Human Molecular Genetics, 2000, Vol. 9, No. 12 1771-1778
© 2000 Oxford University Press
Cellular and viral splicing factors can modify the splicing pattern of CFTR transcripts carrying splicing mutations
Department of Genetics, Life Sciences Institute, The Hebrew University, Jerusalem 91904, Israel and 1Gesher-Israel Advanced Biotecs, Beit Neqofa 90830, Israel
Received 9 March 2000; Revised and Accepted 24 May 2000.
| ABSTRACT |
|---|
|
|
|---|
Variable levels of aberrantly spliced cystic fibrosis transmembrane conductance regulator (CFTR ) transcripts were suggested to correlate with variable cystic fibrosis (CF) severity. We studied the effect of the cellular splicing factors, hnRNP A1 and ASF/SF2, and their adenoviral analogues, E4-ORF6 and E4-ORF3, that promote exon skipping and/or exon inclusion, on the splicing pattern of the CFTR mutation 3849+10kb C
T and the 5T allele. These mutations can lead to cryptic exon inclusion and exon skipping, respectively. Overexpression of the cellular factors promoted exon skipping of pre-mRNA transcribed from minigenes carrying the mutation (p5T or p3849M). This led to a substantial decrease in the level of correctly spliced mRNA transcribed from p5T and generated correctly spliced mRNA transcribed from p3849M that was not found without overexpression of the factors. The viral factor, E4-ORF3, promoted exon inclusion and led to a substantial increase of the correctly spliced mRNA transcribed from the p5T. The factor, E4-ORF6, activated exon skipping and generated correctly spliced mRNA transcribed from p3849M. Thus, overexpression of alternative splicing factors can modulate the splicing pattern of CFTR alleles carrying splicing mutations. These results are important for understanding the mechanism underlying phenotypic variability in CF and other genetic diseases. | INTRODUCTION |
|---|
|
|
|---|
Cystic fibrosis (CF) is a common severe autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene (1). Several CFTR mutations were found to affect the splicing of CFTR transcripts, leading to the generation of both correctly and aberrantly spliced transcripts. Among these are mutations leading to inclusion of intronic sequences, such as 3849+10kb C
T (2), 1811+1.6kb A
G (3) and Q1291H (4), and mutations leading to the skipping of CFTR exons, such as 1898+5 G
T (5) and the polymorphic alleles at IVS8-Tn site (5T, 7T and 9T alleles) (6). The aberrantly spliced transcripts are translated into a truncated and/or non-functional protein (7).
A wide variability in the level of the aberrantly spliced mRNA transcribed from two of these mutations, the 3849+10kb C
T and the 5T, was found among different individuals (811). The severity of the CF disease also varies among individuals carrying these splicing mutations, ranging from healthy fertile individuals to classic CF presentation (2,1214). An inverse correlation was found between the level of the correctly spliced mRNA and the severity of the disease (911). An inverse correlation between the level of correctly spliced mRNA and disease severity was also found among different organs of the same individual (8,9,15). All these results suggest that the regulation of alternative splice site selection might play an important role in underlying the variable disease severity in CF patients carrying splicing mutations.
Alternative splicing is a major mechanism controlling gene expression. Several factors essential for constitutive splicing were also shown to modulate alternative splicing. This includes the heterogeneous nuclear ribonucleoprotein (hnRNP) family and proteins from the SR family (16). Members of the hnRNP family have an essential role in promoting the use of distal 5' splice sites (1720). In addition, increased levels of hnRNP proteins were shown to promote skipping of alternatively spliced exons. However, more recently hnRNP A1 was also found to promote exon inclusion (21). SR proteins were shown to be involved in different modes of alternative splicing (1618,22,23). Some SR proteins can promote exon inclusion, whereas others promote exon skipping. Interestingly, two of the SR proteins, ASF/SF2 and SRp40, were shown to promote both exon inclusion and exon skipping (18,21,2428). These results suggest that variations in the cellular levels of antagonistic splicing factors, including ASF/SF2 and hnRNP A1 (29,30), can affect different modes of alternative splicing and may be a natural mechanism for tissue-specific or developmental regulation of gene expression.
Alternative splicing is also a major mechanism underlying gene expression of viral genes. There are viruses in which the alternative splicing process is controlled by the host cell splicing machinery, whereas others encode their own splicing factors. Among the latter is adenovirus-2, in which most transcription units encode two or more alternatively spliced mRNAs (31). The relative concentrations of the alternatively spliced viral mRNA are subjected to temporal control and vary during the infectious cycle. The adenovirus-2 genome encodes two proteins that have antagonistic effects on alternatively spliced viral genes (32). These proteins, E4-ORF3 and E4-ORF6, were shown to promote exon inclusion and skipping on viral genes, respectively. Moreover, these viral proteins were shown to promote the splicing pattern of a human chimeric ß-globin pre-mRNA (32).
Many mutations affecting the normal splicing pattern are known to cause human genetic diseases (3337). However, very little is known about the effect of alternative splicing factors on such mutations. Here we analyzed the effect of overexpression of the cellular splicing factors, ASF/SF2 and hnRNP A1, and the viral factors, E4-ORF3 and E4-ORF6, on the splicing pattern of the CFTR mutation 3849+10kb C
T and the 5T, 7T and 9T alleles.
| RESULTS |
|---|
|
|
|---|
Splicing patterns of mRNA transcribed from the 3849+10kb C
T and the poly(T) minigenesThe 3849+10kb C
T mutation creates a partially active 5' splice site in intron 19 of the CFTR gene, which can lead to the insertion of a new 84 bp cryptic exon containing an in-frame stop codon between exons 19 and 20 (2). The minigenes containing the 3849+10kb C
T mutation (p3849M) or the normal sequence (p3849N) (Fig. 1a) were transfected into HeLa and COS-1 cells and were successfully expressed and spliced in these cells (Fig. 1b and Table 1).
|
|
In every experiment all the spliced transcripts from p3849M included the cryptic 84 bp exon (486 bp RTPCR product in Fig. 1b). No correctly spliced transcripts were detected from this minigene as was shown in patients with a severe disease carrying the 3849+10kb C
T mutation. Upon transfection of p3849N all the transcripts were correctly spliced (402 bp RTPCR product in Fig. 1b) , thus, as expected, the 84 bp of this minigene were not recognized as an exon, since there is no 5' donor splice site.
We further studied the splicing regulation of the 5T, 7T and 9T alleles at the polypyrimidine tract of CFTR intron 8. Each of these alleles can lead to the generation of both correctly and aberrantly spliced CFTR transcripts lacking exon 9; moreover, an inverse correlation was found between the level of the aberrantly spliced transcripts and the length of the pyrimidine tract. The minigenes containing the 5T (p5T), 7T (p7T) or the 9T (p9T) (Fig. 2a) alleles were transfected into NIH3T3 and COS-1 cell lines and were successfully expressed and spliced (Fig. 2b and Table 2). All minigenes led to both correctly and aberrantly spliced transcripts. However, the splicing pattern differed among the minigenes (Fig. 2b); the highest level of aberrantly spliced mRNA was found upon transfection of p5T (35 ± 6% in NIH3T3 and 22 ± 5% in COS-1), whereas the lowest level was found for p9T (only 1 ± 1% in NIH3T3 and 5 ± 1% in COS-1). Thus, the level of the aberrantly spliced mRNA transcribed from the minigenes is inversely correlated with the length of the poly(T) as was found in individuals carrying these alleles (6). These results showed that our tissue culture systems are suitable models to study the mechanisms underlying the regulation of alternative splicing of CFTR alleles carrying the 3849+10kb C
T mutation and the poly(T) alleles.
|
|
The effect of the cellular splicing factors, hnRNP A1 and ASF/SF2, on the splicing pattern of the 3849+10kb C
T and the poly(T) minigenesTransient co-transfection of p3849M and a human hnRNP A1 cDNA (pCG-A1) into COS-1 cells resulted in the generation of normal spliced transcripts (12 ± 3% of the total minigene transcripts), which could not be detected without overexpression of hnRNP A1 (Fig. 3a and Table 1). As expected, hnRNP A1 had no effect on the splicing pattern of p3849N and only correctly spliced transcripts were detected. It should be noted that in all our transient co-transfections of p3849N and each of the studied splicing factors, no effect on the splicing pattern of this minigene was observed (all transcripts were normally spliced), as expected from a minigene with the normal sequence. Different amounts (2.5, 5 or 10 µg) of pCG-A1 were used in the co-transfection experiments. The higher amounts of pCG-A1 (5 and 10 µg per 10 cm dish) showed the same effect of generating 12 ± 3% of correctly spliced RNA. Upon co-transfection with 2.5 µg of pCG-A1 per 10 cm dish, no effect was observed, so only aberrantly spliced transcripts were detected (data not shown). However, this lower amount might have had an effect on the splicing pattern, which was too low to be detected above the background level. Thus, in all the experiments 5 µg of pCG-A1 was used for co-transfections.
|
Transient co-transfections of pCG-A1 and p3849M into HeLa cells resulted in a failure to amplify the transfected hnRNP A1 sequences (Table 1). Thus, the effect of this cellular splicing factor on the splicing pattern of the different minigenes in these cells could not be studied. As can be seen in Table 1 the cellular splicing factor, ASF/SF2, had no effect on p3849M in COS-1 and HeLa cells (i.e. only aberrantly spliced transcripts were detected).
Subsequently, the effect of hnRNP A1 and ASF/SF2 on the poly(T) minigenes was studied. As can be seen in Figure 3b and in Table 2, the splicing pattern of the p5T was modulated by hnRNP A1 and ASF/SF2. Both cellular splicing factors promoted exon skipping, resulting in a substantial increase in the level of aberrantly spliced mRNA transcribed from p5T. ASF/SF2 had no effect on p7T and p9T, and hnRNP A1 had no effect on p7T (Table 2). Thus, its effect on p9T was not studied. It should be noted that the majority of the mRNA transcribed from p5T (without overexpression of the splicing factors) was correctly spliced in COS-1 (78 ± 5%) and NIH3T3 (65 ± 6%) cells. Upon overexpression of ASF/SF2 in NIH3T3 cells, the proportion between the aberrantly and correctly spliced transcripts was inverted; thus, the majority (65 ± 10%) of the mRNA became aberrantly spliced (Table 2). The cellular splicing factor hnRNP A1 promoted exon skipping of p5T transcripts in COS-1 cells only. No effect was found in NIH3T3 cells (Table 2).
The effect of different amounts (0.2510 µg) of pCG-A1 on the splicing pattern of p5T in COS-1 cells was studied. As can be seen in Figure 3c there was an increase in the effect upon co-transfection with increased amounts of the pCG-A1. The effect reached a plateau at 5 µg; thus, in all the experiments 5 µg of pCG-A1 was used. We also analyzed the effect of different amounts (0.55 µg) of pCG-SF2 on the splicing pattern of p5T in NIH3T3 cells. The same effect (promotion of exon skipping leading to an increase of 30% in the level of the aberrantly spliced transcripts) was observed upon co-transfection with the different amounts (data not shown).
The effect of the viral splicing factors, E4-ORF6 and E4-ORF3, on the splicing pattern of the CFTR minigenes
We further aimed to study the ability of the adenoviral splicing factors, E4-ORF6 and E4-ORF3, to modulate the splicing pattern of p3849M and the poly(T) minigenes. Overexpression of the adenovirus E4-ORF6 (pCMVE4-ORF6), known to promote exon skipping, resulted in the generation of correctly spliced mRNA transcribed from p3849M, both in COS-1 (9 ± 3%) and HeLa (8 ± 3%) cells (Fig. 4a and Table 1). This skipping effect was similar to the effect of hnRNP A1 on this minigene (Fig. 3a and Table 1).
|
E4-ORF3, which promotes exon inclusion, did not affect the splicing pattern of p3849M in COS-1 and HeLa cells (Table 1). This result was expected, since all the spliced mRNA transcribed from p3849M was aberrantly spliced and already included the cryptic 84 bp exon.
Next we studied the effect of the viral splicing factors on the poly(T) minigenes. Overexpression of E4-ORF3 promoted exon inclusion in p5T, in both NIH3T3 and COS-1 cells and resulted in a substantial decrease in the level of aberrantly spliced transcripts (Fig. 4b and Table 2). Thus, the correctly spliced transcripts reached a very high level, >90% of the total RNA transcribed from p5T (Fig. 4b and Table 2). This inclusion effect on p5T was antagonistic to the skipping effect found with the cellular splicing factors on this minigene (Fig. 3b and Table 2). E4-ORF3 also promoted exon inclusion of mRNA transcribed from p7T (Table 2). Without the splicing factors, the levels of aberrantly spliced mRNA transcribed from p7T were low (5 ± 1% in NIH3T3 and 8 ± 2% in COS-1). These levels were further decreased by E4-ORF3 (to <1 and 4 ± 1%, respectively). E4-ORF3 had no effect on the level of aberrantly spliced mRNA transcribed from p9T (Table 2).
We then analyzed the effect of E4-ORF6 on the splicing pattern of mRNA transcribed from p5T in COS-1 and NIH3T3 cells. In COS-1 cells, no effect on the splicing pattern of p5T was observed. In NIH3T3 cells, different co-transfection experiments resulted in a different effect on the splicing pattern of p5T. In some experiments no effect was observed, whereas in others promotion of either exon inclusion or skipping was observed. No conclusion could be drawn, although the mean level of aberrantly spliced transcripts was 27 ± 11% (Table 2).
The effect of the splicing factors on the splicing pattern of the poly(T) minigenes in human cells expressing the CFTR gene
The relevance and significance of the effect of the splicing factors on the CFTR splicing pattern was further studied in epithelial cell lines expressing the CFTR gene. First we studied the splicing pattern of the p5T in three human epithelial cell lines, from colon (HT29), trachea (IB3) and pancreas (PANC-1). In all the cell lines the transfection of p5T resulted in both correctly and aberrantly spliced transcripts (Table 3). Interestingly, as found for the CFTR non-expressing cell lines, the level of the aberrantly spliced transcripts varied (1330%) among the cell lines.
|
We then studied the effect of the cellular splicing factors on the splicing pattern of p5T. Overexpression of ASF/SF2 and hnRNP A1 led to the promotion of exon skipping and resulted in a substantial increase in the level of aberrantly spliced mRNA in all the analyzed cell lines, with the exception of hnRNP A1 which had no effect in PANC-1 cells (Table 3). We also studied the effect of the viral splicing factor E4-ORF3, which was found to modulate the splicing pattern of p5T in CFTR non-expressing cells. Overexpression of this splicing factor promoted exon inclusion in all the cell lines (Table 3). Thus, as found in CFTR non-expressing cells, the cellular splicing factors ASF/SF2 and hnRNP A1 promoted exon skipping in p5T, whereas the viral splicing factor E4-ORF3 had an antagonistic effect of promoting exon inclusion in this minigene.
We extended our analysis and studied the splicing pattern of p7T and p9T in one of the CFTR expressing cell lines, HT29. An inverse correlation was found between the level of aberrantly spliced transcripts and the length of the poly(T) tract of the minigenes (Table 3). Upon overexpression of the different splicing factors, the splicing pattern of p9T was not modulated, whereas a slight effect was found on p7T with ASF/SF2 and E4-ORF3. These results show that the relative level of aberrantly spliced RNA transcribed from the poly(T) minigenes and the effect of the splicing factors on these minigenes in the CFTR expressing cells were similar to those found in non-expressing cells.
| DISCUSSION |
|---|
|
|
|---|
The CFTR gene consists of 27 exons, which are constitutively spliced to produce a functional CFTR protein (1,38,39). In this study we have shown that overexpression of two of the cellular splicing factors (hnRNP A1 and ASF/SF2) and the adenoviral splicing factors (E4-ORF3 and E4-ORF6) can modulate the splicing pattern of CFTR alleles carrying naturally occurring splicing mutations.
The 3849+10kb C
T mutation was found to be associated with a mild form of CF (2,12). Nevertheless, a marked variability in disease severity is found among patients with this allele, several have a severe pulmonary disease (10,40). In our study, the minigene carrying the 3849+10kb C
T mutation (p3849M) generated only aberrantly spliced transcripts, as was found in respiratory epithelial cells of patients with a severe lung disease (10). Most individuals in the healthy population carry the 7T or the 9T alleles at the IVS8-Tn site, whereas the frequency of the 5T allele is only ~5%. The 5T allele is the most frequent mutation causing congenital bilateral absence of the vas deferens (CBAVD) (3,41). The clinical status of individuals carrying the 5T allele can vary from healthy fertile males to typical phenotype of CF (14). The minigenes carrying the poly(T) alleles showed an inverse correlation (in CFTR expressing and non-expressing cells) between the level of aberrantly spliced mRNA and the length of the thymidine tract, in accordance with observations seen in individuals carrying these alleles (6,8,11,42). Hence, the systems developed in this study might shed light on the mechanism regulating the variable level of correctly spliced transcripts among individuals carrying the 3849+10kb C
T mutation and the poly(T) alleles.
The cellular splicing factors promoted exon skipping of the minigene transcripts carrying the studied splicing mutations. Interestingly, in p3849M, hnRNP A1 promoted a partial suppression of the use of the cryptic 3' and the new 5'splice and led to a partial use of the normal splice sites that were not used without the overexpression of this factor (Fig. 3a and Table 1). In vitro studies have shown that the ability of hnRNP A1 to promote alternative exon skipping depends on the size of the internal alternative exon (requires short exons) and the strength of the polypyrimidine tract in the preceding intron (requires weak tract) (22). Very little is known about the effect of hnRNP A1 on exon skipping as a result of natural mutations causing human genetic diseases. The results of our study showed that the same structural parameters might regulate exon skipping of such mutations by hnRNP A1. The alternative spliced exon in the 3849+10kb C
T CFTR allele is short, only 84 bp, and the preceding polypyrimidine tract is very weak, only 4 bp. Thus, hnRNP A1 could promote correctly spliced transcripts, in which the 84 bp exon is skipped. The alternative spliced exon in the 5T allele is long, 183 bp. However, the polypyrimidine tract of the preceding intron is very weak, only 5 bp. This weak polypyrimidine tract probably enabled hnRNPA1 to promote exon skipping of RNA transcribed from p5T. The polypyrimidine tract of 7T and 9T was probably strong enough to prevent the activity of the hnRNP A1.
The human cellular splicing factor ASF/SF2 affected the splicing pattern of p5T and led to a substantial decrease in the efficiency of exon 9 recognition (Fig. 3b and Tables 2 and 3). This effect was similar to the effect observed with hnRNP A1 on this minigene. ASF/SF2, as other SR proteins, can bind exonic splicing enhancer sequences of pre-mRNAs and promote exon recognition by facilitating splicing of the upstream intron (23,4345). Interestingly, exon 9 includes two of these splicing enhancer consensus sequences (SRSASGA and GARGAR) (44,45). However, their presence did not promote exon 9 recognition upon ASF/SF2 overexpression. Furthermore, ASF/SF2 had no effect on the splicing pattern of p7T or p9T (except for a slight effect on p7T in HT29), indicating that the length of the pyrimidine tract plays a major role in the regulation of exon 9 recognition, promoted by ASF/SF2 in our systems (Tables 2 and 3). ASF/SF2 was previously shown to promote either exon inclusion or skipping (18,21,25,27,28). In this study we have shown that ASF/SF2 did not affect the splicing pattern of pre-mRNA transcribed from the p3849M (Table 1). All the RNA transcribed from this minigene remained aberrantly spliced; thus, the effect of ASF/SF2 on the inclusion of this exon could not be investigated. However, our results suggested that ASF/SF2 had no skipping effect on the 3849+10kb C
T allele. It should be noted that the known exonic elements, recognized by ASF/SF2, were not found in the 84 bp cryptic exon. In conclusion, overexpression of the cellular splicing factors, hnRNP A1 and ASF/SF2 can modulate the splicing pattern of CFTR alleles carrying splicing mutations in both CFTR expressing and non-expressing cells. Clearly, additional splicing factors as well as other cellular and environmental factors contribute to the complex mechanism of alternative splicing.
The adenoviral genes E4-ORF6 and E4-ORF3 were shown to regulate viral gene expression at the level of accumulation of alternatively spliced viral mRNA (32). The activity of these viral splicing factors may be of a general relevance and not restricted to the splicing of viral genes. Indeed, these factors were shown to promote exon skipping and inclusion of pre-mRNA of a human chimeric construct (32). Here we showed that E4-ORF6 and E4-ORF3 could modulate the splicing pattern (skipping and inclusion, respectively) of pre-mRNA carrying naturally occurring CFTR splicing mutations, similarly to their known effect on viral pre-mRNA. Our study showed that both cellular and viral splicing factors may have an effect on the same human pre mRNA. This might be important for understanding one of the effects of adeno infection on the splicing pattern of infected cells.
One interesting result from studying the poly(T) minigenes is the variability in the level of modulation by ASF/SF2 and E4-ORF3 in CFTR expressing as well as non-expressing cell lines (Tables 2 and 3). It should be noted that hnRNP A1 had a variable effect in some cell lines (COS-1, IB3 and HT29 cells), but no effect in others (NIH3T3 and PANC-1 cells). It was observed that even without overexpression of splicing factors p5T showed variable levels of aberrantly spliced transcripts in all cell lines. These results suggested that naturally occurring splicing mutations in human genes might be differently affected, in different tissues, as a result of programmed tissue-specific regulation of alternative splicing (30). Indeed, differences in the level of alternatively spliced transcripts were found in different tissues of the same individual carrying the 3849+10kb C
T mutation or the 5T allele (8,9,15,42).
Another polymorphic locus, comprising of a TG repeat with alleles ranging from 9 to 13, was found immediately upstream of the poly(T) tract (6). Analysis of RNA transcribed from 7T and 5T alleles showed that the poly(T) length had a major effect on exon 9 skipping which could be further modulated by the length of the TG repeat (46,47). In our study, the 5T minigene had a medium length of 11 TG repeats. As can be seen in Tables 2 and 3 overexpression of the splicing factors enabled the promotion of both exon skipping and inclusion of this allele. It is expected that the effects of skipping and inclusion on the splicing pattern of p5T could be further modulated by different TG repeats.
In summary, the results of our study are the first step towards understanding the regulation of alternative splicing pattern of CFTR alleles carrying splicing mutations. This might be important also for understanding the regulation of other genes causing human genetic diseases.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The minigenes
The minigene for the analysis of the CFTR mutation, 3849+10kb C
T (p3849M), and the minigene with the normal sequence (p3849N) were constructed using genomic DNA from a CF patient homozygous for the
F508 mutation. In the amplified region he had the normal sequence (Fig. 1a). The minigenes contained PCR fragments of exon 19, a region from intron 19 including the cryptic 84 bp exon, exon 20 and part of their flanking sequences (Fig. 1a). The 3849+10kb C
T mutation was introduced by site-directed mutagenesis using Power-Cloning (see below). The same cloning approach was applied for the construction of the 5T (p5T), the 7T (p7T) and the 9T (p9T) minigenes. These minigenes contained PCR fragments of exons 8, 9 and 10 and part of their flanking sequences (Fig. 2a). p5T and p9T were constructed using genomic DNA from a homozygote for the 5T allele, except for the fragment containing exon 9 of p9T, which was amplified from a homozygote for the 9T allele. p7T was generated by site-directed mutagenesis on p9T, using Power-Cloning (see below). The minigenes were created by connecting the PCR fragments to each other and to the mammalian expression vector pSI (Promega, Madison, WI) at its EcoRI and AccI restriction sites in a single step using Power-Cloning technology (patent pending in the USA: WO98/38297; WO98/38298; WO98/38299). The minigenes were sequenced and no variations were identified between the minigenes and the genomic sequences, other than the introduced mutations.
The splicing factors
The hnRNP A1 and the ASF/SF2 expression plasmids, pCG-A1 and pCG-SF2, respectively, contain the full-length human coding sequences (cDNA) of these genes (18). The E4-ORF6 and the E4-ORF3 expression plasmids, pCMVE4-ORF6 pCMVE4-ORF3, respectively (32), contain the full-length cDNA of the adenovirus genes.
Cells and transfections
COS-1, NIH3T3, IB3, HT29 and PANC-1 cells were grown in Dulbeccos modified Eagles medium (DMEM) with high glucose and HeLa cells were grown in MEM-E, all supplemented with 10% fetal calf serum. The cells were grown in 10 cm tissue culture dishes; 106 cells/dish were plated 24 h before transfection. Monolayer cells were transfected (or co-transfected with two different plasmids) using the calcium phosphate and 2x BBS co-precipitation technique (48). Following the transfection the cells were further grown for 48 h. In each transfection 15 µg of each of the minigene plasmids were used. Each experiment was repeated over seven times.
RNA preparation and single-strand cDNA synthesis
The transfected cells were harvested and lysed with UltraspecRNA reagent, and total RNA was purified using the Ultraspec RNA kit (Biotecx). cDNA was synthesized as previously described (9).
Analysis of the splicing pattern of the minigene transcripts
The primers used for the analysis of p3849M and p3849N transcripts (Fig. 1a) were: 19i5 specific for intron 19 (49), and X20 (5'-ATCCAGTTCTTCCCAAGAGGC-3') specific for exon 20. X20 was fluorescently labeled with 6-FAM. The PCR products of the correctly and aberrantly spliced transcripts were 402 and 486 bp, respectively. The primers used for the analysis of the poly(T) minigenes (p5T, p7T and p9T) were: 8Ri5 (5'-TGCATTAATGCTATTCTGATTC-3') specific for intron 8, and F10Rx3 (5'-TTGGCATGCTTTGATGACGC-3') specific for exon 10 (Fig. 2a). F10Rx3 was fluorescently labeled with 6-FAM. The PCR products of the correctly and aberrantly spliced transcripts were 513 and 330 bp, respectively.
RNA-less reactions were used as controls. The cDNA samples were heated at 94°C for 3 min and then subjected to 35 cycles of 94°C for 1 min, 55°C for 30 s and 65°C for 1 min, followed by final extension for 7 min at 65°C. The PCR was performed under semi-quantitative conditions as determined by serial tertiary dilution prior to the experiments (data not shown). The amounts of PCR product required to give an appropriate fluorescent signal (12% of the total PCR products) were empirically determined by analysis of serially diluted PCR products on polyacrylamide gels. The analysis was performed as previously described (50). In brief, each PCR product (1 µl) was mixed with 0.4 µl of a TAMRA-labeled commercial size standard (Genescan 500-Tamra; Applied Biosystems) and run on an ABI 377 system. The analysis was performed using Genescan software (v.2.X). The level of the aberrantly or correctly spliced transcripts was determined as: (i) the peak area of the signal of the aberrantly; or (ii) correctly spliced PCR product/(the peak area of the signal of the aberrantly spliced PCR product + the peak area of the signal of the correctly spliced PCR product).
Analysis of the transfection of the splicing factors
In each co-transfection, the transfection of the splicing factor plasmids were verified by RTPCR analysis. Only experiments in which the transfected splicing factors were found were included in the analysis. hnRNP A1 primers were: pCG 5'-UTR (GACGCCATCCACGCTGTT), specific for the pCG 5'-UTR, and A1exp3 (AAGTGGGCACCTGGTCTTTG). The primers used for ASF/SF2 analysis were: pCG 5'-UTR and ASF3 (GCTTCGAGGAAACTCCAC). The primers used for E4-ORF6 analysis were: CCCGAATGTAACACTTTGAC for ORF6exp5 and CGGTACCATATAAACCTCTG for ORF6exp3. The primers used for E4-ORF3 analysis were: TGATTCGCTGCTTGAGGCTG for ORF3-5 and TATTAAGTGAACGCGCTCCC for ORF3-3. The PCRs were performed as for the minigenes except for the annealing temperature (52°C) and the number of cycles (30).
| ACKNOWLEDGEMENTS |
|---|
The authors wish to thank Dr A.R. Krainier for kindly providing pCG-A1 and pCG-SF2 and Dr G. Akusjarvi for kindly providing pCMVE4-ORF6 and pCMVE4-ORF3. This study was partially supported by the March of Dimes, the North American CF Foundation and the Israel Foundation for the Sciences and Humanities grant to B.K.
| FOOTNOTES |
|---|
+ These authors contributed equally to this work
§ To whom correspondence should be addressed. Tel: +972 2 6585689; Fax: +972 2 6586975; Email kerem@leonardo.ls.huji.ac.il ![]()
| REFERENCES |
|---|
|
|
|---|
1 Kerem, B., Rommens, J.M., Buchanan, J.A., Markiewicz, D., Cox, T.K., Chakravarti, A., Buchwald, M. and Tsui, L.C. (1989) Identification of the cystic fibrosis gene: genetic analysis. Science, 245, 10731080.
2 Highsmith, W.E., Burch, L.H., Zhou, Z., Olsen, J.C., Boat, T.E., Spock, A., Gorvoy, J.D., Quittel, L., Friedman, K.J. and Silverman, L.M. (1994) A novel mutation in the cystic fibrosis gene in patients with pulmonary disease but normal sweat chloride concentrations. N. Engl. J. Med., 331, 974980.
3 Chillon, M., Dork, T., Casals, T., Gimenez, J., Fonknechten, N., Will, K., Ramos, D., Nunes, V. and Estivill, X. (1995) A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811+1.6kb A
G, produces a new exon: high frequency in Spanish cystic fibrosis chromosomes and association with severe phenotype. Am. J. Hum. Genet., 56, 623629.[Web of Science][Medline]
4 Jones, C.T., McIntosh, I., Keston, M., Ferguson, A. and Brock, D.J. (1992) Three novel mutations in the cystic fibrosis gene detected by chemical cleavage: analysis of variant splicing and a nonsense mutation. Hum. Mol. Genet., 1, 1117.
5 Highsmith, W.E., Burch, L.H., Zhou, Z., Olsen, J.C., Strong, T.V., Smith, T., Friedman, K.J., Silverman, L.M., Boucher, R.C., Collins, F.S. and Knowles, M.R. (1997) Identification of a splice site mutation (2789+5 G
A) associated with small amounts of normal CFTR mRNA and mild cystic fibrosis. Hum. Mutat., 9, 332338.[Web of Science][Medline]
6 Chu, C.S., Trapnell, B.C., Curristin, S., Cutting, G.R. and Crystal, R.G. (1993) Genetic basis of variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nature Genet., 3, 151156.[Web of Science][Medline]
7 Strong, T.V., Wilkinson, D.J., Mansoura, M.K., Devor, D.C., Henze, K., Yang, Y., Wilson, J.M., Cohn, J.A., Dawson, D.C. and Frizzell, R.A. (1993) Expression of an abundant alternatively spliced form of the cystic fibrosis transmembrane conductance regulator (CFTR) gene is not associated with a cAMP-activated chloride conductance. Hum. Mol. Genet., 2, 225230.
8 Mak, V., Jarvi, K.A., Zielenski, J., Durie, P. and Tsui, L.C. (1997) Higher proportion of intact exon 9 CFTR mRNA in nasal epithelium compared with vas deferens. Hum. Mol. Genet., 6, 20992107.
9 Rave-Harel, N., Kerem, E., Nissim-Rafinia, M., Madjar, I., Goshen, R., Augarten, A., Rahat, A., Hurwitz, A., Darvasi, A. and Kerem, B. (1997) The molecular basis of partial penetrance of splicing mutations in cystic fibrosis. Am. J. Hum. Genet., 60, 8794.[Web of Science][Medline]
10 Chiba-Falek, O., Kerem, E., Shoshani, T., Aviram, M., Augarten, A., Bentur, L., Tal, A., Tullis, E., Rahat, A. and Kerem, B. (1998) The molecular basis of disease variability among cystic fibrosis patients carrying the 3849+10 kb C
T mutation. Genomics, 53, 276283.[Web of Science][Medline]
11 Larriba, S., Bassas, L., Gimenez, J., Ramos, M.D., Segura, A., Nunes, V., Estivill, X. and Casals, T. (1998) Testicular CFTR splice variants in patients with congenital absence of the vas deferens. Hum. Mol. Genet., 7, 17391743.
12 Augarten, A., Kerem, B.S., Yahav, Y., Noiman, S., Rivlin, Y., Tal, A., Blau, H., Ben-Tur, L., Szeinberg, A. and Kerem, E. (1993) Mild cystic fibrosis and normal or borderline sweat test in patients with the 3849+10 kb C
T mutation. Lancet, 342, 2526.[Web of Science][Medline]
13 Gilbert, F., Li, Z., Arzimanoglou, I.I., Bialer, M., Denning, C., Gorvoy, J., Honorof, J., Ores, C. and Quittell, L. (1995) Clinical spectrum in homozygotes and compound heterozygotes inheriting cystic fibrosis mutation 3849 + 10 kb C
T: significance for geneticists. Am. J. Med. Genet., 58, 356359.[Web of Science][Medline]
14 Kerem, E., Rave-Harel, N., Augarten, A., Madgar, I., Nissim-Rafinia, M., Yahav, Y., Goshen, R., Bentur, L., Rivlin, J., Aviram, M. et al. (1997) A cystic fibrosis transmembrane conductance regulator splice variant with partial penetrance associated with variable cystic fibrosis presentations. Am. J. Respir. Crit. Care. Med., 155, 19141920.[Abstract]
15 Chiba-Falek, O., Parad, R.B., Kerem, E. and Kerem, B. (1999) Variable levels of normal RNA in different organs carrying the CFTR splicing mutation 3849 +10 kb C
T. Am. J. Respir. Crit. Care. Med., 159, 19982002.
16 Caceres, J.F. and Krainer, A.R. (1997) In Krainer, A.R. (ed.), Eukaryotic mRNA Processing. IRL Press, Oxford, UK, pp. 174212.
17 Mayeda, A. and Krainer, A.R. (1992) Regulation of alternative pre-mRNA splicing by hnRNP A1 and splicing factor SF2. Cell, 68, 365375.[Web of Science][Medline]
18 Caceres, J.F., Stamm, S., Helfman, D.M. and Krainer, A.R. (1994) Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science, 265, 17061709.
19 Mayeda, A., Munroe, S.H., Caceres, J.F. and Krainer, A.R. (1994) Function of conserved domains of hnRNP A1 and other hnRNP A/B proteins. EMBO J., 13, 54835495.[Web of Science][Medline]
20 Yang, X., Bani, M.R., Lu, S.J., Rowan, S., Ben-David, Y. and Chabot, B. (1994) The A1 and A1B proteins of heterogeneous nuclear ribonucleoparticles modulate 5' splice site selection in vivo. Proc. Natl Acad. Sci. USA, 91, 69246928.
21 Jiang, Z.H., Zhang, W.J., Rao, Y. and Wu, J.Y. (1998) Regulation of Ich-1 pre-mRNA alternative splicing and apoptosis by mammalian splicing factors. Proc. Natl Acad. Sci. USA, 95, 91559160.
22 Mayeda, A., Helfman, D.M. and Krainer, A.R. (1993) Modulation of exon skipping and inclusion by heterogeneous nuclear ribonucleoprotein A1 and pre-mRNA splicing factor SF2/ASF. Mol. Cell. Biol., 13, 29933001.
23 Manley, J.L. and Tacke, R. (1996) SR proteins and splicing control. Genes Dev., 10, 15691579.
24 Ramchatesingh, J., Zahler, A.M., Neugebauer, K.M., Roth, M.B. and Cooper, T.A. (1995) A subset of SR proteins activates splicing of the cardiac troponin T alternative exon by direct interactions with an exonic enhancer. Mol. Cell Biol., 15, 48984907.
25 Sarkissian, M., Winne, A. and Lafyatis, R. (1996) The mammalian homolog of suppressor-of-white-apricot regulates alternative mRNA splicing of CD45 exon 4 and fibronectin IIICS. J. Biol. Chem., 271, 3110631114.
26 Du, K., Peng, Y., Greenbaum, L.E., Haber, B.A. and Taub, R. (1997) HRS/SRp40-mediated inclusion of the fibronectin EIIIB exon, a possible cause of increased EIIIB expression in proliferating liver. Mol. Cell. Biol., 17, 40964104.[Abstract]
27 Lim, L.P. and Sharp, P.A. (1998) Alternative splicing of the fibronectin EIIIB exon depends on specific TGCATG repeats. Mol. Cell. Biol., 18, 39003906.
28 Lemaire, R., Winne, A., Sarkissian, M. and Lafyatis, R. (1999) SF2 and SRp55 regulation of CD45 exon 4 skipping during T cell activation. Eur. J. Immunol., 29, 823837.[Web of Science][Medline]
29 Zahler, A.M., Neugebauer, K.M., Lane, W.S. and Roth, M.B. (1993) Distinct functions of SR proteins in alternative pre-mRNA splicing. Science, 260, 219222.
30 Hanamura, A., Caceres, J.F., Mayeda, A., Franza, B.R. and Krainer, A.R. (1998) Regulated tissue-specific expression of antagonistic pre-mRNA splicing factors. RNA, 4, 430444.[Abstract]
31 Imperiale, M.J., Akusjnarvi, G. and Leppard, K.N. (1995) Post-transcriptional control of adenovirus gene expression. Curr. Top. Microbiol. Immunol., 199, 139171.
32 Nordqvist, K., Ohman, K. and Akusjarvi, G. (1994) Human adenovirus encodes two proteins which have opposite effects on accumulation of alternatively spliced mRNAs. Mol. Cell. Biol., 14, 437445.
33 Weatherall, D.J., Clegg, J.B., Higgs, D.R. and Wood, W.G. (1989) In Scriver, C.L., Sly, W.S. and Valle, D. (eds), The Metabolic Basis of Inherited Disease. McGraw Hill, New York, NY, pp. 22812339.
34 Kishimoto, T.K., OConner, K. and Springer, T.A. (1989) Leukocyte adhesion deficiency. Aberrant splicing of a conserved integrin sequence causes a moderate deficiency phenotype. J. Biol. Chem., 264, 35883595.
35 McInnes, B., Potier, M., Wakamatsu, N., Melancon, S.B., Klavins, M.H., Tsuji, S. and Mahuran, D.J. (1992) An unusual splicing mutation in the HEXB gene is associated with dramatically different phenotypes in patients from different racial backgrounds. J. Clin. Invest., 90, 306314.
36 Arredondo-Vega, F.X., Santisteban, I., Kelly, S., Schlossman, C.M., Umetsu, D.T. and Hershfield, M.S. (1994) Correct splicing despite mutation of the invariant first nucleotide of a 5' splice site: a possible basis for disparate clinical phenotypes in siblings with adenosine deaminase deficiency. Am. J. Hum. Genet., 54, 820830.[Web of Science][Medline]
37 Nestorowicz, A., Wilson, B.A., Schoor, K.P., Inoue, H., Glaser, B., Landau, H., Stanley, C.A., Thornton, P.S., Clement, J.P.T., Bryan, J. et al. (1996) Mutations in the sulonylurea receptor gene are associated with familial hyperinsulinism in Ashkenazi Jews. Hum. Mol. Genet., 5, 18131822.
38 Riordan, J.R., Rommens, J.M., Kerem, B., Alon, N., Rozmahel, R., Grzelczak, Z., Zielenski, J., Lok, S., Plavsic, N. and Chou, J.L. (1989) Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science, 245, 10661073.
39 Rommens, J.M., Iannuzzi, M.C., Kerem, B., Drumm, M.L., Melmer, G., Dean, M., Rozmahel, R., Cole, J.L., Kennedy, D. and Hidaka, N. (1989) Identification of the cystic fibrosis gene: chromosome walking and jumping. Science, 245, 10591065.
40 Dreyfus, D.H., Bethel, R. and Gelfand, E.W. (1996) Cystic fibrosis 3849+10kb C
T mutation associated with severe pulmonary disease and male fertility. Am. J. Respir. Crit. Care Med., 153, 858860.[Abstract]
41 Jarvi, K., Zielenski, J., Wilschanski, M., Durie, P., Buckspan, M., Tullis, E., Markiewicz, D. and Tsui, L.C. (1995) Cystic fibrosis transmembrane conductance regulator and obstructive azoospermia. Lancet, 345, 1578.[Web of Science][Medline]
42 Teng, H., Jorissen, M., Van Poppel, H., Legius, E., Cassiman, J.J. and Cuppens, H. (1997) Increased proportion of exon 9 alternatively spliced CFTR transcripts in vas deferens compared with nasal epithelial cells. Hum. Mol. Genet., 6, 8590.
43 Sun, Q., Mayeda, A., Hampson, R.K., Krainer, A.R. and Rottman, F.M. (1993) General splicing factor SF2/ASF promotes alternative splicing by binding to an exonic splicing enhancer. Genes Dev., 7, 25982608.
44 Gallego, M.E., Gattoni, R., Stevenin, J., Marie, J. and Expert-Bezancon, A. (1997) The SR splicing factors ASF/SF2 and SC35 have antagonistic effects on intronic enhancer-dependent splicing of the beta-tropomyosin alternative exon 6A. EMBO J., 16, 17721784.[Web of Science][Medline]
45 Liu, H.X., Zhang, M. and Krainer, A.R. (1998) Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins. Genes Dev., 12, 19982012.
46 Cuppens, H., Lin, W., Jaspers, M., Costes, B., Teng, H., Vankeerberghen, A., Jorissen, M., Droogmans, G., Reynaert, I., Goossens, M. et al. (1998) Polyvariant mutant cystic fibrosis transmembrane conductance regulator genes. The polymorphic (Tg)m locus explains the partial penetrance of the T5 polymorphism as a disease mutation. J. Clin. Invest., 101, 487496.[Web of Science][Medline]
47 Niksic, M., Romano, M., Buratti, E., Pagani, F. and Baralle, F.E. (1999) Functional analysis of cis-acting elements regulating the alternative splicing of human CFTR exon 9. Hum. Mol. Genet., 8, 23392349.
48 Ausbel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (1992) In Ausbel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (eds), Short Protocols in Molecular Biology. Greene Publishing and John Wiley & Sons, pp. 95.
49 Zielenski, J., Rozmahel, R., Bozon, D., Kerem, B., Grzelczak, Z., Riordan, J.R., Rommens, J. and Tsui, L.C. (1991) Genomic DNA sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Genomics, 10, 214228.[Web of Science][Medline]
50 Hampton, G.M., Larson, A.A., Baergen, R.N., Sommers, R.L., Kern, S. and Cavenee, W.K. (1996) Simultaneous assessment of loss of heterozygosity at multiple microsatellite loci using semi-automated fluorescence-based detection: subregional mapping of chromosome 4 in cervical carcinoma. Proc. Natl Acad. Sci. USA, 93, 67046709.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
E. Buratti, C. Stuani, G. De Prato, and F. E. Baralle SR protein-mediated inhibition of CFTR exon 9 inclusion: molecular characterization of the intronic splicing silencer Nucleic Acids Res., July 26, 2007; 35(13): 4359 - 4368. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Radpour, H. Gourabi, M. A. S. Gilani, and A. V. Dizaj Molecular Study of (TG)m(T)n Polymorphisms in Iranian Males With Congenital Bilateral Absence of the Vas Deferens J Androl, July 1, 2007; 28(4): 541 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Ziedalski, P. N. Kao, N. R. Henig, S. S. Jacobs, and S. J. Ruoss Prospective analysis of cystic fibrosis transmembrane regulator mutations in adults with bronchiectasis or pulmonary nontuberculous mycobacterial infection. Chest, October 1, 2006; 130(4): 995 - 1002. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Buratti, A. Brindisi, M. Giombi, S. Tisminetzky, Y. M. Ayala, and F. E. Baralle TDP-43 Binds Heterogeneous Nuclear Ribonucleoprotein A/B through Its C-terminal Tail: AN IMPORTANT REGION FOR THE INHIBITION OF CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR EXON 9 SPLICING J. Biol. Chem., November 11, 2005; 280(45): 37572 - 37584. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gabut, M. Mine, C. Marsac, M. Brivet, J. Tazi, and J. Soret The SR Protein SC35 Is Responsible for Aberrant Splicing of the E1{alpha} Pyruvate Dehydrogenase mRNA in a Case of Mental Retardation with Lactic Acidosis Mol. Cell. Biol., April 15, 2005; 25(8): 3286 - 3294. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Willoughby, L. L. Y. Chan, S. Herd, G. Billingsley, N. Noordeh, A. V. Levin, Y. Buys, G. Trope, M. Sarfarazi, and E. Heon Defining the Pathogenicity of Optineurin in Juvenile Open-Angle Glaucoma Invest. Ophthalmol. Vis. Sci., September 1, 2004; 45(9): 3122 - 3130. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Slaugenhaupt, J. Mull, M. Leyne, M. P. Cuajungco, S. P. Gill, M. M. Hims, F. Quintero, F. B. Axelrod, and J. F. Gusella Rescue of a human mRNA splicing defect by the plant cytokinin kinetin Hum. Mol. Genet., February 15, 2004; 13(4): 429 - 436. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Aznarez, E. M. Chan, J. Zielenski, B. J. Blencowe, and L.-C. Tsui Characterization of disease-associated mutations affecting an exonic splicing enhancer and two cryptic splice sites in exon 13 of the cystic fibrosis transmembrane conductance regulator gene Hum. Mol. Genet., August 15, 2003; 12(16): 2031 - 2040. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Pagani, E. Buratti, C. Stuani, and F. E. Baralle Missense, Nonsense, and Neutral Mutations Define Juxtaposed Regulatory Elements of Splicing in Cystic Fibrosis Transmembrane Regulator Exon 9 J. Biol. Chem., July 11, 2003; 278(29): 26580 - 26588. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Faustino and T. A. Cooper Pre-mRNA splicing and human disease Genes & Dev., February 15, 2003; 17(4): 419 - 437. [Full Text] [PDF] |
||||
![]() |
F. Pagani, C. Stuani, E. Zuccato, A. R. Kornblihtt, and F. E. Baralle Promoter Architecture Modulates CFTR Exon 9 Skipping J. Biol. Chem., January 10, 2003; 278(3): 1511 - 1517. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












