Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (51)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Grayson, C.
Right arrow Articles by Trump, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grayson, C.
Right arrow Articles by Trump, D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2000, Vol. 9, No. 12 1873-1879
© 2000 Oxford University Press

Retinoschisin, the X-linked retinoschisis protein, is a secreted photoreceptor protein, and is expressed and released by Weri–Rb1 cells

Celene Grayson, Silvia N.M. Reid1, Juliet A. Ellis, Adam Rutherford2, Jane C. Sowden2, John R.W. Yates, Debora B. Farber1 and Dorothy Trump+

Department of Medical Genetics, The Wellcome Trust Centre for Molecular Mechanisms in Disease, Cambridge Institute for Medical Research, University of Cambridge, Addenbrookes Hospital, Hills Road, Cambridge CB2 2QQ, UK, 1Jules Stein Institute, UCLA School of Medicine, Los Angeles, CA, USA and 2Developmental Biology Unit, Institute of Child Health, University College London, London, UK

Received 10 April 2000; Revised and Accepted 19 May 2000.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
X-linked retinoschisis is characterized by microcystic-like changes of the macular region and schisis within the inner retinal layers, leading to visual deterioration in males. Many missense and protein-truncating mutations of the causative gene RS1 have now been identified and are thought to be inactivating. RS1 encodes a 224 amino acid protein, retinoschisin, which contains a discoidin domain but is of unknown function. We have generated a polyclonal antibody against a peptide from a unique region within retinoschisin, which detects a protein of ~28 kDa in retinal samples reduced with dithiothreitol, but multimers sized >40 kDa under non-reducing conditions. A screen of human tissues with this antibody reveals retinoschisin to be retina specific and the antibody detects a protein of similar size in bovine and murine retinae. We investigated the expression pattern in the retina of both RS1 mRNA (using in situ hybridization with riboprobes) and retinoschisin (using immunohistochemistry). The antisense riboprobe detected RS1 mRNA only in the photoreceptor layer but the protein product of the gene was present both in the photoreceptors and within the inner portions of the retina. Furthermore, differentiated retinoblastoma cells (Weri–Rb1 cells) were found to express RS1 mRNA and to release retinoschisin. These results suggest that retinoschisin is released by photo­receptors and has functions within the inner retinal layers. Thus, X-linked retinoschisis is caused by abnormalities in a putative secreted photoreceptor protein and is the first example of a secreted photo­receptor protein associated with a retinal dystrophy.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
X-linked juvenile retinoschisis is the leading cause of juvenile macular degeneration in males (1) and is characterized by schisis (splitting) of the inner retinal layers [inner limiting membrane (ILM) and nerve fibre layers] resulting in cystic degeneration ‘retinoschisis’ of the central retina (2,3). Peripheral retinal lesions are also present in ~50% of cases (3). Clinically the condition is variable, with most patients presenting with progressive visual impairment between 5 and 10 years of age, but a proportion of patients present in infancy with squint, nystagmus and bilateral and highly elevated bullous retinoschisis (4,5). In the later stages of retinoschisis complications include vitreal haemorrhage, choroidal sclerosis, retinal detachment and in rare cases, retinal atrophy resulting in blindness (6).

Previously it had been suggested that an underlying defect in the Müller cell, the retinal glial cell, could explain the combination of features (2,7–9). Histological reports describe the characteristic abnormality as a schisis within the superficial retinal layers, the ILM, the nerve fibre layer and the ganglion cell layer (2,10,11). The inner leaflet of the schisis consists of ILM, fragments of Müller cells and blood vessels and a thinned ganglion cell layer. Degeneration of the overlying photoreceptors is also observed (11). The schisis cavity and surrounding retina are described as containing an amorphous eosinophilic PAS-positive filamentous material thought to originate from Müller cells (2,11). The electroretinogram of patients affected with retinoschisis shows a reduced b-wave [suggesting an inner retinal abnormality (3)], consistent with a Müller cell abnormality. Furthermore, these patients exhibit the ‘Mizou phenomenon’, a change in colour of the dark-adapted retina from red to gold shortly after exposure to light, which is thought to be due to a potassium imbalance in the inner retina (9). Photoreceptor hyperpolarization occurs in response to light leading to a rise in extracellular potassium, which is distributed to the vitreous fluid via the Müller cells. Thus, an abnormality in these cells might lead to a build up of potassium ions in the extracellular space (9).

The gene causing X-linked juvenile retinoschisis, RS1, maps to Xp22 and was identified recently (12) after an extensive positional cloning effort by several groups (13–15). The mouse orthologue gene has also been cloned (16). RS1 has six exons and encodes a 224 amino acid protein, retinoschisin. The function of retinoschisin is unknown. Almost the entire protein consists of a discoidin domain, and disease-causing mutations are clustered in regions that encode this domain, suggesting that it is crucial for the normal function of retinoschisin (17). Discoidin domains are present in extracellular or trans­membrane proteins implicated in cell adhesion or cell–cell interactions (18). These proteins include, for example: (i) neuropilin I and II (receptors for the semaphorin family of cell adhesion molecules) (19); (ii) neurexin IV/caspr (axon–glial interactions in septate junctions) (20); (iii) P47 (binding of sperm to the zona pellucida during fertilization) (21); (iv) del-1 (a ligand for the {alpha}Vß3 integrin receptor which induces integrin signalling and angiogenesis) (22); and (v) the receptor tyrosine kinases DDR1 and DDR2 (for which collagen acts as a ligand) (23). Therefore, it has been speculated that retinoschisin could be a secreted protein involved in either cell–cell interaction or adhesion and that with this function it could contribute to the maintenance of the cellular architecture of the retina (16). In mice the retinoschisis gene is expressed in the photoreceptors which are located far from the site of pathology (16). This cell expression needs to be confirmed in the human retina. Since the schisis occurs at a site other than the site of synthesis of retinoschisin, this suggests that the protein is secreted by the photoreceptors. The purpose of this study was to investigate these issues. Our results are consistent with the notion that retinoschisin is a secreted photoreceptor protein and that it performs a function within the inner retina.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Affinity-purified antibody against retinoschisin
Rabbit polyclonal antiserum was raised against peptide STEDEGEDPWYQKA (amino acid residues 24–37) conjugated to keyhole limpet haemocyanin (KLH) and affinity-­purified (24). The resulting antibody RS24–37 was characterized against human, bovine and murine retinal tissues. In samples of human retinal proteins reduced with dithiothreitol (DTT), RS24–37 recognized a protein of ~28 kDa but under non-reducing conditions it bound multimers of >40 kDa (Fig. 1A). Pre-immune serum showed no cross reactivity (data not shown), and the band was not detected when RS24–37 was incubated with the peptide against which it was generated prior to immunoblotting (Fig. 1A). These results indicate that the bands detected by RS24–37 were specific. RS24–37 also reacted with specific proteins of similar sizes from reduced bovine and murine retinal samples with proteins of much higher molecular weight from non-reduced samples (data not shown). Immmunoblotting with RS24–37 against a panel of 10 other human tissues, including ovary, cerebellum, cerebral cortex, lung, liver, placenta, spleen, kidney, adrenal and heart, confirmed and extended this finding. RS24–37 detected a specific band only from retinal tissue (Fig. 1B). This confirmed previous analyses using cDNA RS1 probes and multi-tissue northern blots which revealed mRNA expression in retina only (12,16).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. (A) Immunoblot of human retinal proteins reacted with antibody RS24–37. Lanes 1 and 2, samples without and with the addition of DTT, respectively. In the reduced samples the antibody recognizes a predominant band at ~28 kDa but in the non-reduced sample it recognizes multimers sized >40 kDa. None of these bands were detected when the antiserum had been adsorbed by the peptide prior to immunoblotting(lanes 3 and 4). (B) Immunoblot of proteins from different human tissues using RS24–37. This antibody recognizes a specific band in retina only (upper panel). An antibody against actin was used together with RS24–37, which had been previously adsorbed by the peptide that was used to generate it (lower panel). Actin is detected in all lanes and the specific retinal band is no longer detected by RS24–37.

 
Retinoschisin expression pattern within the retina
The expression pattern of the RS1 mRNA and its encoded protein, retinoschisin, were investigated using retinal sections from adult human and mouse [the gene is first expressed at day 5 postnatally in mouse (16)]. Digoxigenin-labelled sense and antisense riboprobes were generated from the full-length RS1 cDNA (including the open reading frame of 642 bp). Consistent with previous findings in mice (16), staining in human retina was detected only within the photoreceptor cell layer and was most prominent within the inner segments of the photoreceptors (Fig. 2A). It was absent from the inner plexiform layers (where the retinoschisis pathology is most prominent) and the inner nuclear layer [which contains the cell bodies of the Müller cells, previously implicated in retinoschisis pathology (3–5,11)]. The pattern of expression was similar in mouse and in human samples (Fig. 2A). No staining was detected with the sense riboprobe.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 2. In situ hybridization of retina with digoxigenin-labelled antisense RS1 riboprobes. (A) mRNA transcripts are readily detectable in the inner segments of the photoreceptors only in adult human (iv) and mouse (ii) (shown for comparison). (i) and (iii) are adjacent sections from the same specimens stained with haematoxylin and eosin to show the histology, and labelled as follows: rpe, retinal pigment epithelium; os, outer segment of photoreceptor; is, inner segment of photoreceptor; onl, outer nuclear layer; opl, outer plexiform layer; inl, inner nuclear layer; ipl, inner plexiform layer; gcl, ganglion cell layer. (B) Immunohistochemistry in mouse and human retina using RS24–37. Immunolabelling is found in the inner segment of the photoreceptors, the inner nuclear layer, the inner plexiform layer and the ganglion cell layer in both mouse and human peripheral sections. The staining in the inner nuclear layer is patchy. In the human macula, there is patchy staining in both nuclear layers and more homogeneous staining in the inner plexiform layer. The immunoreaction was not observed when the primary antibody was omitted, using pre-immune serum or the peptide-epitope pre-absorbed RS24–37.

 
Immunohistochemistry
In mice, immunolabelling with RS24–37 was found in the inner segment of the photoreceptors, the inner nuclear layer, the inner plexiform layer and the ganglion cell layer. The staining in the inner nuclear layer was patchy (Fig. 2B). This pattern was also found in the peripheral portion of the human retina (Fig. 2B). At the macula, there was patchy immunoreactivity in both the outer and inner nuclear layers and more homogeneous staining in the inner plexiform layer (Fig. 2B). No reaction was observed when the primary antibody was omitted (Fig. 2B) or when pre-immune serum or serum pre-absorbed with the original peptide was used.

Expression of retinoschisin in Weri–Rb1 cells
Expression of retinoschisin was investigated in the Weri–Rb1 cell line using a combination of RT–PCR with exonic primers from within the RS1 gene (designed so that the products would span introns) and immunoblotting with the antibody RS24–37 (to detect the presence of the protein within the Weri–Rb1 cells and/or in the media in which cells had grown). Retinoblastoma cells are precursors of photoreceptors and are an appropriate in vitro photoreceptor cell model since photoreceptor cell lines are not available (25).

RT–PCR using RNA from undifferentiated Weri–Rb1 cells and two sets of primers [RSPEP10 and RSPEP5 from exons 2 and 4, respectively (product size 262 bp), and RSPEP3 and RSPEP6 from exons 4 and 6, respectively (product size 406 bp)] gave products of the expected size. Figure 3 shows only the products from primers RSPEP10 and RSPEP5. These results indicate that the RS1 gene is expressed in the Weri–Rb1 cell line.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 3. (A) RT–PCR of Weri–Rb1 cells using primers from RS1 exons 2 and 4. Lanes 1–3, RT–PCR using oligo(dT) primers for the initial RT, Weri–Rb1 cells (lane1), water control (lane 2), Weri–Rb1 cells without RT 9 (lane 3); lanes 4–6, RT–PCR using random hexamer primers for RT, Weri–Rb1 cells (lane 4), water control (lane 5), Weri–Rb1 cells without RT (lane 6); lane 7, RS1 cDNA; lane 8, genomic DNA; lane 9, water; lane 10, 1 kb ladder. Bands of the expected size (262 bp) were observed with Weri–Rb1 cells and the cDNA only, and not in any negative control, indicating that the cell line expresses the RS1 gene. (B) Immunoblot containing proteins of theWeri–Rb1 cells reacted with RS24–37: results obtained with proteins of human retina (Hum Ret), Weri–Rb1 cells undifferentiated (UD) and differentiated (D), medium from Weri–Rb1 cells undifferentiated (UD) and differentiated (D), and unused medium used as control (control). RS24–37 recognizes a band of ~28 kDa in both undifferentiated and differentiated Weri–Rb1 cells and in medium from each. No band was observed in control medium. Thus, retinoschisin is present in both undifferentiated and differentiated Weri–Rb1 cells and is released from the cells into the medium.

 
Undifferentiated and differentiated Weri–Rb1 cells were investigated by immunoblotting with the RS24–37 antibody. Undifferentiated Weri–Rb1 cells were grown in suspension and differentiation was induced by coating culture dishes with poly-D-lysine and fibronectin to induce adhesion and adding di-butyryl cyclic AMP (DBcAMP) to the culture media. Differentiation was detected by a change in morphology of the cells. Antibody RS24–37 detected a specific band of ~28 kDa in both cell lysates and conditioned medium from differentiated and undifferentiated Weri–Rb1 cells (Fig. 3B) indicating that retinoschisin is secreted from these cells. A more intensely labelled band in the lanes loaded with proteins isolated from the differentiated cells showed that expression of retinoschisin appeared to be enhanced by cell differentiation (Fig. 3). The antibody detected a clean monomeric band in the Weri–Rb1 cells and the media which contrasts with the results from reduced retina in the same western blot showing additional bands of higher molecular weight and may indicate differences in oligomerization.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The identification of the retinoschisis gene (12) enabled computer analysis of its sequence and of that of the predicted protein. These analyses suggested that retinoschisin could be a secreted globular protein. Moreover, they showed that its sequence contains: a putative signal peptide with an endopeptidase cleavage site; 10 cysteine residues which may form disulphide bridges (rare in intracellular proteins); and a discoidin domain which functions in the extracellular environment in other proteins (18). The disease-causing mutations described in the RS1 gene are most commonly missense mutations and cluster within the discoidin domain residues (17) of retinoschisin, suggesting that this functional domain of the protein is responsible for interaction with other proteins.

The results of our studies confirm that the expression of the RS1 gene is restricted to photoreceptors in human retinae. They also suggest that retinoschisin is produced by photoreceptors in adult retinae and that it is secreted by these cells. Thus, the intriguing result showing RS1 expression within photo­receptors at some distance from the site of retinoschisis pathology can be explained by secretion of retinoschisin into these layers.

The role of retinoschisin within the inner retina has yet to be established. Proteins containing discoidin domains are thought to be involved with cell–cell interactions, and discoidin, in Dictyostelium discoideum, from which this class of proteins drives its name, is a lectin involved in cell aggregation (18,23,26). The discoidin domain is present in a variety of proteins but its interactions with ligands (either other protein domains or phospholipids) have not been fully elucidated. The discoidin domain receptors (DDR1 and DDR2), with extracellular discoidin domains and intracellular tyrosine kinase domains, are known to be activated by collagens, although the discoidin-binding domains within the collagen molecules are not yet defined (27,28). Blood coagulation factors V and VIII contain discoidin domains which are thought to interact with phospholipids on the surface of platelets (29), and the secreted protein del1, which contains two discoidin domains, interacts with the {alpha}Vß3 integrin receptor (although this interaction is dependent on the RGD motif within an EGF repeat rather than the discoidin domain (30). Retinoschisin is a small protein consisting almost entirely of one discoidin domain (and no other recognized domains), and thus elucidating its interactions with cell surface receptors or the extracellular matrix may yield information applicable to the whole family of proteins about how this domain functions. The results we discuss here, which are consistent with secretion and interactions within the inner retina, are an important first stage of this work.

The pathological changes described in X-linked retinoschisis have previously been attributed to abnormalities in the Müller glial cell. The interaction of retinoschisin with a Müller cell receptor such as an integrin receptor would be in keeping with its discoidin domain and an abnormality in this interaction could account for all the recognized findings. Alternatively, the pathology could be occurring secondarily to architectural disruption within the inner retinal layers leading to abnormal Müller and bipolar cell function resulting in, for example, a reduced b-wave in the electroretinogram. This may be the case if retinoschisin interacts with components of the extracellular matrix and could explain the detection of the high molecular weight bands when immunoblotting retinal extracts but bands of the expected size of retinoschisin (in keeping with monomers) when investigating protein secreted by Weri–Rb1 cells. The high molecular weight bands detected in retinal extracts might represent protein complexes in which the other proteins originate from retinal cells distinct from photoreceptors (or Weri–Rb1 cells). Further investigation of these protein inter­actions may give insight into the processes leading to cell adhesion and architectural integrity within these retinal layers. Furthermore, investigation of mutant retinoschisin will determine firstly whether it is successfully secreted from photo­receptors and subsequently targeted appropriately within the retina, or secondly whether the different mutations interfere with crucial protein–protein interactions within the inner retinal layers by interfering with the structure of the discoidin domain.

In conclusion, retinoschisin, the protein causing X-linked retinoschisis, is the first example of a secreted protein leading to retinal dystrophy. Further evaluation of its function may give insight into the processes leading to cell adhesion and architectural integrity within the retina.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In situ hybridization
Sections (8 µm) were cut from paraffin embedded mouse retina and mounted on glass slides. The sections were dewaxed with xylene (twice for 10 min at room temperature) and the following steps used for preparation of the sections. The sections were rehydrated for 2 min in each of seven ethanol solutions at decreasing concentrations (100 to 30%), washed with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde at room temperature for 20 min, treated for 10 min with 0.2 M HCl2, rinsed in PBS, acetylated with 0.5% acetic anhydride (10 min at room temperature) rinsed with PBS, treated with proteinase K (50 µg/ml in PBS supplemented with 0.02 M CaCl2 for 10 min at 37°C), washed in PBS and dehydrated for 2 min each in solutions of increasing ethanol concentration. The sections were then dried.

Sense and antisense probes were generated from a full-length RS1 cDNA clone in Bluescript KS+ (a generous gift of Dr B.H.F. Weber, Universität Würzburg, Germany). Plasmid DNA was linearized using either NotI or HindIII and digoxigenin-labelled riboprobes synthesized using T7 or T3 RNA polymerase (Boehringer Mannheim, Lewes, UK), respectively.

For hybridization, probes were diluted in hybridization buffer (2x SSC, 5% dextran, 0.2% Marvel, 50% deionized formamide) and denatured at 80°C for 2 min. Hybridization reactions were left overnight at 60°C and then washed in decreasing concentrations of 2x SSC at 60°C for 45 min, 1x SSC 50% formamide at 60°C for 45 min and two 10 min washes in 1x and 0.5x SSC, respectively, at room temperature. Signals were detected by firstly soaking in buffer 1 (100 mM Tris–HCl pH 7.5, 100 mM NaCl, 2 mM MgCl2, 0.05% Triton X-100, 0.3% Tween), blocking in buffer 2 for 30 min [0.5–1% blocking reagent (Boehringer Mannheim)] then incubating with 400 µl of anti-digoxigenin alkaline phosphatase-conjugated antibody diluted to 1:500 in blocking buffer for 1 h. Sections were washed once in buffer 1 and soaked in buffer 3 for 5 min (100 mM Tris–HCl pH 9.5, 100 mM NaCl, 50 mM MgCl2). Sections were incubated with colour change solution (4.5 µl of nitroblue tetrazolium salt, 3.5 µl of 3-bromo-3-indoyl-phosphate in 1 ml of buffer 3) in darkness until colour development and the slides mounted.

Antibody, SDS–PAGE and immunoblotting
Rabbit polyclonal antiserum was raised against peptide STEDEGEDPWYQKA (amino acid residues 24–37) conjugated to KLH (Genosys Biotechnologies, Pampisford, UK) and affinity-purified on the peptide (24), yielding antibody RS24–37. The Pierce (Rockford, IL) BCA kit was used to assay protein levels in tissue and cell samples to ensure even loading on gels. Protein samples were prepared by homogenization of tissues or cells in sample buffer (200 mM Tris–HCl, 5 mM EDTA, 1 M sucrose, 0.1% bromophenol blue) containing 4% SDS (with the addition of DTT to a final concentration of 10 mM for reduced samples), subjected to SDS–PAGE on 15% gels and electroblotted on to ECL nitrocellulose (Amersham, Little Chalfont, UK). Following blocking in 6% Marvel/1x PBS/0.1% Tween 20 (blocking buffer) for 1 h at room temperature blots were hybridized overnight with the affinity-purified primary antibody RS24–37 (1:1000 dilution) at 4°C. Subsequently, anti-rabbit polyclonal secondary antibody conjugated to peroxidase (Amersham) was used at 1:3000 for 2 h at room temperature. Bands were visualized using enhanced chemiluminescence (Amersham). When pre-adsorbed RS24–37 was used as a probe, 1 µg/ml of the peptide used to generate the antibody was incubated with RS24–37 at 1:750 dilution for 4 h on ice in blocking buffer. These blots were then reacted with anti-actin antibody (Sigma, Poole, UK) at a dilution of 1:2000.

Immunohistochemistry
After deep anaesthetic, mice were perfused with lactated Ringer’s (20–50 ml) and fixative (4% paraformaldehyde in 0.066 M PBS at pH 7.4, 100 ml). After dissection, retinae were further fixed in fixative, cryoprotected in 30% sucrose–PBS (pH 7.4, 4°C), frozen on dry ice and stored at –80°C. Paraffin embedded human retina sections were gifts of Prof. Philip Luthert (Institute of Ophthalmology, London, UK). Cryostat mouse retina sections (10 µm) were mounted on glass slides, permeabilized with cold methanol (–80°C, 3 min), blocked with 2% fish gelatin (1 h, room temperature), incubated with RS24–37 in 2% fish gelatin (1:1000, 4°C, overnight), and finally with biotin-conjugated goat anti-rabbit IgG in 2% fish gelatin (1:200, 25°C, 1 h). The immunoreaction was visualized with the biotin–avidin–peroxidase (Vector Laboratories, Burlingame, CA) and 3',3'-diaminobenzidine (DAB, 1 mg/ml; H2O2, 0.03%) (Sigma). The human retina sections were de-paraffined successively with xylene, 100% ethanol and 95% ethanol before proceeding with the immunohistochemistry. Control (omitting the primary antiserum) was included included in each experiment. To verify the specificity of the immunostaining, retina sections were also stained with pre-immune serum and RS24–37 pre-absorbed with the peptide epitope (25 µg/µl).

RT–PCR
RNA was extracted from undifferentiated cells using the RNeasy kit from Qiagen (Crawley, UK), following the ­manufacturer’s instructions. RT–PCR was performed using SuperScript Preamplification System (Gibco BRL, Paisley, UK) to obtain the first strand cDNA with either random hexamer primers or oligo(dT) primers as per the manu­facturer’s protocol. PCR was performed using exonic primers RSPEP10 (TTTTGAATTCCATATGTCTACCGAGGATG­AAGGC) and RSPEP5 (TTTTGTCGACCTCGAGTCAGTT­TGCAGTCCACGA) from exons 2 and 4, respectively (product size 262 bp), and primers RSPEP3 (TTTTGGATCCCATATGGCCCGGCTCAACAGTCAA) and RSPEP6 (TTTTGTCGACCTCGAGTCCGGCACAGTTGC) from exons 4 and 6, respectively. The following conditions were used: 94°C for 5 min, then 40 cycles at 94°C for 30 s, 55°C for 30 s, 72°C for 1 min and a final extension of 72°C for 10 min.

Retinoblastoma cell culture
Weri–Rb1 human retinoblastoma cells (31) were obtained from the American Type Tissue Culture Collection (Manassas, VA). Cells were maintained in suspension culture in RPMI 1640 (Gibco BRL) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U penicillin/ml and 100 µg streptomycin/ml (Sigma), with medium changes every 2–3 days. For analysis by western blotting, cells were transferred to 30 mm six-well dishes for attachment and differentiation. The dishes were treated with 0.2 mg/ml poly-D-lysine (Sigma) for 30 min at room temperature and rinsed with distilled water before 5 µg/ml fibronectin (Sigma) was added for 1 h at room temperature. After this time the excess fibronectin was removed and the cells were seeded directly on to the adhesive surface at a density of 1 x 105 cells/well. Cells were grown as monolayer cultures for 7 days before the addition of DBcAMP (Sigma) at a final concentration of 2 mM. DBcAMP was readministered every 2–3 days with the medium changes. A sample of the medium in which the cells had grown was taken at these times. Differentiation was assessed by the change in morphology of the cells (25). After 9 days of treatment the cells were gently scraped off the bottom of the wells and prepared for western blot analysis or determination of protein concentration.


    ACKNOWLEDGEMENTS
 
We are very grateful to Prof. P. Luthert (Institute of Ophthalmology, UK) for providing human retina samples and to Dr Bernard H.F. Weber (Universität Würzburg, Germany) for providing the RS1 cDNA. We are grateful for financial support from the Wellcome Trust (D.T. and C.G.), the Foundation Fighting Blindness and National Institutes of Health grant EY08285 (D.B.F. and S.N.M.R.), the Muscular Dystrophy Campaign (J.A.E.) and the Medical Research Council, UK (A.R. and J.C.S.). D.T. was a Wellcome Clinician Scientist Fellow and D.B.F. is the recipient of a Research to Prevent Blindness Senior Investigator’s Award.


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +44 1223 331139; Fax: +44 1223 331206; Email: dorothy.trump@cimr.cam.ac.uk Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Forsius, H., Krause, U., Helve, J., Voupala, V., Mustonen, E., Vainio-Mattila, B. and Fellman, J. (1973) Visual acuity in 183 cases of X-­chromosomal retinoschisis. Can. J. Ophthalmol., 8, 385–393.[Web of Science][Medline]

2 Condon, G.P., Brownstein, S., Wang, N.S., Kearns, J.A. and Ewing, C.C. (1986) Congenital hereditary (juvenile X-linked) retinoschisis. Histopathologic and ultrastructural findings in three eyes. Arch. Ophthalmol., 104, 576–583.[Abstract/Free Full Text]

3 George, N.D., Yates, J.R. and Moore, A.T. (1995) X-liked retinoschisis. Br. J. Ophthalmol., 79, 697–702.[Free Full Text]

4 George, N.D., Yates, J.R., Bradshaw, K. and Moore, A.T. (1995) Infantile presentation of X linked retinoschisis. Br. J. Ophthalmol., 79, 653–657.[Abstract/Free Full Text]

5 George, N.D., Yates, J.R., Bradshaw, K. and Moore, A.T. (1996) Clinical features in affected males with X-linked retinoschisis. Arch. Ophthalmol., 114, 274–280.[Abstract/Free Full Text]

6 Kraushar, M.F., Stepens, C.L., Kaplan, J.A. and Freeman, H.M. (1972) Congenital retinoschisis. In Bellows, J.G. (ed.), Contemporary Ophthalmology Honoring Sir Stewart Duke-Elder. Williams and Wilkins, Baltimore, MD, pp. 265–290.

7 Tanino, T., Katsumi, O. and Hirose, T. (1985) Electrophysiological similarities between two eyes with X-linked recessive retinoschisis. Doc. Ophthalmol., 60, 149–161.[Web of Science][Medline]

8 Peachey, N.S., Fishman, G.A., Derlacki, D.J. and Brigell, M.G. (1987) Psychophysical and electroretinographic findings in X-linked juvenile retinoschisis. Arch. Ophthalmol., 105, 513–516.[Abstract/Free Full Text]

9 de Jong, P.T., Zrenner, E., van Meel, G.J., Keunen, J.E. and van Norren, D. (1991) Mizuo phenomenon in X-linked retinoschisis. Pathogenesis of the Mizuo phenomenon. Arch. Ophthalmol., 109, 1104–1108.[Abstract/Free Full Text]

10 Manschot, W.A. (1972) Pathology of hereditary juvenile retinoschisis. Arch. Ophthalmol., 88, 131–137.[Abstract/Free Full Text]

11 Kirsch, L.S., Brownstein, S. and de Wolff-Rouendaal, D. (1996) A histo­pathological, ultrastructural and immunohistochemical study of congenital hereditary retinoschisis. Can. J. Ophthalmol., 31, 301–310.[Web of Science][Medline]

12 Sauer, C.G., Gehrig, A., Warneke-Wittstock, R., Marquardt, A., Ewing, C.C., Gibson, A., Lorenz, B., Jurklies, B. and Weber, B.H. (1997) Positional cloning of the gene associated with X-linked juvenile retinoschisis. Nature Genet., 17, 164–170.[Web of Science][Medline]

13 van de Vosse, E., Walpole, S.M., Nicolaou, A., van der Bent, P., Cahn, A., Vaudin, M., Ross, M.T., Durham, J., Pavitt, R., Wilkinson, J. et al. (1998) Characterisation of SCML1, a new gene in Xp22, with homology to developmental polycomb genes. Genomics, 49, 96–102.[Web of Science][Medline]

14 Walpole, S.M., Hiriyana, K.T., Nicolaou, A., Bingham, E.L., Durham, J., Vaudin, M., Ross, M.T., Yates, J.R.W., Seiving, P.A. and Trump, D. (1999) Identification and characterisation of the human homologue (RAI2) of a mouse retinoic acid-induced gene in Xp22. Genomics, 55, 275–283.[Web of Science][Medline]

15 Montini, E., Andolfi, G., Caruso, A., Buchner, G., Walpole, S.M., ­Mariani, M., Consalez, G., Trump, D., Ballabio, A. and Franco, B. (1998) Identification and characterisation of a novel serine-threonine kinase gene from the Xp22 region. Genomics, 51, 427–433.[Web of Science][Medline]

16 Reid, S.N., Akhmedov, N.B., Piriev, N.I., Kozak, C.A., Danciger, M. and Farber, D.B. (1999) The mouse X-linked juvenile retinoschisis cDNA: expression in photoreceptors. Gene, 227, 257–266.[Web of Science][Medline]

17 The Retinoschisis Consortium (1998) Functional implications of the spectrum of mutations found in 234 cases with X-linked juvenile retinoschisis (XLRS). Hum. Mol. Genet., 7, 1185–1192.[Abstract/Free Full Text]

18 Baumgartner, S., Hofmann, K., Chiquet-Ehrismann, R. and Bucher, P. (1998) The discoidin family revisited: new members from prokaryotes and a homology based fold prediction. Protein Sci., 7, 1626–1631.[Web of Science][Medline]

19 He, X. and Tessier-Lavigne, M. (1997) Neuropilin is a receptor for the axonal chemorepellent Semaphorin III. Cell, 90, 739–751.[Web of Science][Medline]

20 Bellen, H.J., Lu, R., Beckstead, R. and Bhat, M.A. (1998) Neurexin IV, caspr and paranodin—novel members of the neurexin family: encounters of axons and glia. Trends Neurosci., 21, 444–449.[Web of Science][Medline]

21 Ensslin, M., Vogel, T., Calvete, J.J., Thole, H.H., Schmidtke, J., Matsuda, T. and Topfer-Peterson, E. (1998) Molecular cloning and characterisation of P47, a novel boar sperm-associated zona-pellucida-binding protein homologous to a family of mammalian secretory proteins. Biol. Reprod., 52, 1057–1064.

22 Hidai, C., Zupancic, T., Penta, K., Mikhail, A., Kawana, M., ­Quertermous, E.E., Aoka, Y., Fukagawa, M., Matsui, Y., Platika, D. et al. (1998) Cloning and characterisation of developmental endothelial locus-1: an embryonic endothelial cell protein that binds the anb3 integrin receptor. Genes Dev., 12, 21–33.[Abstract/Free Full Text]

23 Vogel, W. (1999) Discoidin domain receptors: structural relations and functional implications. FASEB J., 13, S77–S82.[Abstract/Free Full Text]

24 Luzio, J.P., Ellis, J.A., Thomas, S. and Banting, G. (1995) Antibody screening of bacterial expression systems. In Hames, B.D. and Higgins, S.J. (eds), Gene Probes: A Practical Approach. IRL Press, Oxford, UK, pp. 77–101.

25 Seigel, G.M. (1999) The golden age of retinal cell culture. Mol. Vis., 5, 4.[Medline]

26 Springer, W.R., Cooper, D.N. and Barondes, S.H. (1984) Discoidin I is implicated in cell-substratum attachment and ordered cell migration of Dictyostelium discoideum and resembles fibronectin. Cell, 39, 557–564.[Web of Science][Medline]

27 Foehr, E.D., Tatavos, A., Tanabe, E., Raffioni, S., Goetz, S., Dimarco, E., De Luca, M. and Bradshaw, R.A. (2000) Discoidin domain receptor 1 (DDR1) signaling in PC12 cells: activation of juxtamembrane domains in PDGFR/DDR/TrkA chimeric receptors. FASEB J., 14, 973–981.[Abstract/Free Full Text]

28 Vogel, W., Brakebusch, C., Fssler, R., Alves, F., Ruggiero, F. and ­Pawson, T. (2000) Discoidin domain receptor 1 is activated independently of ß1 integrin. J. Biol. Chem., 275, 5779–5784.[Abstract/Free Full Text]

29 Kane, W.H. and Davie, E.W. (1988) Blood coagulation factors V and VIII: structural and functional similarities and their relationship to ­hemorrhagic and thrombotic disorders. Blood, 71, 539–551.[Free Full Text]

30 Penta, K., Varner, J.A., Liaw, L., Hidai, C., Schatzman, R. and ­Quertermous, T. (1999) Del1 induces integrin signalling and angiogenesis by ligation of {alpha}Vß3. J. Biol. Chem., 274, 11101–11109.[Abstract/Free Full Text]

31 McFall, R.C., Sery, T.W. and Makadon, M. (1977) Characterisation of a new continuous cell line derived froma human retinoblastoma. Cancer Res., 37, 1003–1010.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
J. A. Coleman, M. C. M. Kwok, and R. S. Molday
Localization, Purification, and Functional Reconstitution of the P4-ATPase Atp8a2, a Phosphatidylserine Flippase in Photoreceptor Disc Membranes
J. Biol. Chem., November 20, 2009; 284(47): 32670 - 32679.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
C. Vijayasarathy, L. Ziccardi, Y. Zeng, N. Smaoui, R. C. Caruso, and P. A. Sieving
Null Retinoschisin-Protein Expression from an RS1 c354del1-ins18 Mutation Causing Progressive and Severe XLRS in a Cross-Sectional Family Study
Invest. Ophthalmol. Vis. Sci., November 1, 2009; 50(11): 5375 - 5383.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Shi, K. Jian, M. L. Ko, D. Trump, and G. Y.-P. Ko
Retinoschisin, a New Binding Partner for L-type Voltage-gated Calcium Channels in the Retina
J. Biol. Chem., February 6, 2009; 284(6): 3966 - 3975.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Langmann, C. C. L. Lai, K. Weigelt, B. M. Tam, R. Warneke-Wittstock, O. L. Moritz, and B. H. F. Weber
CRX controls retinal expression of the X-linked juvenile retinoschisis (RS1) gene
Nucleic Acids Res., November 1, 2008; 36(20): 6523 - 6534.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. L. Ko, Y. Liu, L. Shi, D. Trump, and G. Y.-P. Ko
Circadian Regulation of Retinoschisin in the Chick Retina
Invest. Ophthalmol. Vis. Sci., April 1, 2008; 49(4): 1615 - 1621.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
R. Farjo, W. M. Peterson, and M. I. Naash
Expression Profiling after Retinal Detachment and Reattachment: A Possible Role for Aquaporin-0
Invest. Ophthalmol. Vis. Sci., February 1, 2008; 49(2): 511 - 521.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S. K Sikkink, S. Biswas, N. R A Parry, P. E Stanga, and D. Trump
X-linked retinoschisis: an update
J. Med. Genet., April 1, 2007; 44(4): 225 - 232.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Gehrig, T. Langmann, F. Horling, A. Janssen, M. Bonin, M. Walter, S. Poths, and B. H. F. Weber
Genome-Wide Expression Profiling of the Retinoschisin-Deficient Retina in Early Postnatal Mouse Development
Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 891 - 900.
[Abstract] [Full Text] [PDF]


Home page
Br J OphthalmolHome page
T Wang, A Zhou, C T Waters, E O'Connor, R J Read, and D Trump
Molecular pathology of X linked retinoschisis: mutations interfere with retinoschisin secretion and oligomerisation
Br J Ophthalmol, January 1, 2006; 90(1): 81 - 86.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
D Pimenides, N D L George, J R W Yates, K Bradshaw, S A Roberts, A T Moore, and D Trump
X-linked retinoschisis: clinical phenotype and RS1 genotype in 86 UK patients
J. Med. Genet., June 1, 2005; 42(6): e35 - e35.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. W. H. Wu, J. P. Wong, J. Kast, and R. S. Molday
RS1, a Discoidin Domain-containing Retinal Cell Adhesion Protein Associated with X-linked Retinoschisis, Exists as a Novel Disulfide-linked Octamer
J. Biol. Chem., March 18, 2005; 280(11): 10721 - 10730.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Zeng, Y. Takada, S. Kjellstrom, K. Hiriyanna, A. Tanikawa, E. Wawrousek, N. Smaoui, R. Caruso, R. A. Bush, and P. A. Sieving
RS-1 Gene Delivery to an Adult Rs1h Knockout Mouse Model Restores ERG b-Wave with Reversal of the Electronegative Waveform of X-Linked Retinoschisis
Invest. Ophthalmol. Vis. Sci., September 1, 2004; 45(9): 3279 - 3285.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Takada, R. N. Fariss, A. Tanikawa, Y. Zeng, D. Carper, R. Bush, and P. A. Sieving
A Retinal Neuronal Developmental Wave of Retinoschisin Expression Begins in Ganglion Cells during Layer Formation
Invest. Ophthalmol. Vis. Sci., September 1, 2004; 45(9): 3302 - 3312.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Abdulhussein, C. McFadden, P. Fuentes-Prior, and W. F. Vogel
Exploring the Collagen-binding Site of the DDR1 Tyrosine Kinase Receptor
J. Biol. Chem., July 23, 2004; 279(30): 31462 - 31470.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M Michaelides, D M Hunt, and A T Moore
The genetics of inherited macular dystrophies
J. Med. Genet., September 1, 2003; 40(9): 641 - 650.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. W. H. Wu and R. S. Molday
Defective Discoidin Domain Structure, Subunit Assembly, and Endoplasmic Reticulum Processing of Retinoschisin are Primary Mechanisms Responsible for X-linked Retinoschisis
J. Biol. Chem., July 18, 2003; 278(30): 28139 - 28146.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. N. M. Reid, C. Yamashita, and D. B. Farber
Retinoschisin, a Photoreceptor-Secreted Protein, and Its Interaction with Bipolar and Muller Cells
J. Neurosci., July 9, 2003; 23(14): 6030 - 6040.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. Grayson, F. Bartolini, J. P. Chapple, K. R. Willison, A. Bhamidipati, S. A. Lewis, P. J. Luthert, A. J. Hardcastle, N. J. Cowan, and M. E. Cheetham
Localization in the human retina of the X-linked retinitis pigmentosa protein RP2, its homologue cofactor C and the RP2 interacting protein Arl3
Hum. Mol. Genet., November 15, 2002; 11(24): 3065 - 3074.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. Wang, C. T. Waters, A. M.K. Rothman, T. J. Jakins, K. Romisch, and D. Trump
Intracellular retention of mutant retinoschisin is the pathological mechanism underlying X-linked retinoschisis
Hum. Mol. Genet., November 15, 2002; 11(24): 3097 - 3105.
[Abstract] [Full Text] [PDF]


Home page
Arch OphthalmolHome page
C. M. Mooy, L. I. van den Born, S. Baarsma, D. A. Paridaens, T. Kraaijenbrink, A. Bergen, and B. H. F. Weber
Hereditary X-Linked Juvenile Retinoschisis: A Review of the Role of Muller Cells
Arch Ophthalmol, July 1, 2002; 120(7): 979 - 984.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. A. Curat, M. Eck, X. Dervillez, and W. F. Vogel
Mapping of Epitopes in Discoidin Domain Receptor 1 Critical for Collagen Binding
J. Biol. Chem., November 30, 2001; 276(49): 45952 - 45958.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
K. R. Alexander, C. S. Barnes, and G. A. Fishman
High-Frequency Attenuation of the Cone ERG and ON-Response Deficits in X-linked Retinoschisis
Invest. Ophthalmol. Vis. Sci., August 1, 2001; 42(9): 2094 - 2101.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
L. L. Molday, D. Hicks, C. G. Sauer, B. H. F. Weber, and R. S. Molday
Expression of X-Linked Retinoschisis Protein RS1 in Photoreceptor and Bipolar Cells
Invest. Ophthalmol. Vis. Sci., March 1, 2001; 42(3): 816 - 825.
[Abstract] [Full Text]


Home page
IOVSHome page
K. R. Alexander, G. A. Fishman, C. S. Barnes, and S. Grover
ON-Response Deficit in the Electroretinogram of the Cone System in X-Linked Retinoschisis
Invest. Ophthalmol. Vis. Sci., February 1, 2001; 42(2): 453 - 459.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (51)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Grayson, C.
Right arrow Articles by Trump, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grayson, C.
Right arrow Articles by Trump, D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?