Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (68)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cheng, N. C.
Right arrow Articles by Arwert, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, N. C.
Right arrow Articles by Arwert, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2000, Vol. 9, No. 12 1805-1811
© 2000 Oxford University Press

Mice with a targeted disruption of the Fanconi anemia homolog Fanca

Ngan Ching Cheng1,2, Henri J. van de Vrugt1, Martin A. van der Valk3, Anneke B. Oostra1, Paul Krimpenfort2, Yne de Vries1, Hans Joenje1, Anton Berns2 and Fré Arwert,1,+

1Department of Clinical Genetics and Human Genetics, Free University Medical Center, Van der Boechorststraat 7, 1081 BT Amsterdam, The Netherlands, 2Division of Molecular Genetics and Center of Biomedical Genetics, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands and 3Department of Experimental Animal Pathology, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands

Received 16 March 2000; Revised and Accepted 5 June 2000.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Fanconi anemia (FA) is a hereditary chromosomal instability syndrome with cancer predisposition. Bone marrow failure resulting in pancytopenia is the main cause of death of FA patients. Diagnosis of FA is based on their cellular hypersensitivity to DNA crosslinking agents and chromosome breakages. Somatic complementation experiments suggest the involvement of at least eight genes in FA. The gene for complementation group A (FANCA) is defective in the majority of FA patients. We show here that mice deficient of Fanca are viable and have no detectable developmental abnormalities. The hematological parameters showed a slightly decreased platelet count and a slightly increased erythrocyte mean cell volume in mice at young age, but this did not progress to anemia. Consistent with the clinical phenotype of FA patients, both male and female mice showed hypogonadism and impaired fertility. Furthermore, embryonic fibroblasts of the knock-out mice exhibited spontaneous chromosomal instability and were hyper-responsive to the clastogenic effect of the crosslinker mitomycin C.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Fanconi anemia (FA) is an autosomal recessive disorder characterized by aplastic anemia due to bone marrow failure, congenital abnormalities of the skeleton, kidney, skin and heart, and an increased risk for the development of leukemia and squamous cell carcinoma (1). FA patients often show retarded growth and hypogonadism. Pancytopenia typically occurs during the first decade of life, usually starting with thrombocytopenia associated with macrocytic erythrocytes and elevated fetal hemoglobin (HbF), followed by neutropenia, and finally anemia. The pancytopenia is associated with reduced bone marrow cellularity. FA is also a genomic instability syndrome: patients’ cells show chromosomal aberrations and are hypersensitive to DNA crosslinking agents. This in vitro phenotype has become the basis of FA diagnosis.

The clinical manifestations of FA are highly variable. Asymptomatic and severe cases may co-exist within a family. In addition to the clinical heterogeneity, FA also displays genetic heterogeneity. Fusion of cells from different patients show complementation of the crosslinker sensitivity sug­gesting that distinct genes are involved in this disorder. To date, eight complementation groups have been identified, designated ­FA­-A to FA-H (2). Four FA genes (FANCA, FANCC, FANCG and FANCF) have been cloned (37) and two additional genes (FANCD and FANCE) have been mapped (8,9).

No correlation has so far been found between complementation groups, clinical phenotype and disease outcome. The cloning of the FA genes represented a breakthrough in the FA diagnosis, but has not yet shed light on the etiology of the disease. The four FA genes identified thus far did not show homology to other gene sequences in the databases. In addition, unlike other genes associated with genomic stability (XP, AT, BS, HNPCC), no homologs are found in simple organisms like yeast and bacteria (1014). Biochemical studies showed association of the FA proteins (1517), suggesting that they act in a complex. Complexes were mainly found in the cell nucleus. These data could suggest an evolutionarily novel pathway of FA genes in the maintenance of genomic integrity.

FA-A is the major FA complementation group, accounting for 66% of the patients worldwide (1). The corresponding gene, FANCA, was cloned in 1996 (4,5). This is a large gene consisting of 43 exons and coding for a 160 kDa protein. Mutation analyses in FA-A patients did not identify mutational hotspots (18,19).

Animal models are important tools in the understanding of human diseases. Analysis of mice defective in FA genes can give insight into the biological function of the genes and their role in the relevant biochemical pathways. Moreover, they may prove useful for testing potential therapies. We generated mice with a null mutation in the Fanca gene. The mutants show the expected cellular phenotype as well as impaired fertility but minor, if at all significant, hematological features of the disease.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of Fanca–/– mice
The targeted mutagenesis of the Fanca gene was performed by replacement of exons 4–7 by the lacZ–Neo fusion marker (Fig. 1A). Introduction of the targeting construct into mouse embryonic stem (ES) cells yielded clones with the expected homologous recombination (Fig. 1B). Two mouse lines were generated from independent ES cell clones. Chimeric males were used for germline transmission of the targeted Fanca allele. Genotyping was performed by PCR analysis (Fig. 1C). Absence of FANCA protein expression in the mutant mice was confirmed (Fig. 1D). Interbreeding of heterozygotes produced the expected proportion of homozygous mutant offspring. Fanca–/– mice appeared normal, without obvious congenital malformations or growth retardation.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Generation of Fanca-deficient mice by gene targeting. (A) Map of the 5' genomic locus of the murine Fanca gene showing the first 14 exons, the targeting construct and the homologous recombinant locus. Gene targeting resulted from deletion of exons 4–7 and insertion of a promoterless lacZneo fusion cassette. Restriction enzymes: B, BamHI; Nh, NheI; RI, EcoRI; Xb, XbaI. The positions of the 5' and 3' flanking probes are indicated. (B) Southern blot analysis of Fanca targeting in ES cells. Genomic DNA of ES clones were digested with XbaI (left) or NheI (right) and hybridized to the 5' or 3' flanking probes, respectively. WT, wild-type allele; KO, knock-out allele. (C) PCR genotyping of mouse tails. +/+, wild-type; +/–, heterozygote; –/–, homozygous knock-out. WT, wild-type Fanca allele from exons 4–6; KO, knock-out allele from the Neo marker. (D) Western blot of immunoprecipitated FANCA protein from mouse spleens. +/+, wild-type, +/–, heterozygote; –/–, homozygous knock-out. The 161 kDa FANCA protein is indicated.

 
Fanca–/– mice have impaired fertility
FA patients have reduced fertility. Therefore, we studied fertility in the Fanca mutant mice (Fig. 2). Ten- to twelve-week-old Fanca–/– mice were bred with wild-type mice and followed over time. The Fanca–/– females showed a severe fertility defect; they stopped breeding between 10 and 21 weeks of age (Fig. 2A). The mean litter size was smaller than that of control litters (Fig. 2B). Reduced fertility was also observed in males, although less severe. They reproduce for longer than the females, but after ~20 weeks of age both the number and size of their litters declined precipitously, with the majority becoming completely infertile. However, occasionally some males regained reproductivity after a non-reproductive period of several months.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Fanca–/– mice have reduced reproduction ability. Reproductive performance of five pairs of mice per group were followed over time. Fanca–/– (KO) mice were crossed with wild-type mice. Controls were heterozygote x heterozygote crosses. (A) Total number of litters per age group. (B) Mean litter size with standard deviation per litter of each group.

 
Gonadal abnormalities of Fanca–/– mice
Infertility was accompanied by striking abnormalities in the gonads, apparent in histological examination of 2.5- to 10-month-old mice. Hypogonadism was obvious for both sexes (Fig. 3B and F). The seminiferous tubules in mutant testes were atrophic with strongly reduced spermatogenesis (Fig. 3D) compared with control testes (Fig. 3C). In addition, mutant testes showed hyperplasia of Leydig cells. Ovaries of Fanca–/– females have few or almost no follicles. The ovaries were composed mainly of interstitial cells (compare Fig. 3H and G).



View larger version (144K):
[in this window]
[in a new window]
 
Figure 3. Gonadal abnormalities of Fanca–/– mice. Histological sections of testis and ovary of 6-month-old mice. (A, B, C and D) Control or Fanca–/– testis. (E, F, G and H) Control or Fanca–/– ovary. (C), (D), (G) and (H) are higher magnifications of (A), (B), (E) and (F). The control testis shows all stages of normal spermatogenesis whereas in Fanca–/– testis spermatogenesis is only detected in some seminiferous tubules. Some tubuli mainly have Sertoli cells (D, arrow) and there is a diffuse hyperplasia of Leydig cells (D, arrowhead). The normal ovary contains numerous developing Graafian follicles. The Fanca–/– ovary consists predominantly of interstitial cells. Some degenerated follicles with residual oocyte can be seen (H, arrow).

 
No other consistent congenital abnormalities were noticed in the mutant mice. Bone marrow of Fanca–/– mice showed no signs of hypoplasia and hematopoiesis appeared normal.

Hematological parameters
FA patients typically develop pancytopenia during childhood. We therefore performed periodic hematological measurements on Fanca–/– mice starting from 8 weeks of age. Fanca–/– mice showed no signs of obvious spontaneous anemia. Red blood cell count was normal both in the mutants and in the control groups. No significant difference was seen in the hemoglobin and hematocrit values between the Fanca mutants and controls. The platelet count was somewhat reduced in the knock-out group (Fig. 4) and the mean cell volume (MCV) of Fanca–/– mice was slightly higher, suggestive of macrocytic red cells. These features were seen in mice ~20 weeks of age. However, as all other hematological parameters, including total erythrocyte counts and hemoglobin levels, are normal in Fanca–/– mice (data not shown) and, since no further decrease in the platelet counts was measured over the course of time, there is no indication of progressive anemia in these animals.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 4. Platelet counts and MCV of Fanca–/– mice. The average and standard deviation values of Fanca–/– and control mice of increasing age groups are shown. The asterisks (*) mark the statistically significant observations (P < 0.05) in Fanca–/– mice. M, male mice; F, female mice.

 
In mice, the spleen is an important alternative hematopoietic organ in addition to bone marrow. To enforce reliance on the bone marrow and in that way accelerate potential failure of this hematopoietic source, splenectomy was carried out in a group of animals. However, hematological analysis 2 months after splenectomy did not show signs of anemia (data not shown).

Flow cytometry analysis of bone marrow, spleen and thymus showed no consistent abnormalities of the B and T lymphocyte, erythrocyte, macrophage and granulocyte lineages in Fanca–/– mice of 6 weeks to 10 months of age (data not shown). Fetal hemoglobin expression in adult Fanca–/– mice, assayed by gel electrophoresis, was not elevated (data not shown).

May–Gruenwald–Giemsa stained blood smears were made and white blood cells were analyzed and counted. No aberrant morphology was noted and white blood cell numbers (lymphocytes, granulocytes and monocytes) were similar in the three genotypes.

Altogether, these data suggest that Fanca–/– mice exhibit some minor hematological deviations characteristic of FA patients during the initial anemic phase. However, in contrast to FA patients, Fanca–/– mice do not develop progressive anemia, at least not within the first 12 months of life, so that the biological significance of these observations remains unclear.

Fanca–/– cells show the characteristic FA DNA crosslinker-sensitive phenotype
Mouse embryonic fibroblasts (MEFs) were analyzed for DNA crosslinker sensitivity in a mitomycin C (MMC) growth inhibition assay. Fanca–/– primary MEFs are more sensitive to MMC than wild-type and heterozygous MEFs. Whereas the IC50 for the control cells is ~30 ng/ml, 50% of proliferation was inhibited in Fanca–/– MEFs at ~3 ng/ml MMC (Fig. 5A). The increased MMC sensitivity was also observed in Fanca–/– post-crisis MEFs and Concanavalin-A-stimulated splenocytes (data not shown). Another diagnostic parameter of FA is chromosome breakages. Hence, metaphase spreads from primary MEFs were analyzed for chromosomal damage (Fig. 5B). In the absence of MMC, 4% of wild-type MEFs showed aberrations whereas 22% of the Fanca–/– cells presented spontaneous chromosomal damage (Fig. 5B, white bars). Treatment with MMC induced mild chromosomal damage in the Fanca+/+ cells, and 78% of the metaphase spreads showed no abnormalities. In contrast, MMC treatment caused severe chromosomal damage in Fanca–/– cells. The majority of cells contained >10 aberrations (Fig. 5B, black bars). The heterozygous cells showed an intermediate level of chromosomal aberrations (data not shown), as described for some human carriers.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. Murine Fanca–/– cells show the in vitro Fanconi anemia DNA crosslinker-sensitive phenotype. (A) MMC growth inhibition curve of MEFs. Cells were grown in the presence of increasing concentrations of MMC. After 5 days the amount of cells was compared with that of untreated cells, which is designated 100% of proliferation. KO, homozygous mutant; Het, heterozygote; WT, wild-type. Values are means of three or four independent cultures per genotype. (B) MMC-induced chromosome breakage test. Diploid primary MEFs were treated with 50 nM MMC for 48 h. The numbers of chromosomal aberrations per metaphase spread were scored. White bars, untreated controls; black bars, MMC treated cells. Similar results were obtained with immortal post-crisis aneuploid MEFs (data not shown).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FA patients exhibit extreme clinical heterogeneity. The characteristic hypersensitivity of FA cells to DNA crosslinking agents has been introduced as a reliable indicator for this disorder. Mice mutated in the Fanca gene show this FA cellular phenotype and are therefore useful models in which to study this aspect of the disease. Skeletal abnormalities, observed in a large proportion of FA patients were not found in Fanca–/– mice following radiological examination (data not shown).

FA patients show severe depletion of bone marrow stem cells resulting in aplastic anemia. Mice, however, have a very resilient hematopoietic system. Our attempts to make anemic mice by mutational disruption of the Fanca gene has not resulted in a model of this aspect of the human disease: the Fanca–/– mice showed some minor hematological parameters of FA patients. Attempts to stress further the mouse hemato­poietic system by splenectomy did not result in anemia or reduced blood cell counts. In this respect Fanca–/– mice behave similar to Fancc–/– mice (20,21), which also failed to show anemia following disruption of the Fancc gene. However, loss of FANCC protein results in a reduced hematopoietic stem cell repopulation ability (22), and anemia in Fancc–/– animals can be induced by treatment of the animals with DNA crosslinking agents (23).

FA male patients often display hypogonadism and reduced sperm count, and rarely produce offspring. Although pregnancies of FA female patients have been reported in a few cases, premature menopause has also been described, starting as early as 26 years (24). In mice lacking Fanca expression, female infertility is more severe. Young female mice are able to reproduce, although they have smaller litters. However, these mice cease breeding at an early age. Histological analysis showed almost no mature follicles. Nevertheless, the presence of degenerated oocytes and the normal uterus morphology suggest that previous hormonal stimulation occurred, indicating a more or less normal functional development of the reproductive system initially. This may be comparable to premature menopause in FA patients. Endocrine studies in this report are limited to staining of pituitary glands for follicle-stimulating hormone and leutinizing hormone. No consistent differences between the genotypes was observed. Hypo­gonadism and a reduced spermatogenesis with increased number of Leydig cells was observed in a male FA patient (25). The histological picture in a 15-year-old male patient is described as a ‘Sertoli-cell-only’ defect and very few spermatogonia were observed in a post mortem examination of the testis (25). The reduction in the number of spermatogonia seems more severe in humans than in our Fanca–/– mice, where seminiferous tubules with apparently normal spermatogenesis are present. FA is a member of a group of different diseases, characterized by defects in caretaker genes (26) which safeguard genomic integrity. Mutations in several caretaker genes are associated with defects in fertility. The evidence points to a role of ATM, MLH1, PMS2 and BLM proteins in meiosis (27–30). BLM and MLH1 proteins are found to localize in the synaptonemal complex. Fanca–/– mice also clearly show defects in fertility. Histology of mutant testis showed seminiferous tubules with normal spermatogenesis next to abnormal tubules with strongly reduced spermatogenesis. This observation is suggestive of a role of FANCA proteins in maintenance of adequate number of spermatogenic stem cells. Localization studies of FANCA protein in spermatogonia and synaptonemal complexes, Sertoli and Leydig cells will be helpful in understanding the precise function of FANCA protein in spermatogenesis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction of the Fanca gene-targeting vector
An 11 kb EcoRI genomic fragment containing exons 3–12 of the Fanca gene from the 129Ola strain was subcloned into pBRMG, a modified pBR322 vector (generously supplied by M. Giovannini). Partial BamHI digestion was performed to delete the 4.4 kb fragment containing exons 4–7 and the restriction overhangs were filled in with dATP and dGTP. The 6.7 kb SalI cassette containing the second intron from the Engrailed gene, a splice acceptor site, an IRES, the lacZNeo fusion gene and the SV40 polyadenylation signal was isolated from the pGT1.8IresBgeo plasmid (B. Skarnes), partially filled in with dTTP and dCTP and ligated to the Fanca construct.

ES cell targeting and generation of Fanca–/– mice
The targeting construct was isolated from the vector by NotI digestion and electroporated into E14 ES cells derived from the 129Ola strain. Genomic DNA from clones surviving G418 selection were isolated, digested with XbaI or NheI, and analyzed with the 5' or 3' probes on Southern blots. Subsequent hybridizations of the same blots with internal probes from the lacZNeo cassette confirmed the homologous recombination in the clones. Two independent ES clones with normal karyotype were injected into blastocysts from the C57Bl/6 strain and the resulting chimeric males were bred with FVB females and germline transmission was obtained. Heterozygous F1 mice were intercrossed to produce homozygous mutant mice. Genotype was determined by PCR analysis on mouse tail DNA with primer sets for the endogenous exon 4–6 allele (primers GGATCAGGCCTCGAGGCTGG and TGCA­GTAGCTCCTGTAGGCT, ~750 bp) and for the recombinant Neo allele (GACTGGGCACAACAGACAATCGGCT and TGATATTCGGCAAGCAGGCATCGCC primers, 523 bp). FANCA protein expression was analyzed in cell lysate from mouse tissues or MEFs by immunoprecipitation and western blot with antiserum directed against the GST–FANCA fusion protein (amino acids 1–454) (31).

Hematological analysis
Peripheral blood was collected by orbital puncture, with EDTA as an anticoagulant. Measurements of blood cell counts, hemoglobin and hematocrit levels, and the derived mean MCV, mean cell hemoglobin and mean cell hemoglobin concentration values were performed on a Sysmex K-4500 machine (Goffin-Meyvis, Tiel, The Netherlands).

Histological analysis
Mice were sacrificed and isolated organs were fixed in 4% paraformaldehyde in PBS, pH 7.8, embedded in paraffin, sectioned, and stained with hematoxylin and eosin. These include testis, ovary, kidney, liver, spleen, intestines, thymus, heart, lungs, extremities, salivary gland, eye, brain, pituitary gland and bone marrow.

MMC growth inhibition assay
MEFs were derived from 14 day post coitum embryos and seeded in quadruplicate in 96-well microtiter plates at a density of 500 cells/well in Dulbecco’s modified Eagle’s medium with glutamate (Gibco BRL) containing 10% fetal bovine serum supplemented with sodium pyruvate and penicillin/streptomycin. MMC was added in a dilution series of 0–640 ng/ml. Cells were incubated for 5 days at 37°C in a 5% CO2 incubator. Plates were frozen at –80°C. Nucleic acid quantification was performed with a proprietary dye (CyQUANT; Molecular Probes) and subsequently analyzed by an ELISA plate reader according to the manufacturer’s directions.

MMC-induced chromosome breakage analysis
MEFs were incubated for 48 h in the absence or presence of 50 nM MMC. For each culture, 50 metaphase spreads were analyzed for chromosomal abnormalities, which included both chromosome and chromatid-type aberrations.


    ACKNOWLEDGEMENTS
 
We thank J. Allen for technical advice and assistance, as well as critical comments on the manuscript, K. van Veen for blasto­cyst injections, N. Bosnie, F. van der Ahé, E. Gelderop and I. de Greeuw for mice care, and A. Dietrich and A. Vink for immunohistochemistry on mouse testes. This work was supported by a grant from the Dutch Cancer Society (project no. VU97-1642).


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +31 20 4448270; Fax: +31 20 4448285; Email: f.arwert.humgen@med.vu.nl Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Auerbach, A.D., Buchwald, M. and Joenje, H. (1998) Fanconi anemia. In Vogelstein, B. and Kinzler, K.W. (eds), The Genetic Basis of Human Cancer. McGraw-Hill, New York, NY, pp. 317–332.

2 Joenje, H., Oostra, A.B., Wijker, M., di Summa, F.M., van Berkel, C.G.M., Rooimans, M.A., Ebell, W., van Weel, M., Pronk, J.C., Buchwald, M. et al. (1997) Evidence for at least eight Fanconi Anemia genes. Am. J. Hum. Genet., 61, 940–944.[Web of Science][Medline]

3 Strathdee, C.A., Gavish, H., Shannon, W.R. and Buchwald, M. (1992) Cloning of cDNAs for Fanconi’s anemia by functional complementation. Nature, 356, 763–767.[Medline]

4 Lo Ten Foe, J.R., Rooimans, M.A., Bosnoyan-Collins, L., Alon, N., Wijker, M., Parker, L., Lightfoot, J., Carreau, M., Callen, D.F., Savoia, A. et al. (1996) Expression cloning of a cDNA for the major Fanconi anemia gene, FAA. Nature Genet., 14, 320–323.[Web of Science][Medline]

5 The Fanconi Anemia/Breast Cancer Consortium (1996) Positional cloning of Fanconi anemia group A gene. Nature Genet., 14, 324–328.[Web of Science][Medline]

6 De Winter, J.P., Waisfisz, Q., Rooimans, M.A., van Berkel, C.G., Bosnoyan-Collins, L., Alon, N., Carreau, M., Bender, O., Demuth, I., Schindler, D. et al. (1998) The Fanconi anemia group G gene FANCG is identical with XRCC9. Nature Genet., 20, 281–283.[Web of Science][Medline]

7 De Winter, J.P., Rooimans, M.A., van der Weel, L., van Berkel, C.G., Alon, N., Bosnoyan-Collins, L., de Groot, J., Zhi, Y., Waisfisz, Q., Pronk, J.C. et al. (2000) The Fanconi anemia gene FANCF encodes a novel protein with homology to ROM. Nature Genet., 24, 15–16.[Web of Science][Medline]

8 Whitney, M., Thayer, M., Eeifsteck, C., Olson, S., Smith, L., Jakobs, P.M., Leach, R., Naylor, S., Joenje, H. and Grompe, M. (1995) Microcell mediated chromosome transfer maps the Fanconi anemia group D gene to chromosome 3p. Nature Genet., 11, 341–343.[Web of Science][Medline]

9 Waisfisz, Q, Saar, K., Morgan, N.V., Altay, C., Leegwater, P.A., de Winter, J.P., Komatsu, K., Evans, G.R., Wegner, R.-D., Reis, A. et al. (1999) The Fanconi anemia group E gene, FANCE, maps to chromosome 6p. Am. J. Hum. Genet., 64, 1400–1405.[Web of Science][Medline]

10 Bootsma, D., Kraemer, K.H., Cleaver, J.E. and Hoeijmakers, J.H.J. (1998) Nucleotide excision repair syndromes: xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. In Vogelstein, B. and Kinzler, K.W. (eds), The Genetic Basis of Human Cancer. McGraw-Hill, New York, NY, pp. 317–332.

11 Savitsky, K., Bar-Shira, A., Gilad, S., Rotman, G., Ziv, Y., Vanagaite, L., Tagle, D.A., Smith, S., Uziel, T., Sfez, S. et al. (1995) A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science, 268, 1749–1753.[Abstract/Free Full Text]

12 Ellis, N.A., Groden, J., Ye, T.Z., Straughen, J., Lennon, D.J., Ciocci, S., Proytcheva, M. and German, J. (1995) The Bloom’s syndrome gene product is homologous to RecQ helicases. Cell, 83, 655–666.[Web of Science][Medline]

13 Fishel, R., Lescoe, M.K., Rao, M.R., Copeland, N.G., Jenkins, N.A., Garber, J., Kane, M. and Kolodner, R. (1993) The human mutator gene homolog MSH2 and its association with hereditary nonpolyposis colon cancer. Cell, 75, 1027–1038.[Web of Science][Medline]

14 Papadopoulos, N., Nicolaides, N.C., Wei, Y.F., Ruben, S.M., Carter, K.C., Rosen, C.A., Haseltine, W.A., Fleischmann, R.D., Fraser, C.M., Adams, M.D. et al. (1994) Mutation of a mutL homolog in hereditary colon cancer. ­Science, 263, 1625–1629.[Abstract/Free Full Text]

15 Kupfer, G.M., Naf, D., Suliman, A., Pulsipher, M. and D’Andrea, A.D. (1997) The Fanconi anemia proteins, FAA and FAC interact to form a nuclear complex. Nature Genet., 17, 487–490.[Web of Science][Medline]

16 Garcia-Higuera, I., Kuang, Y., Naf, D., Wasik, J. and D’Andrea, A.D. (1999) Fanconi anemia proteins FANCA, FANCC and FANCG/XRCC9 interact in a functional nuclear complex. Mol. Cell. Biol., 19, 4866–4873.[Abstract/Free Full Text]

17 Waisfisz, Q., de Winter, J.P., Kruyt, F.A., de Groot, J., van der Weel, L., Dijkmans, L.M., Zhi, Y., Arwert, F., Scheper, R.J., Youssoufian, H. et al. (1999) A physical complex of the Fanconi anemia proteins FANCG/XRCC9 and FANCA. Proc. Natl Acad. Sci. USA, 96, 10320–10325.[Abstract/Free Full Text]

18 Savino, M., Ianzano, L., Strippoli, P., Ramenghi, U., Arslanian, A., Bagnara, G.P., Joenje, H., Zelante, L. and Savoia, A. (1997) Mutations of the Fanconi anemia group A gene (FAA) in Italian patients. Am. J. Hum. Genet., 61, 1246–1253.[Web of Science][Medline]

19 Wijker, M., Morgan, N.V., Herterich, S., van Berkel, C.G., Tipping, A.J., Gross, H.J., Gille, J.J., Pals, G., Savino, M., Altay, C. et al. (1999) Hetero­geneous spectrum of mutations in the Fanconi anaemia group A gene. Eur. J. Hum. Genet., 7, 52–61.[Web of Science][Medline]

20 Chen, M., Tomkins, D.J., Auerbach, W., McKerlie, C., Youssoufian, H., Liu, L., Gan, O., Carreau, M., Auerbach, A., Groves, T. et al. (1996) Inactivation of Fac in mice produces inducible chromosomal instability and reduced fertility reminiscent of Fanconi anaemia. Nature Genet., 12, 448–451.[Web of Science][Medline]

21 Whitney, M.A., Royle, G., Low, M.J., Kelly, M.A., Axthelm, M.K., Reifsteck, C., Olson, S., Braun, R.E., Heinrich, M.C., Rathbun, R.K. et al. (1996) Germ cell defects and hematopoietic hypersensitivity to {gamma}-interferon in mice with a targeted disruption of the Fanconi anemia C gene. Blood, 88, 49–58.[Abstract/Free Full Text]

22 Haneline, L.S., Gobbett, T.A., Ramani, R., Carreau, M., Buchwald, M., Yoder, M.C. and Clapp, D.W. (1999) Loss of FancC function results in decreased hematopoietic stem cell repopulating ability. Blood, 94, 1–8.[Abstract/Free Full Text]

23 Carreau, M., Gan, O.I., Liu, L., Doedens, M., McKerlie, C., Dick, J.E. and Buchwald, M. (1998) Bone marrow failure in the Fanconi anemia group C mouse model after DNA damage. Blood, 91, 2737–2744.[Abstract/Free Full Text]

24 Alter, B.P., Frissora, C.L., Halperin, D.S., Freedman, M.H., Chitkara, U., Alvarez, E., Lynch, L., Adler-Brecher, B. and Auerbach, A.D. (1991) Fanconi’s anaemia and pregnancy. Br. J. Haematol., 77, 410–418.[Web of Science][Medline]

25 Bargman, G.J., Shahidi, N.T., Gilbert, E.F. and Opitz, J.M. (1977) Studies of malformation syndromes of man XL VII: disappearance of spermatogonia in the Fanconi anemia syndrome. Eur. J. Pediat., 125, 163–168.[Web of Science][Medline]

26 Kinzler, K.W. and Vogelstein, B. (1998) Familial cancer syndromes: the role of caretakers and gatekeepers. In Vogelstein and Kinzler (eds), The Genetic Basis of Human Cancer. McGraw-Hill, NewYork, NY, pp. 241–242.

27 Barlow, C., Liyanage, M., Moens, P.B., Tarsounas, M., Nagashima, K., Brown, K., Rottinghaus, S., Jackson, S.P., Tagle, D. Ried, T. and Wynshaw-Boris, A. (1998) Atm deficiency results in severe meiotic disruption as early as leptonema of prophase I. Development, 125, 4007–4017.[Abstract]

28 Baker, S.M., Plug, A.W., Prolla, T.A., Bronner, C.E., Harris, A.C., Yao, X., Christi, D.M., Monell, C., Arnheim, N., Bradley, A. et al. (1996) Involvement of mouse Mlh1 in DNA mismatch repair and meiotic crossing over. Nature Genet., 13, 336–342.[Web of Science][Medline]

29 Baker, S.M., Bronner, C.E., Zhang, L., Plug, A.W., Robatzek, M., Warren, G., Elliott, E.A., Yu, J., Ashley, T., Arnheim, N. et al. (1995) Male mice defective in the DNA mismatch repair gene PMS2 exhibit abnormal chromosome synapsis in meiosis. Cell, 82, 309–319.[Web of Science][Medline]

30 Walpita, D., Plug, A.W., Neff, N.F., German, J. and Ashley, T. (1999) Bloom’s syndrome protein, BLM, colocalizes with replication protein A in meiotic prophase nuclei of mammalian spermatocytes. Proc. Natl Acad. Sci. USA, 96, 5622–5627.[Abstract/Free Full Text]

31 Vrugt, H.J. van de, Cheng, N.C., de Vries, Y., Rooimans, M.A., de Groot, J., Scheper, R.J., Zhi, Y., Hoatlin, M.E., Joenje, H. and Arwert, F. (2000) Cloning and characterization of the murine Fanconi anemia group A gene: Fanca protein is expressed in lymphoid tissues, testis and ovary. Mamm. Genome, in press.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
S. T. Bakker, H. J. van de Vrugt, M. A. Rooimans, A. B. Oostra, J. Steltenpool, E. Delzenne-Goette, A. van der Wal, M. van der Valk, H. Joenje, H. te Riele, et al.
Fancm-deficient mice reveal unique features of Fanconi anemia complementation group M
Hum. Mol. Genet., September 15, 2009; 18(18): 3484 - 3495.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
M. D. Milsom, A. W. Lee, Y. Zheng, and J. A. Cancelas
Fanca-/- hematopoietic stem cells demonstrate a mobilization defect which can be overcome by administration of the Rac inhibitor NSC23766
Haematologica, July 1, 2009; 94(7): 1011 - 1015.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Rio, N. W. Meza, A. Gonzalez-Murillo, S. Navarro, L. Alvarez, J. Surralles, M. Castella, G. Guenechea, J. C. Segovia, H. Hanenberg, et al.
In vivo proliferation advantage of genetically corrected hematopoietic stem cells in a mouse model of Fanconi anemia FA-D1
Blood, December 15, 2008; 112(13): 4853 - 4861.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Briot, G. Mace-Aime, F. Subra, and F. Rosselli
Aberrant activation of stress-response pathways leads to TNF-{alpha} oversecretion in Fanconi anemia
Blood, February 15, 2008; 111(4): 1913 - 1923.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Giri, D. L. Batista, B. P. Alter, and C. A. Stratakis
Endocrine Abnormalities in Patients with Fanconi Anemia
J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2624 - 2631.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Sharma, D. J. Stumpo, A. S. Balajee, C. B. Bock, P. M. Lansdorp, R. M. Brosh Jr., and P. J. Blackshear
RECQL, a Member of the RecQ Family of DNA Helicases, Suppresses Chromosomal Instability
Mol. Cell. Biol., March 1, 2007; 27(5): 1784 - 1794.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. Gallmeier and S. E. Kern
Targeting Fanconi Anemia/BRCA2 Pathway Defects in Cancer: The Significance of Preclinical Pharmacogenomic Models
Clin. Cancer Res., January 1, 2007; 13(1): 4 - 10.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Si, S. Ciccone, F.-C. Yang, J. Yuan, D. Zeng, S. Chen, H. J. van de Vrugt, J. Critser, F. Arwert, L. S. Haneline, et al.
Continuous in vivo infusion of interferon-gamma (IFN-{gamma}) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice
Blood, December 15, 2006; 108(13): 4283 - 4287.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Larder, D. Karali, N. Nelson, and P. Brown
Fanconi Anemia a Is a Nucleocytoplasmic Shuttling Molecule Required for Gonadotropin-Releasing Hormone (GnRH) Transduction of the GnRH Receptor
Endocrinology, December 1, 2006; 147(12): 5676 - 5689.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
K.R. Barnett, C. Schilling, C.R. Greenfeld, D. Tomic, and J.A. Flaws
Ovarian follicle development and transgenic mouse models
Hum. Reprod. Update, September 1, 2006; 12(5): 537 - 555.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Neff, B. C. Beard, and H.-P. Kiem
Survival of the fittest: in vivo selection and stem cell gene therapy
Blood, March 1, 2006; 107(5): 1751 - 1760.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Bijangi-Vishehsaraei, M. R. Saadatzadeh, A. Werne, K. A. W. McKenzie, R. Kapur, H. Ichijo, and L. S. Haneline
Enhanced TNF-{alpha}-induced apoptosis in Fanconi anemia type C-deficient cells is dependent on apoptosis signal-regulating kinase 1
Blood, December 15, 2005; 106(13): 4124 - 4130.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Y.-G. Yang, Z. Herceg, K. Nakanishi, I. Demuth, C. Piccoli, J. Michelon, G. Hildebrand, M. Jasin, M. Digweed, and Z.-Q. Wang
The Fanconi anemia group A protein modulates homologous repair of DNA double-strand breaks in mammalian cells
Carcinogenesis, October 1, 2005; 26(10): 1731 - 1740.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Dendouga, H. Gao, D. Moechars, M. Janicot, J. Vialard, and C. H. McGowan
Disruption of Murine Mus81 Increases Genomic Instability and DNA Damage Sensitivity but Does Not Promote Tumorigenesis
Mol. Cell. Biol., September 1, 2005; 25(17): 7569 - 7579.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Houghtaling, L. Granville, Y. Akkari, Y. Torimaru, S. Olson, M. Finegold, and M. Grompe
Heterozygosity for p53 (Trp53+/-) Accelerates Epithelial Tumor Formation in Fanconi Anemia Complementation Group D2 (Fancd2) Knockout Mice
Cancer Res., January 1, 2005; 65(1): 85 - 91.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Larder, L. Chang, M. Clinton, and P. Brown
Gonadotropin-Releasing Hormone Regulates Expression of the DNA Damage Repair Gene, Fanconi anemia A, in Pituitary Gonadotroph Cells
Biol Reprod, September 1, 2004; 71(3): 828 - 836.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. C.Y. Wong, N. Alon, C. Mckerlie, J. R. Huang, M. S. Meyn, and M. Buchwald
Targeted disruption of exons 1 to 6 of the Fanconi Anemia group A gene leads to growth retardation, strain-specific microphthalmia, meiotic defects and primordial germ cell hypoplasia
Hum. Mol. Genet., August 15, 2003; 12(16): 2063 - 2076.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. Houghtaling, C. Timmers, M. Noll, M. J. Finegold, S. N. Jones, M. S. Meyn, and M. Grompe
Epithelial cancer in Fanconi anemia complementation group D2 (Fancd2) knockout mice
Genes & Dev., August 15, 2003; 17(16): 2021 - 2035.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
N. Shima, S. A. Hartford, T. Duffy, L. A. Wilson, K. J. Schimenti, and J. C. Schimenti
Phenotype-Based Identification of Mouse Chromosome Instability Mutants
Genetics, March 1, 2003; 163(3): 1031 - 1040.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
C. A. Walter, R. B. Walter, and J. R. McCarrey
Germline Genomes--A Biological Fountain of Youth?
Sci. Aging Knowl. Environ., February 26, 2003; 2003(8): pe4 - 4.
[Abstract] [Full Text]


Home page
J. Med. Genet.Home page
M D Tischkowitz and S V Hodgson
Fanconi anaemia
J. Med. Genet., January 1, 2003; 40(1): 1 - 10.
[Abstract] [Full Text]


Home page
BloodHome page
D. S. Grenda, S. E. Johnson, J. R. Mayer, M. L. McLemore, K. F. Benson, M. Horwitz, and D. C. Link
Mice expressing a neutrophil elastase mutation derived from patients with severe congenital neutropenia have normal granulopoiesis
Blood, October 16, 2002; 100(9): 3221 - 3228.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Rio, J. C. Segovia, H. Hanenberg, J. A. Casado, J. Martinez, K. Gottsche, N. C. Cheng, H. J. Van de Vrugt, F. Arwert, H. Joenje, et al.
In vitro phenotypic correction of hematopoietic progenitors from Fanconi anemia group A knockout mice
Blood, August 28, 2002; 100(6): 2032 - 2039.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Koomen, N. C. Cheng, H. J. van de Vrugt, B. C. Godthelp, M. A. van der Valk, A. B. Oostra, M. Z. Zdzienicka, H. Joenje, and F. Arwert
Reduced fertility and hypersensitivity to mitomycin C characterize Fancg/Xrcc9 null mice
Hum. Mol. Genet., February 1, 2002; 11(3): 273 - 281.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Yang, Y. Kuang, R. M. De Oca, T. Hays, L. Moreau, N. Lu, B. Seed, and A. D. D'Andrea
Targeted disruption of the murine Fanconi anemia gene, Fancg/Xrcc9
Blood, December 1, 2001; 98(12): 3435 - 3440.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (68)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cheng, N. C.
Right arrow Articles by Arwert, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, N. C.
Right arrow Articles by Arwert, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?