydroxysuccinimide ester (MBS) as a coupling reagent. The immunization and antiserum purification were done at Genosys (Cambridge, UK). The 391/CLN8 antibody did not detect native protein in the western blot analysis or in the immunofluorescence analysis of cultured non-transfected cells. For double immunostainings, 391/CLN8 (1:500) was combined with a monoclonal ER antibody anti-PDI (1:200; StressGen Biotechnologies, Victoria, Canada), a monoclonal Golgi antibody anti-CTR433 (1:10; a gift from Michel Bornens, Institut CURIE, Paris), a monoclonal lysosome antibody anti-LAMP-1 (1:50; a gift from J.T. August and J.E.K. Hildreth, Johns Hopkins University School of Medicine, Baltimore, MD), or a monoclonal ERGIC protein anti-ERGIC-53 antibody (1:1000, a gift from H.P. Hauri, Department of Pharmacology, Biozentrum, University of Basel, Basel, Switzerland). A monoclonal FLAG antibody anti-FLAG M2Ab (1:500; Eastman Kodak Company, Rochester, NY) was used to detect the N-terminus of the CLN8-FLAG protein. Secondary antibodies used in immunofluorescence microscopy were tetramethylrhodamine isothiocyanate (TRITC)-conjugated goat anti-rabbit IgG (1:200) and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (1:200) (Jackson’s Immunoresearch Laboratories, Bar Harbor, ME).

Western analysis
For western blot analysis, COS-1 cells on 3 cm plates were transfected, trypsinized and resuspended in 130 µl Laemmli buffer (39). 25 µl of the samples were run on 14% SDS–PAGE and transferred to a nitrocellulose membrane (Hybond-C Extra; Amersham International, Little Chalfont, UK) by electro­blotting on ice at 400 mA for 1 h. 2 µl of BioRad Prestained SDS–PAGE Standard Low Range (BioRad, Richmond, CA) was used as a molecular weight marker. The filter was immunostained with 391/CLN8 (1:200) and anti-rabbit IgG-AP (1:7500) (Promega, Madison, WI). The bands were visualized by ProtoBlot NBT and BCIP Color Development System (Promega).

Pulse labelling and immunoprecipitation
COS-1 cells transfected with the CLN8-SvPoly-FLAG construct were starved in cysteine- and methionine-free DMEM with antibiotics for 30 min. After starvation, the cells were labelled with a mixture of 100 µCi/ml of [35S]cysteine and 100 µCi/ml of [35S]methionine (Amersham) in cysteine- and methionine-free DMEM with antibiotics for 1 h. The media was then substituted to DMEM with antibiotics. The cells were harvested by trypsinization in chases 0 h, 1 h, 3 h, 6 h and overnight and lysed for 20 min on ice with RIPA-buffer [50 mM Tris pH 8.0, 150 mM NaCl, 1% IGEPAL (Sigma, St Louis, MO), 0.5% deoxycholic acid (Sigma), 0.1% SDS] with a complete set of protease inhibitors (Complete; Boehringer-Mannheim, Mannheim, Germany). The samples were centrifuged and the anti-FLAG antibody M2Ab (1:300; Eastman Kodak Company) and 30 µl Protein A/G PLUS-Agarose (Santa Cruz Biotechnology, Heidelberg, Germany) were added to the supernatant. After 24 h incubation at +4°C, the samples were washed three times with cold RIPA-buffer and resuspended in 30 µl of 2 x Laemmli buffer (39). The samples were not boiled before loading. The immunoprecipited polypeptides were separated on 14% SDS–PAGE and visualized by fluorography. The immunoprecipitated protein from the chases 1 h and 3 h were also treated with 0.5 µl of EndoH (Boehringer-Mannheim).

Confocal microscopy
For morphological studies, the transfected cells were seeded on coverslips and grown to 50–60% confluency. They were fixed in 4% paraformaldehyde (PFA), pH 7.4, and permeabilized with phosphate buffered saline containing 0.5% bovine serum albumin (Sigma) and 0.05 % saponin (Sigma). Antibodies 391/CLN8 (1:500), anti-PDI (1:200), anti-CTR 433 (1:10), anti-Lamp1 (1:50), anti-ERGIC-53 (1:1000) and anti-FLAG M2Ab (1:500) were used as the primary antibodies. The cells were stained with 1:200 dilutions of secondary antibodies: TRITC-conjugated goat anti-rabbit IgG and FITC-conjugated goat anti-mouse IgG (Jackson’s Immunoresearch Laboratories). Specimens were viewed with 63 objective in a Leica DMR confocal microscope (Leica, Depew, NY) with TCS NT software.


    ACKNOWLEDGEMENTS
 
We thank A. Nyberg, A. Santanen and P. Hakala for technical assistance and O. Heinonen for much helpful advice. We are grateful to M. Bornens, J.T. August, J.E.K. Hildreth and H.P. Hauri for the antibodies. This study was supported by The Academy of Finland, The Ulla Hjelt Foundation and The Finnish State Grant TYH8310.


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +358 9 47448392; Fax: +358 9 47448480; Email: anu.jalanko@ktl.fi Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Santavuori, P. (1998) Neuronal ceroid-lipofuscinosis in childhood. Brain Dev., 10, 80–83.

2 Mole, S.E. (1998) Batten disease: four genes and still counting. Neurobiol. Dis., 5, 287–303.

3 The international Batten Disease Consortium (1995) Isolation of a novel gene underlying Batten disease, CLN3. Cell, 82, 949–957.[Web of Science][Medline]

4 Vesa, J., Hellsten, E., Verkruyse, L.A., Camp, L.A., Rapola, J., Santavuori, P., Hoffman, S.L. and Peltonen, L. (1995) Mutations in the palmitoyl protein thioesterase gene causing infantile neuronal ceroid lipofuscinosis. Nature, 376, 584–587. [Medline]

5 Sleat, D.E., Donnelly, R.J., Lackland, H., Liu, C.G., Sohar, I., Pullarkat, R.K. and Lobel, P. (1997) Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science, 277, 1802–1805.[Abstract/Free Full Text]

6 Savukoski, M., Klockars, T., Holmberg, V., Santavuori, P., Lander, E.S. and Peltonen, L. (1998) CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nature Genet., 19, 286–288.[Web of Science][Medline]

7 Ranta, S., Yonghui, Z., Ross, B., Lonka, L., Takkunen, E., Messer, A., Sharp, J., Wheeler, R., Kusumi, K., Mole, S. et al. (1999) The neuronal ceroid lipofuscinoses in human EPMR and mnd mutant mice are associated with mutations in CLN8. Nature Genet., 23, 233–236.[Web of Science][Medline]

8 Järvelä, I., Sainio, M., Rantamäki, T., Olkkonen V.M., Carpen, O., Peltonen, L. and Jalanko A. (1998) Biosynthesis and intracellular targeting of the CLN3 protein defective in Batten disease. Hum. Mol. Genet., 7, 85–90.[Abstract/Free Full Text]

9 Mole, S.E., Mitchison, H.M. and Munroe, P.B. (1999) Molecular basis of the neuronal ceroid lipofuscinoses: mutations in CLN1, CLN2, CLN3, and CLN5. Hum. Mutat., 14, 199–215. [Web of Science][Medline]

10 Herva, R., Tyynelä, J., Hirvasniemi, A., Syrjäkallio-Ylitalo, M. and Haltia, M. (2000) Northern epilepsy: a novel form of neuronal ceroid-lipofuscinosis. Brain Pathol., 10, 215–222.[Web of Science][Medline]

11 Hirvasniemi, A., Lang, H., Lehesjoki, A.-E. and Leisti, J. (1994) Northern epilepsy syndrome: an inherited childhood onset epilepsy with associated mental deterioration. J. Med. Genet., 31, 177–182.[Abstract/Free Full Text]

12 Bronson, R.T., Lake, B.D., Cook, S., Taylor, S. and Davisson, M.T. (1993) Motor neuron degeneration of mice is a model of neuronal ceroid lipofuscinosis (Batten’s disease). Ann. Neurol., 33, 381–385.[Web of Science][Medline]

13 Messer, A. and Flaherty, L. (1986) Autosomal dominance in a late-onset motor neuron disease in the mouse. J. Neurogenet., 3, 345–355. [Web of Science][Medline]

14 Messer, A., Plummer, J., MacMillen, M.C. and Frankel, W.N. (1995) Genetics of primary and timing effects in the mnd mouse. Am. J. Med. Genet., 57, 361–364.[Web of Science][Medline]

15 Jackson, M.R., Nilsson, T. and Peterson, P.A. (1990) Identification of a consensus motif for retention of transmembrane proteins in the endoplasmic reticulum. EMBO J., 9, 3153–3162.[Web of Science][Medline]

16 Cosson, P. and Letourneur, F. (1994) Coatomer interaction with di-lysine endoplasmic reticulum retention motifs. Science, 263, 1629–1631.[Abstract/Free Full Text]

17 Hellsten, E., Vesa, J., Olkkonen, V.M., Jalanko, A. and Peltonen, L. (1996) Human palmitoyl protein thioesterase: evidence for lysosomal targeting of the enzyme and disturbed cellular routing in infantile neuronal ceroid lipofuscinosis. EMBO J., 15, 5240–5245.[Web of Science][Medline]

18 Verkruyse, L.A. and Hofmann, S.L. (1996) Lysosomal targeting of palmitoyl-protein thioesterase. J. Biol. Chem., 271, 15831–15836.[Abstract/Free Full Text]

19 Lu, J.Y., Verkruyse, L.A. and Hofmann, S.L. (1996) Lipid thioesters derived from acylated proteins accumulate in infantile neuronal lipofuscinosis: correction of the defect in lymphoblasts by recombinant palmitoyl-protein thioesterase. Proc. Natl. Acad. Sci. USA, 93, 10046–10050.[Abstract/Free Full Text]

20 Vines, D.J. and Warburton, M.J. (1999) Classical late infantile neuronal ceroid lipofuscinosis fibroblasts are deficient in lysosomal tripeptidyl peptidase I. FEBS Lett., 433, 131–135.

21 Rawlings, N.D. and Barrett, A.J. (1999) Tripeptidyl-peptidase I is apparently the CLN2 protein absent in classical late-infantile neuronal ceroid lipofuscinosis. Biochim. Biophys. Acta, 2, 496–500.

22 Järvelä, I., Lehtovirta, M., Tikkanen, R., Kyttälä, A. and Jalanko, A. (1999) Defective intracellular transport of CLN3 is the molecular basis of Batten disease (JNCL). Hum. Mol. Genet., 8, 1091–1098.[Abstract/Free Full Text]

23 Pearce, D.A. (2000) Localization and processing of CLN3, the protein associated to Batten disease: where is it and what does it do? J. Neurosci. Res., 1, 19–23.

24 Barlowe, C., Orci, L., Yeung, T., Hosobuchi, M., Hamamoto, S., Salama, N., Rexach, M.F., Ravazzola, M., Amherdt, M. and Schekman, R. (1994) COPII: a membrane coat formed by sec proteins that drive vesicle budding from the endoplasmic reticulum. Cell, 77, 895–907.[Web of Science][Medline]

25 Barlowe C. (1998) COPII and selective export from the endoplasmic reticulum. Biochim. Biophys. Acta, 1404, 67–76.[Medline]

26 Cosson, P. and Letourneur, F. (1997) Coatomer (COPI)-coated vesicles: role in intracellular transport and protein sorting. Curr. Opin. Cell Biol., 9, 484–487.[Web of Science][Medline]

27 Letourneur, F., Gaynor, E.C., Hennecke, S., Demolliere, C., Duden, R., Emr, S.D., Riezman, H. and Cosson, P. (1994) Coatomer is essential for retrieval of dilysine-tagged proteins to the endoplasmic reticulum. Cell, 79, 1199–1207. [Web of Science][Medline]

28 Andersson, H., Kappeler, F. and Hauri, H.P. (1999) Protein targeting to endoplasmic reticulum by dilysine signals involves direct retention in addition to retrieval. J. Biol. Chem., 274, 15080–15084.[Abstract/Free Full Text]

29 Dominguez, M., Dejgaard, K., Füllekrug, J., Dahan, S., Fazel, A., Paccaud, J.-P., Thomas, D.Y., Bergeron, J.J.M. and Nilsson, T. (1998) gp25L/emp24/p24 protein family members of the cis-Golgi network bind both COP I and II coatomer. J. Cell Biol., 140, 751–765.[Abstract/Free Full Text]

30 Herrmann, J.M., Malkus, P. and Schekman, R. (1999) Out of the ER – outfitters, escorts and guides. Trends Cell Biol., 9, 5–7. [Web of Science][Medline]

31 Hauri, H.-P., Kappeler, F., Andersson, H. and Appenzeller, C. (2000) ERGIC-53 and traffic in the secretory pathway. J. Cell Sci., 113, 587–596.[Abstract]

32 Kovacs, D.M., Fausett, H.J., Page, K.J., Kim, T.-W., Moir, R.D., Merriam, D.E., Hollister, R.D., Hallmark, O.G., Mancini, R., Felsenstein, K.M. et al. (1996) Alzheimer-associated presenilins 1 and 2: Neuronal expression in brain and localization to intracellular membranes in mammalian cells. Nature Med., 2, 224–229.[Web of Science][Medline]

33 Culvenor, J.G., Maher, F., Evin, G., Malchiodi-Albedi, F., Cappai, R., Underwood, J.R., Davis, J.B., Karran, E.H., Roberts, G.W., Beyreuther, K. and Masters, C.L. (1997) Alzheimer’s disease-associated presenilin 1 in neuronal cells: evidence for localization to the endoplasmic reticulum-Golgi intermediate compartment. J. Neurosci. Res., 49, 719–731.[Web of Science][Medline]

34 Nichols, W.C., Seligsohn, U., Zivelin, A., Terry, V.H., Hertel, C.E., Wheatley, M.A., Moussalli, M.J., Hauri, H.P., Ciavarella, N., Kaufman, R.J. and Ginsburg, D. (1998) Mutations in the ER-Golgi intermediate compartment protein ERGIC-53 cause combined deficiency of coagulation factors V and VIII. Cell, 93, 61–70.[Web of Science][Medline]

35 Scheper, W., Zwart, R., van der Sluijs, P., Annaert, W., van Gool, W.A. and Baas, F. (2000) Alzheimer’s presenilin 1 is a putative membrane receptor for rab GDP dissociation inhibitor. Hum. Mol. Genet., 9, 303–310.[Abstract/Free Full Text]

36 Aridor, M. and Balch, W.E. (1999) Integration of endoplasmic reticulum signaling in health and disease. Nature Med., 5, 745–751.[Web of Science][Medline]

37 Stacey, A. and Schnieke, A. (1990) SVpoly: a versatile mammalian expression vector. Nucleic Acids Res., 18, 2829.[Free Full Text]

38 Lee, F., Mulligan, R., Berg, P. and Ringold, G. (1981) Glucocorticoids regulate expression of dihydrofolate reductase cDNA in mouse mammary tumor virus cimeric plasmids. Nature, 294, 228–232.[Medline]

39 Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685.[Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
BrainHome page
M. Kousi, E. Siintola, L. Dvorakova, H. Vlaskova, J. Turnbull, M. Topcu, D. Yuksel, S. Gokben, B. A. Minassian, M. Elleder, et al.
Mutations in CLN7/MFSD8 are a common cause of variant late-infantile neuronal ceroid lipofuscinosis
Brain, March 1, 2009; 132(3): 810 - 819.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
D. Ramirez-Montealegre, P. G Rothberg, and D. A Pearce
Another disorder finds its gene
Brain, June 1, 2006; 129(6): 1353 - 1356.
[Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Gachet, S. Codlin, J. S. Hyams, and S. E. Mole
btn1, the Schizosaccharomyces pombe homologue of the human Batten disease gene CLN3, regulates vacuole homeostasis
J. Cell Sci., December 1, 2005; 118(23): 5525 - 5536.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Heine, B. Koch, S. Storch, A. Kohlschutter, D. N. Palmer, and T. Braulke
Defective Endoplasmic Reticulum-resident Membrane Protein CLN6 Affects Lysosomal Degradation of Endocytosed Arylsulfatase A
J. Biol. Chem., May 21, 2004; 279(21): 22347 - 22352.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Guillas, J. C. Jiang, C. Vionnet, C. Roubaty, D. Uldry, R. Chuard, J. Wang, S. M. Jazwinski, and A. Conzelmann
Human Homologues of LAG1 Reconstitute Acyl-CoA-dependent Ceramide Synthesis in Yeast
J. Biol. Chem., September 26, 2003; 278(39): 37083 - 37091.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. Vesa, M. H. Chin, K. Oelgeschlager, J. Isosomppi, E. C. DellAngelica, A. Jalanko, and L. Peltonen
Neuronal Ceroid Lipofuscinoses Are Connected at Molecular Level: Interaction of CLN5 Protein with CLN2 and CLN3
Mol. Biol. Cell, July 1, 2002; 13(7): 2410 - 2420.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Isosomppi, J. Vesa, A. Jalanko, and L. Peltonen
Lysosomal localization of the neuronal ceroid lipofuscinosis CLN5 protein
Hum. Mol. Genet., April 15, 2002; 11(8): 885 - 891.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Luiro, O. Kopra, M. Lehtovirta, and A. Jalanko
CLN3 protein is targeted to neuronal synapses but excluded from synaptic vesicles: new clues to Batten disease
Hum. Mol. Genet., September 1, 2001; 10(19): 2123 - 2131.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Lehtovirta, A. Kyttala, E.-L. Eskelinen, M. Hess, O. Heinonen, and A. Jalanko
Palmitoyl protein thioesterase (PPT) localizes into synaptosomes and synaptic vesicles in neurons: implications for infantile neuronal ceroid lipofuscinosis (INCL)
Hum. Mol. Genet., January 1, 2001; 10(1): 69 - 75.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (45)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lonka, L.
Right arrow Articles by Lehesjoki, A.-E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lonka, L.
Right arrow Articles by Lehesjoki, A.-E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?