Human Molecular Genetics, 2000, Vol. 9, No. 14 2131-2139
© 2000 Oxford University Press
Variation in residual PITX2 activity underlies the phenotypic spectrum of anterior segment developmental disorders
Departments of 1Ophthalmology and 2Medical Genetics, University of Alberta, Edmonton, Alberta T6G 2H7, Canada
Received 24 April 2000; Revised and Accepted 10 July 2000.
| ABSTRACT |
|---|
|
|
|---|
The autosomal dominant disorders iris hypolasia (IH), iridogoniodysgenesis syndrome (IGDS) and AxenfeldRieger syndrome (ARS) are characterized by maldevelopment of the anterior segment of the eye associated with an increased risk of early-onset glaucoma. IH, IGDS and ARS are allelic disorders, as all three can result from mutations of the transcription factor PITX2. IH is the mildest of the three, whereas ARS exhibits the most severe ocular malformations. We hypothesize that varying amounts of residual PITX2 activity could underlie the severity of these phenotypes. Missense mutations of the PITX2 homeodomain identified in IH (Arg46Trp), IGDS (Arg31His) and ARS patients (Leu16Gln; Thr30Pro; Arg53Pro) were introduced into recombinant PITX2 cDNA by site-directed mutagenesis. PITX2 mutant proteins expressed in COS-7 cells were determined to be stable and localized to the nucleus; however, the Arg53Pro ARS mutant also displayed cytoplasmic staining. Our findings are consistent with the possibility of a novel nuclear localization signal (NLS) within helix 3 of the PITX2 homeodomain, homologous to the NLS of the related transcription factor PDX-1. Analysis of the five mutant PITX2 proteins by DNA-binding shifts and transactivation studies demonstrated reduced activity of the IH and IGDS mutant PITX2 proteins, with the IH mutant retaining the most activity in both studies, whereas the ARS mutant PITX2 proteins proved to be non-functional. In addition to providing insight into the etiological mechanism of IH, IGDS and ARS, these results are consistent with the hypothesis that mutant PITX2 proteins that retain partial function result in milder anterior segment aberrations.
| INTRODUCTION |
|---|
|
|
|---|
Autosomal dominant iris hypoplasia (IH) (1), iridogoniodysgenesis syndrome (IGDS) (OMIM 137600) and AxenfeldRieger syndrome (ARS) (OMIM 180500) are related disorders that represent a spectrum of anterior segment anomalies (25). All three disorders are characterized by maldevelopment of the iris stroma and early-onset glaucoma. IH is the mildest of the anomalies, characterized solely by the above ocular defects (1). IGDS further presents with abnormalities in iridocorneal angle tissue differentiation (goniodysgenesis) (6). ARS has the most severe ocular phenotype, displaying all of the aforementioned defects with the addition of an anteriorly displaced (and thickened) junction between Descemets membrane and the trabecular meshwork, known as Schwalbes line (5). Tendrils can often be seen to connect Schwalbes line to the iris, the pull of which can result in an eccentric pupil and tears within the iris. The pathogenesis of these anomalies is postulated to result from developmental arrest late in gestation of the anterior segment structures derived from the neural crest cells that form the corneal endothelium, iris stroma and trabecular meshwork (7).
IH, IGDS and ARS also share non-ocular syndromic features that include hypertelorism, maxillary hypoplasia, hypodontia, microdontia, redundant periumbilical skin and hypospadius in males, all of which are generally seen as more severe in ARS. Other features, which have been noted in ARS patients, include pituitary, gastrointestinal, cardiac and limb developmental irregularities (8).
ARS is a genetically heterogeneous disorder with linkage to loci at chromosomes 4q25, 6p25 and 13q14. Positional cloning identified the transcription factor PITX2 (formerly RIEG1) at 4q25 (9). PITX2 mutations have been reported in six families with ARS, one IH and one IGDS family, and in one family with the related ocular disorder Peters anomaly (central corneal opacification, irido-corneal adhesions, cataract and syndromic features as above; OMIM 604229) (912). ARS has also been shown to result from mutation of the forkhead-like transcription factor FOX-C1 (formerly FKHL7) at 6p25 (13). Mutations of FOX-C1 have also been found in AxenfeldRieger anomaly (ARA) which has the ocular phenotype of ARS without the syndromic features (14,15). The third locus at chromosome 13q14 has been linked to a family with ARS and sensory-neuro deafness (16).
The PITX2 protein contains a 60 amino acid homeodomain of the paired-bicoid class which is responsible for binding DNA. Three human PITX2 isoforms have been described that differ at the N-terminus as proteins of 271 (isoform a), 317 (isoform b) and 324 amino acids (isoform c) (17). All three PITX2 isoforms maintain a full 60 amino acid homeodomain and identical C-termini containing a conserved 14 amino acid stretch, postulated to be a proteinprotein interaction domain (9). Recent reports indicate that the 39 amino acids of the PITX2 C-terminus may repress the ability of PITX2 to bind DNA, an effect that is masked by protein binding to the region (18).
The murine Pitx2 expression profile correlates strongly with the tissues affected in IH, IGDS and ARS patients (9,19). In situ hybridization studies of murine Pitx2 mRNA during embryogenesis show Pitx2 expression in Rathkes pouch, maxillary and mandibular epithelia, periocular mesenchyme, vitelline and umbilical vessels, limb bud and dorsal mesentery (9). Recently, PITX2 has been implicated in the developmental pathway of leftright asymmetry. Altered Pitx2 expression patterns were found in mice with laterality defects which correlated to changes in the visceral symmetry (20), and ectopic expression of Pitx2 mRNA in chick and Xenopus embryos resulted in aberrant looping of the heart and gut and reversed body rotation (2123). Embryonic-lethal Pitx2 homozygous null (/) mice have been created, with incomplete turning of the embryo, defective body wall closure, aberrant heart morphogenesis and/or positioning (but normal looping), right isomerization of the lung, failed pituitary development and tooth organogenesis, and defects in anterior and posterior eye segments (2426). Heterozygous Pitx2+/ mice displayed variable but severe ARS-like defects, including small eyes with aberrantly shaped and misplaced pupils, full-thickness iris holes, clouded lens, tooth defects and retarded growth (24). In addition to malpositioned small eyes lacking extrinsic musculature with vestigial lens pits and optic nerve coloboma, Pitx2/ null mice presented thickening of both the corneal epithelium and the mesenchyme separating the optic cup rim from the corneal surface ectoderm (24). These later defects are reminiscent of the thickened Schwalbes line and maldevelopment of the iridocorneal angle seen in ARS and IGDS patients. Interestingly, undifferentiated mesenchymal cells have been demonstrated in place of a proper cornea in mice null for the Pitx2 homeodomain (hd/), which also lack the anterior chamber (25). Together, these results indicate that PITX2 plays a crucial role in the differentiation of the periocular mesenchyme, loss of which may result in the accumulation of undifferentiated cells and thickening of the structures.
The severity of non-ocular defects and issues of laterality of the homozygous Pitx2/ mice are not seen in heterozygous IH, IGDS and ARS patients. The one wild-type PITX2 allele carried by IH, IGDS and ARS patients may be sufficient for normal laterality. Functional redundancy may also be a consideration within the pituitary where Pitx1 exhibits overlapping expression with Pitx2 during murine development (19,2729). This is not the case within the eye where Pitx1 is not expressed and the developmental pathways of the anterior segment affected in IH, IGDS and ARS are potentially under stricter PITX2 dosage control. We hypothesize that differences in functional amounts of PITX2 protein may be the basis for the spectrum of anterior segment anomalies discussed in this paper. To test our hypothesis we have assayed DNA-binding ability, transactivation of a reporter gene and nuclear localization of recombinant PITX2 proteins containing missense mutations of the PITX2 homeodomain identified in IH, IGDS and ARS patients.
| RESULTS |
|---|
|
|
|---|
Western analysis and immunofluorescence
Mammalian COS-7 cells were used to express the IH, IGDS and ARS mutant PITX2 cDNAs (isoform a) subcloned within the pcDNA4/HisMax A vector (see Materials and Methods) (Fig. 1). Whole-cell protein extracts of transfected COS-7 cells were size-separated by SDSPAGE. Subsequent western analysis with a commercial antibody to the vector-encoded Xpress epitope demonstrated a stable 35 kDa band for wild-type and mutant PITX2 protein extracts, representing the 4 kDa Xpress epitope tag and expected 31 kDa PITX2 protein (Fig. 2). Band intensities of the western blots were used to equalize the recombinant PITX2 protein extracts.
|
|
Immunofluorescence of transfected COS-7 cells also demonstrated stable recombinant wild-type and mutant PITX2 protein (Fig. 3). Cells transfected with wild-type PITX2 showed full nuclear localization. Of the 1000 cells assayed by immunofluorescence for each mutant PITX2 construct, 3% of Arg31His (IGDS), 23% of Arg46Trp (IH), 30% of Leu16Gln (ARS-1), 18% of Thr30Pro (ARS-2) and 64% of Arg53Pro (ARS-3) of transfected cells displayed cytoplasmic staining in addition to nuclear localization (Fig. 3).
|
Electrophoretic mobility shift assays (EMSAs)
EMSAs demonstrated that wild-type PITX2 protein could form DNAprotein complexes with the CE-3 oligonucleotide containing the DNA-binding site of Pitx1 (2830) (Fig. 4). Untransfected COS-7 cell extracts were used to confirm that the CE-3 binding activity was not a property endogenous to COS-7 cell proteins (Fig. 4A, lane 2). Similarly, the XpressLacZ fusion protein was used to demonstrate that the Xpress epitope did not provide DNA-binding ability to the recombinant PITX2 proteins (Fig. 4A, lane 3). DNA binding by PITX2 protein is specific for double-stranded DNA as the addition of single-stranded CE-3 oligonucleotides (forward and reverse) did not affect binding of the double-stranded CE-3 probe by PITX2 protein (Fig. 4A, lanes 8 and 9). Specificity of CE-3 oligonucleotide binding by PITX2 protein was demonstrated by the addition of unlabeled random oligonucleotides which were unable to effectively compete with the CE-3 probe (Fig. 4A, lanes 57), and by the addition of unlabeled CE-3 oligonucleotide which successfully competed and reduced the visible PITX2 proteinCE-3 complex (Fig.4B).
|
EMSAs with titrated amounts of mutant PITX2 protein extracts showed that the IH mutant retained the greatest amount of residual DNA binding of the CE-3 oligonucleotide compared with wild-type PITX2, whereas the IGDS mutant retained minimal amounts (Fig. 5). Roughly 20 x Arg46Trp (IH) and 200 x Arg31His (IGDS) mutant PITX2 protein extract was necessary to achieve binding of the CE-3 probe equivalent to that of 1 x wild-type PITX2 protein (shown as a control on each gel in Fig. 5). The ARS mutant PITX2 proteins were not able to bind at detectable levels (Fig. 5). EMSAs were replicated three times for wild-type PITX2 protein and the IH and IGDS extracts, and twice for the ARS mutant PITX2 extracts, with similar results each time.
|
Transactivation studies
Co-transfection of the pGL3-promoter vector containing four copies of the CE-3 oligonucleotide (+++) with the pcDNA4/HisMax A PITX2 constructs demonstrated varying levels of firefly luciferase reporter gene transactivation by the different PITX2 mutants (Fig. 6). To ensure that equal amounts of the PITX2 proteins were being assayed, transfected HeLa cells were examined by immunofluorescence. Transfection efficiencies of the PITX2 constructs were approximately equal, with the exception of the ARS-3 (Arg53Pro) construct, which was expressed at 70% of the other PITX2 proteins. As observed in the DNA-binding experiments above, the IH mutant (Arg46Trp) retained the greatest amount of residual transactivation ability, representing 37.9% of wild-type PITX2 activity. The distinction between the other PITX2 mutants is minimal, but does follow the trend observed in DNA-binding of the CE-3 oligonucleotide. The IGDS mutant (Arg31His) maintains 12.4% transactivational ability, whereas the ARS mutations (Leu16Gln, Thr30Pro, Arg53Pro) retained 8.6, 6.7 and 4.8% activity, respectively.
|
| DISCUSSION |
|---|
|
|
|---|
In our present study, we have corroborated the phenotypic distinctions made between the very similar anterior segment disorders IH, IGDS and ARS, by demonstrating the functional consequences of the different PITX2 mutations as found in these disorders. All nine PITX2 mutations found to date are unique and are represented by single families or patients with de novo mutations (912). The Arg46Trp PITX2 mutation was found in 15 affected individuals of a five generation pedigree diagnosed with IH (1,11). Ten individuals presented with glaucoma, six had prominent vascular loops and four had fine translucent iris processes to normally localized Schwalbes lines. One individual presented with dental anomalies, maxillary hypoplasia and redundant periumbilical skin. The Arg31His PITX2 mutation was described in 13 individuals of a five generation pedigree diagnosed with iridogoniodysgenesis (3,6,10). At least six individuals also had glaucoma, and 11 members were described with maxillary hypoplasia and dental anomalies, whereas nine had redundant periumbilical skin. One eye displayed a displaced pupil due to localized adhesion to the posterior periphery of the cornea with membrane-like tissue over the iris root despite an otherwise open angle. Histological examination of another glaucomatous eye donated from this family for study revealed nodular thickening of a normally localized Schwalbes line (31). Although less clinical data have been published on the precise ARS families found to carry PITX2 mutations, it has been reported that at least one member of each family displayed the three cardinal features of ARS that include abnormal anterior segments (generally accepted to include glaucoma, iris hypoplasia, a prominent Schwalbes line and, occasionally, distorted and displaced pupils due to iris processes), hypodontia and failure of the periumbilical skin to involute (9,32,33). It can thus be surmised that, although the ocular findings of the three phenotypes are closely related, there is a gradient of severity of both the ocular and non-ocular features between these disorders.
DNA binding and transactivation studies
Although multiple isoforms of PITX2 exist, this study concentrated on isoform a which has confirmed expression within the murine eye (19). Constructs containing IH, IGDS and ARS mutations of the PITX2 transcription factor (Fig. 1) were examined for functional activity by mobility shift assays, transactivation studies and cellular localization. DNA-binding analysis with an oligonucleotide containing the Pitx1-binding site (CE-3) (2830) and recombinant PITX2 proteins confirmed that all five PITX2 mutants as tested had reduced DNA-binding ability, consistent with these alterations of the PITX2 gene being disease-causing mutations. The Arg31His (IGDS) and Arg46Trp (IH) mutant PITX2 proteins retained residual DNA binding, whereas the three ARS mutant PITX2 proteins tested, Leu16Gln, Thr30Pro and Arg53Pro, were unable to bind the CE-3 oligonucleotide at levels detectable by autoradiography (Fig. 5). A similar pattern was observed in transactivation studies (Fig. 6). We expect that the mutations that result in partial loss of the homeodomain, or otherwise truncated PITX2 protein, by splice-site mutation or introduction of premature stop codons [as identified in Peters anomaly and other ARS patients not included in our present study (9,12)], may produce PITX2 protein targeted for early degradation, or result in non-functional PITX2 protein that underlies the more severe malformations within the spectrum of anterior segment anomalies. However, one nonsense mutation resulting in loss of the C-terminal 34 amino acids of PITX2 identified in an ARS patient (9) is consistent with a possible dominant-negative mechanism. This mutation would result in a PITX2 protein molecule lacking the C-terminal domain found to have an inhibitory effect on DNA binding (18). Additional experiments will allow determination of the functional consequences of this mutation on PITX2 function.
To assess the ways in which the PITX2 mutations tested might result in the observed reduced DNA binding, we compared the PITX2 homeodomain with the sequence and three-dimensional DNA complexed crystal structures of the classic helix-turn-helix homeodomain proteins Antennapedia (Antp) and Engrailed (en) (3436) (Fig. 7). Many of the amino acids of Antp and en that have been determined by crystallographic analysis to be important to homeodomain structure and function are conserved in PITX2 (Fig. 7). Leu16, Phe20, Trp48 and Phe49 are demonstrated in Antp and en to make up the hydrophobic pocket between helices 1 and 3 that regulates and stabilizes the folding of the homeodomain, and are invariant among all homeodomains (37,38), including PITX2. Within the N-terminal arm preceding helix 1 which slides into the minor DNA groove in Antp and en studies, amino acid residues Arg3, Arg5 and Thr6 are conserved in PITX2. Important helix 2 amino acid residues Tyr25 and Arg31 are also conserved, which in Antp and en stabilize the interactions of helix 3 by contacting the DNA phosphate backbone. Helix 3 amino acid residues 47, 50, 51 and 57 involved in DNA sequence recognition and specificity are divergent among the three homeodomains, with the exception of the invariant Asn51 residue (37,38), which makes a critical DNA base contact. Also conserved between Antp/en and PITX2 are a number of helix 3 amino acid residues (residues 48, 53 and 55) that make important DNA phosphate contacts, especially Arg53 which is invariant among all homeodomains (37). Thereby three of the tested PITX2 mutations (Leu16Glu, Arg31His and Arg53Pro) occur at known key residues whereas the remainder fall adjacent to, or within, critical helical sites or domains (Fig. 7). Our PITX2 structural analysis is supported by recent work examining the hydrophobic interactions that direct PITX2 homeodomain folding using a theoretical threading analysis method (39).
|
The IH and IGDS PITX2 mutations represent more conservative amino acid substitutions and seemingly occur at positions less critical to the overall structure of the homeodomain than the mutations identified in ARS patients. We propose that replacement of Arg46 on the hydrophilic face of helix 3 with a hydrophobic and bulky tryptophan may interfere with the stability of the proteinDNA complex, potentially explaining the partial loss of DNA binding and transactivation ability of the Arg46Trp (IH) mutant PITX2 protein. Arg46 may be important for contacting a sugar residue of the DNA backbone just as Lys46 of en does, since the two side-chains have the same overall structure and chemistry. The greater reduction in DNA binding and transactivation by the Arg31His (IGDS) PITX2 mutant protein may represent a more severe mutation than Arg46Trp (Fig. 5). The Arg31His mutation occurs on the hydrophilic face of helix 2 at a critical phosphate backbone contact position required by both Antp and en for efficient DNA binding. Whereas arginine and histidine are both basic residues, the shorter ring structure of the histidine residue may be inappropriate for proper contact with the DNA backbone, resulting in instability of the complex.
Comparison with Antp and en indicates that the ARS mutations may be very detrimental to PITX2 homeodomain structure and PITX2DNA complex stability. Although we found that the overall stability of Leu16Gln PITX2 protein was unaffected, as determined by western analysis and immunofluorescence (Figs 2 and 3), loss of DNA binding and thus transactivating ability of the Leu16Gln (ARS-1) mutant PITX2 protein (Fig. 5) might be explained by improper folding of the homeodomain. Leu16 is normally invariant between homeodomains (37,38), and substitution by a hydrophilic glutamine within the hydrophobic core might disrupt the packing of helix 1 against helix 3.
Mutation to proline residues, described in ARS as Thr30Pro and Arg53Pro mutations, represent substitutions highly disruptive to the
-helix (40). Furthermore, we find that these proline mutations occur at important positions within the homeodomain by comparison with Antp and en crystal structures. The Thr30Pro (ARS-2) mutation occurs between amino acids Arg25 and Arg31 which are required to make phosphate contacts with the DNA backbone to stabilize helix 3 within the DNA major groove. We similarly conclude that the Arg53Pro mutation potentially disrupts helix 3 structure, perhaps also affecting the packing of helix 3 against helix 1, thereby inhibiting DNA binding. Furthermore, this Arg53Pro mutation occurs at a conserved helix 3 residue responsible for making two critical phosphate contacts and is surrounded by a number of DNA contact and recognition points, including those made by amino acids Lys50 and Asn51.
Protein stability and nuclear localization
We have demonstrated by western analysis and immunofluorescence that all five mutant PITX2 proteins tested are stable in mammalian cells (Figs 2 and 3). Leu16Gln (ARS-1) mutant PITX2 protein had previously been shown to be unstable in bacteria (41). Our production of stable Leu16Gln mutant PITX2 protein may reflect our use of a mammalian expression system rather than a bacterial system.
Immunofluorescence of transfected COS-7 cells shows that recombinant wild-type PITX2 protein is fully localized to the nucleus, whereas
23% of Arg46Trp (IH), 3% of Arg31His (IGDS), 30% of Leu16Gln (ARS-1), 18% of Thr30Pro (ARS-2) and 64% of Arg53Pro (ARS-3) transfected cells showed cytoplasmic staining in addition to nuclear localization (Fig. 3). The Leu16Gln (ARS-1) mutation occurs within a critical component of the homeodomain hydrophobic core. Mutation at this residue might affect folding of the PITX2 homeodomain, and thereby result in disrupted nuclear localization. A similar reduction in protein stability introduced by prolines within the
-helix as in the Thr30Pro (ARS-2) and Arg53Pro (ARS-3) mutations may cause the reduced nuclear localization observed. The more extensive reduction to nuclear targeting by the Arg53Pro mutation may result from disruption to helix 3 which would also interfere with packing against helix 1, destabilizing the homeodomain further, but it may also represent an impaired nuclear localization signal (NLS) within helix 3. This is supported by similarity of this PITX2 region to the NLS of the homeodomain transcription factor PDX-1 (Fig. 7) (42). The third helices of PITX2 and PDX-1 are very similar, with three clusters of basic amino acids similarly spaced. The central cluster (Arg53 and Arg54, both conserved in PITX2) is critical to the PDX-1 NLS, mutation of which effectively blocked PDX-1 nuclear import. We also found reduced nuclear localization with the Arg46Trp (IH) PITX2 mutation, indicating that amino acid residue Arg46 and nearby Arg44 may also be part of a PITX2 NLS within helix 3. Basic residues are often characteristic of NLSs (43,44), and basic residues Arg43 and His44 of PDX-1 are found to contribute to proper cellular targeting, impairing nuclear localization when mutated to leucine residues. PITX2 also maintains similarity with the C-terminal end of the PDX-1 NLS. Arg58 and Lys59 of PITX2 may be functionally equivalent to the two PDX-1 lysine residues at positions 58 and 59, which when mutated along with Arg53/Arg54 further excluded PDX-1 from the nucleus. This would be the first description of a C-terminal PITX2 NLS, homology of which would potentially extend to Pitx1 and unc-30 (Fig. 7). A second putative NLS (Lys-Lys-Lys-Arg) may exist immediately N-terminal to helix 1 of the homeodomain (19,43,45). This N-terminal NLS would appear to be secondary to the C-terminal NLS, as deletion of these four amino acids had little effect on subcellular localization (data not shown). More work needs to be done to determine the regulation of PITX2 nuclear localization.
In examining the DNA-binding activity of IH, IGDS and ARS mutant PITX2 proteins we have demonstrated that all five PITX2 mutations tested result in greatly reduced, if not abolished, DNA binding. We have tested transactivational activity of the PITX2 mutants and found a pattern similar to that seen in DNA-binding activity as tested by EMSA. Overall, the IH mutant (Arg46Trp) retains the most function, the IGDS (Arg31His) mutant is further reduced in its function, whereas the three ARS mutants (Leu16Gln, Thr30Pro, Arg53Pro) retain minimal if any activity. These results thus support the hypothesis that reduced PITX2 function due to the five missense mutations of the homeodomain studied, rather than gain-of-function or dominant-negative modes of action (which may be represented by other PITX2 mutations), result in the IH, IGDS and ARS disease phenotypes. Our results also suggest a threshold for functional PITX2 protein in the development of the anterior segment. In heterozygotes, 50% of the normal complement of DNA binding by one wild-type PITX2 allele alone results in the severe ARS form. Additional PITX2 activity, contributed by the mutant allele, would result in the milder IH or IGDS forms, depending on the degree of residual activity. We therefore conclude that the variance in PITX2 activity, due to specific missense mutations within the PITX2 homeodomain results in the different anterior chamber anomalies classified as ARS, IGDS and IH. The differing clinical consequences of the variations in residual PITX2 function serves to illustrate the very tight control of PITX2 within the developmental pathways of the anterior segment.
| MATERIALS AND METHODS |
|---|
|
|
|---|
PITX2 cDNA constructs
Prior to subcloning, site-directed mutagenesis was used to introduce a 5' BamHI site and to remove an upstream stop codon from the PITX2 cDNA (a gift from Dr Jeff Murray, University of Iowa, Iowa City, IA). The new BamHI site was used in conjunction with a pre-existing C-terminal BamHI site for subcloning into the mammalian expression vector pcDNA4/HisMax A (Invitrogen, Carlsbad, CA) which encodes the N-terminal Xpress epitope (Asp-Leu-Tyr-Asp-Asp-Asp-Asp-Lys). IH, IGDS and ARS mutants were introduced into wild-type PITX2 cDNA using the QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) with the mutagenic primers according to the manufacturers instructions (Table 1).
|
A Qiagen MaxiPrep kit (QiagenN, Mississauga, Ontario) was used to isolate and purify plasmid DNA which was fully sequenced by standard [33P]ddNTP methods (Amersham Pharmacia Biotech, Baie dUrfé, Québec).
Protein expression
Wild-type and mutant PITX2 cDNA constructs within the pcDNA4/HisMax A vector (500 ng) were introduced into mammalian COS-7 cells [2 x 106 cells per 100 mm plate in 16 ml of Dulbeccos modified Eagles medium (DMEM) + 10% fetal bovine serum] with the FuGENE 6 transfection reagent (24 µl; Roche Molecular Biochemicals, Indianapolis, IN). Cells were harvested by scraping 72 h post-transfection. Protein extracts were prepared by sonication in 200 µl of lysis buffer (25% glycerol, 20 mM HEPES pH 7.8, 150 mM NaCl, 0.2 mM EDTA, 0.5 mM dithiothreitol, 2.5 mM phenylmethylsulfonylfluoride).
Western analysis
Whole-cell protein extracts were resolved by SDSPAGE and transferred to PVDF membrane (Bio-Rad, Hercules, CA). Recombinant PITX2 protein was detected with a mouse monoclonal antibody, Anti-Xpress (1:5000 dilution), to the plasmid encoded Xpress epitope. The secondary antibody, goat anti-mouse (1:2500 dilution), linked to horseradish peroxidase (Pierce, Rockford, IL), was detected by SuperSignal' West Pico Chemiluminescent Substrate (Pierce).
Immunofluorescence
COS-7 cells, transfected as above, were fixed with 1% paraformaldehyde for 6 min, permeated by 0.05% Triton X-100 for 10 min, and blocked with 5% bovine serum albumin for 1 h (46). Recombinant protein was detected with Anti-Xpress antibody (Invitrogen) (1:400 dilution), and a secondary rabbit anti-mouse antibody linked to Cy3 (Jackson ImmunoResearch, West Grove, PA) (1:400 dilution). Nuclei were counterstained with DAPI dye, and cells were examined by fluorescent microscopy (Leica Mikroskopie und Systeme, Wetzlar, Germany) with a TRITC filter (Chroma Technology, Brattleboro, VT).
EMSAs
Whole-cell protein extracts from transfected COS7 cells, standardized by western analysis to 1 x wild-type PITX2 protein, were used in EMSAs with the labeled double-stranded oligonucleotide: 5'CAGGTCAGTTCAGCGGATCCTGTCGACCAGGATGCTAAGCCTCTGTCAGGCGAATTCAGTGCAACTGCAGC-3' containing the CE-3 binding site of Pitx1 (bold) (2830), with 32P PCR-incorporated using primers to the oligonucleotide (underlined). Wild-type PITX2 protein extracts were titrated from 0.1x to 20x, and mutant PITX2 extracts were titrated from 5x to 200x. Protein extracts were added to 100 ng of CE-3 probe within a 40 µl binding reaction of 5% glycerol, 20 mM HEPES pH 7.5, 1 mM EDTA, 0.5 µg of poly(dI·dC), 1 mM dithiothreitol and 50 mM NaCl (modified from ref. 41). Binding reactions were placed on ice for 20 min prior to addition of protein extracts, and then incubated on ice for an additional 60 min. EMSAs were replicated three times for wild-type PITX2 and the IH and IGDS extracts, and twice for the ARS mutant PITX2 extracts, each extract representing a separate transfection of COS-7 cells. Competition assays were performed with 1001000 ng of unlabeled probe added to binding reactions 5 min prior to addition of protein. Unlabeled CE-3 oligonucleotide probe competitor was prepared as above. Similar assays were performed with the double-stranded random oligonucleotides: 5'-AGTTCAATGGGCTCATGCAGCCCTACGACGACATGTACCCAGGCTATTCCTACAACAACTGG-3' and 5'-GCTTCCCCTTCTTCAACTCTATGAACGTCAACCCCCTGTCATCACAGAGCATGTTTTCCCC-3'. Binding reactions were electrophoresed on 8% PAGE, 0.25x TBE, for 67 h at 250 V (4°C).
Transactivation studies
A CE-3 luciferase reporter construct was developed by subcloning four copies (three in sense and one in anti-sense orientation) of the CE-3 element flanked by BglII restriction sites 5'-GATCTACCAGGATGCTAAGCCTCTGTCA-3' (forward) and 5'-GATCTGACAGAGGCTTAGCATCCTGGTA-3' (reverse) into the BglII cloning site directly 5' of the SV-40 promoter of the pGL3 vector encoding the firefly luciferase gene (Promega, Madison, WI). Wild-type and mutant PITX2 cDNA constructs within the pcDNA4/HisMax A vector (500 ng) were co-transfected with 50 ng of the C-E3 (+++) pGL3-promoter vector into mammalian HeLa cells (2 x 105 cells per well in 2 ml of DMEM + 10% fetal bovine serum) with 3 µl of FuGENE 6 transfection reagent (Roche Molecular Biochemicals). Cells were harvested with 500 µl of a passive lysis buffer (Promega) 40 h post-transfection. Twenty microliters of protein lysate was added to 100 µl of the LARII reagent (Promega), and firefly luciferase activity was measured by luminometer (Turner Designs, Sunnyvale, CA). Transfections were repeated three times for the IH and IGDS mutants and twice for the ARS mutants and the wild-type PITX2 construct. HeLa cells similarly transfected were examined by immunofluorescence, as above, to measure transfection efficiency of the PITX2 constructs.
| ACKNOWLEDGEMENTS |
|---|
The authors wish to thank Drs Semina and Murray (University of Iowa) for providing us with the PITX2 cDNA; Margaret Hughes for assistance with tissue culture; members of the Ocular Genetics Laboratory; and Drs Andrew and Underhill (University of Alberta) for their advice and critical review of this manuscript. This work was supported by funding from the CIBC World Market Research Fund of the Glaucoma Research Foundation USA and Fight for Sight, the Research Division of Prevent Blindness America. M.A.W. is an Alberta Heritage Fund for Medical Research senior scholar and a Medical Research Council of Canada Scientist.
| FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +1 780 492 9805; Fax: +1 780 492 6934; Email: mwalter@ualberta.ca
| REFERENCES |
|---|
|
|
|---|
1 Heon, E., Sheth, B.P., Kalenak, J.W., Sunden, S.L., Streb, L.M., Taylor, C.M., Alward, W.L., Sheffield, V.C. and Stone, E.M. (1995) Linkage of autosomal dominant iris hypoplasia to the region of the Rieger syndrome locus (4q25). Hum. Mol. Genet., 4, 14351439.
2 Alkemade, P.P.H. (1969) Dysgenesis Mesodermalis of the Iris and the Cornea: A Study of Riegers Syndrome and Peters Anomaly. Van Gorcum, Assen, The Netherlands.
3 Chisholm, I.A. and Chudley, A.E. (1983) Autosomal dominant iridogoniodysgenesis with associated somatic anomalies: four-generation family with Riegers syndrome. Br. J. Ophthalmol., 67, 529534.
4 Reese, A.B. and Ellsworth, R.M. (1966) The anterior chamber cleavage syndrome. Arch. Ophthalmol., 75, 307318.
5 Shields, M.B., Buckley, E., Klintworth, G.K. and Thresher, R. (1985) Axenfeld-Rieger syndrome. A spectrum of developmental disorders. Surv. Ophthalmol., 29, 387409.[Web of Science][Medline]
6 Walter, M.A., Mirzayans, F., Mears, A.J., Hickey, K. and Pearce, W.G. (1996) Autosomal-dominant iridogoniodysgenesis and Axenfeld-Rieger syndrome are genetically distinct. Ophthalmology, 103, 19071915.[Web of Science][Medline]
7 Shields, M.B. (1983) Axenfeld-Rieger syndrome: a theory of mechanism and distinctions from the iridocorneal endothelial syndrome. Trans. Am. Ophthalmol. Soc., 81, 736784.[Medline]
8 Fitch, N. and Kaback, M. (1978) The Axenfeld syndrome and the Rieger-syndrome. J. Med. Genet., 15, 3034.
9 Semina, E.V., Reiter, R., Leysens, N.J., Alward, W.L., Small, K.W., Datson, N.A., Siegel, B.J., Bierke, N.D., Bitoun, P., Zabel, B.U. et al. (1996) Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nature Genet., 14, 392399.[Web of Science][Medline]
10 Kulak, S.C., Kozlowski, K., Semina, E.V., Pearce, W.G. and Walter, M.A. (1998) Mutation in the RIEG1 gene in patients with iridogoniodysgenesis syndrome. Hum. Mol. Genet., 7, 11131117.
11 Alward, W.L., Semina, E.V., Kalenak, J.W., Heon, E., Sheth, B.P., Stone, E.M. and Murray, J.C. (1998) Autosomal dominant iris hypoplasia is caused by a mutation in the Rieger syndrome (RIEG/PITX2) gene. Am. J. Ophthalmol., 125, 98100.[Web of Science][Medline]
12 Doward, W., Perveen, R., Lloyd, I.C., Ridgway, A.E., Wilson, L. and Black, G.C. (1999) A mutation in the RIEG1 gene associated with Peters anomaly. J. Med. Genet., 36, 152155.
13 Mirzayans, F., Gould, D.B., Héon, E., Billingsley, G.D., Cheung, J.C., Mears, A.J. and Walter, M.A. (2000) Axenfeld-Rieger Syndrome resulting from mutation of the FKHL7 gene on chromosome 6p25. Eur. J. Hum. Genet., 8, 7174.[Web of Science][Medline]
14 Nishimura, D.Y., Swiderski, R.E., Alwards, L.M., Searby, C.C., Patil, S.R., Bennet, S.R., Kanis, A.B., Gastier, J.M., Stone, E.M. and Sheffield, V.C. (1998) The forkhead transcription factor gene FKHL7 is responsible for glaucoma phenotypes which map to 6p25. Nature Genet., 19, 140147.[Web of Science][Medline]
15 Mears, A.J., Jordan, T., Mirzayans, F., Dubois, S., Kume, T., Parlee, M., Ritch, R., Koop, B., Kuo, W.L., Collins, C. et al. (1998) Mutations of the forkhead/winged helix gene, FKHL7, in patients with Axenfeld-Rieger anomaly. Am. J. Hum. Genet., 63, 13161328.[Web of Science][Medline]
16 Phillips, J.C., Del Bono, E.A., Haines, J.L., Pralea, A.M., Cohen, J.S., Greff, L.J. and Wiggs, J.L. (1996) A second locus for Rieger Syndrome maps to chromosome 13q14. Am. J. Hum. Genet., 59, 613619.[Web of Science][Medline]
17 Arakawa, H., Nakamura, T., Zhadanov, A.B., Fidanza, V., Yano, T., Bullrich, F., Shimizu, M., Blechman, J., Mazo, A., Canaani, E. and Croce, C.M. (1998) Identification and characterization of the ARP1 gene, a target for the human acute leukemia ALL1 gene. Proc. Natl Acad. Sci. USA, 95, 45734578.
18 Amendt, B.A., Sutherland, L.B. and Russo, A.F. (1999) Multifunctional role of the Pitx2 homeodomain protein C-terminal tail. Mol. Cell Biol., 19, 70017010.
19 Gage, P.J. and Camper, S.A. (1997) Pituitary homeobox 2, a novel member of the bicoid-related family of homeobox genes, is a potential regulator of anterior structure formation. Hum. Mol. Genet., 6, 457464.
20 Piedra, M.E., Icardo, J.M., Albajar, M., Rodriguez-Rey, J.C. and Ros, M.A. (1998) Pitx2 participates in the late phase of the pathway controlling left-right asymmetry. Cell, 94, 319324.[Web of Science][Medline]
21 Campione, M., Steinbeisser, H., Schweickert, A., Deissler, K., van Bebber, F., Lowe, L.A., Nowotschin, S., Viebahn, C., Haffter, P., Kuehn, M.R. and Blum, M. (1999) The homeobox gene Pitx2: mediator of asymmetric left-right signaling in vertebrate heart and gut looping. Development, 126, 12251234.[Abstract]
22 Logan, M., Pagan-Westphal, S.M., Smith, D.M., Paganessi, L. and Tabin, C.J. (1998) The transcription factor Pitx2 mediates situs-specific morphogenesis in response to left-right asymmetric signals. Cell, 94, 307317.[Web of Science][Medline]
23 Ryan, A.K., Blumberg, B., Rodriguez-Esteban, C., Yonei-Tamura, S., Tamura, K., Tsukui, T., de la Pena, J., Sabbagh, W., Greenwald, J., Choe, S. et al. (1998) Pitx2 determines left-right asymmetry of internal organs in vertebrates. Nature, 394, 545551.[Medline]
24 Gage, P.J., Suh, H. and Camper, S.A. (1999) Dosage requirement of Pitx2 for development of multiple organs. Development, 126, 46434651.[Abstract]
25 Lin, C.R., Kioussi, C., OConnell, S., Briata, P., Szeto, D., Liu, F., Izpisua-Belmonte, J.C. and Rosenfeld, M.G. (1999) Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and tooth morphogenesis. Nature, 401, 279282.[Medline]
26 Lu, M.F., Pressman, C., Dyer, R., Johnson, R.L. and Martin, J.F. (1999) Function of Rieger syndrome gene in left-right asymmetry and craniofacial development. Nature, 401, 276278.[Medline]
27 Gage, P.J., Suh, H. and Camper, S.A. (1999) The bicoid-related Pitx gene family in development. Mamm. Genome, 10, 197200.[Web of Science][Medline]
28 Lamonerie, T., Tremblay, J.J., Lanctot, C., Therrien, M., Gauthier, Y. and Drouin, J. (1996) Ptx1, a bicoid-related homeo box transcription factor involved in transcription of the pro-opiomelanocortin gene. Genes Dev., 10, 12841295.
29 Tremblay, J.J., Marcil, A., Gauthier, Y. and Drouin, J. (1999) Ptx1 regulates SF-1 activity by an interaction that mimics the role of the ligand-binding domain. EMBO J., 18, 34313441.[Web of Science][Medline]
30 Drouin, J., Lamolet, B., Lamonerie, T., Lanctot, C. and Tremblay, J.J. (1998) The PTX family of homeodomain transcription factors during pituitary developments. Mol. Cell. Endocrinol., 140, 3136.[Web of Science][Medline]
31 Pearce, W.G., Mielke, B., Kulak, S.C. and Walter, M.A. (1999) Histopathology and molecular basis of iridogoniodysgenesis syndrome. Ophthalmic. Genet., 20, 8388.[Medline]
32 Semina, E.V., Datson, N.A., Leysens, N.J., Zabel, B.U., Carey, J.C., Bell, G.I., Bitoun, P., Lindgren, C., Stevenson, T., Frants, R.R. et al. (1996) Exclusion of epidermal growth factor and high-resolution physical mapping across the Rieger syndrome locus. Am. J. Hum. Genet., 59, 12881296.[Web of Science][Medline]
33 Murray, J.C., Bennet, S.R., Kwitek, A.E., Small, K.W., Schinzel, A., Alward, W.L.M., Weber, J.L., Bell, G.I. and Buetow, K.H. (1992) Linkage of Rieger syndrome to the region of the epidermal growth factor gene on chromosome 4. Nature Genet., 2, 4649.[Web of Science][Medline]
34 Billeter, M., Qian, Y.Q., Otting, G., Muller, M., Gehring, W. and Wuthrich, K. (1993) Determination of the nuclear magnetic resonance solution structure of an Antennapedia homeodomain-DNA complex. J. Mol. Biol., 234, 10841093.[Web of Science][Medline]
35 Kissinger, C.R., Liu, B.S., Martin-Blanco, E., Kornberg, T.B. and Pabo, C.O. (1990) Crystal structure of an engrailed homeodomain-DNA complex at 2.8 Å resolution: a framework for understanding homeodomain-DNA interactions. Cell, 63, 579590.[Web of Science][Medline]
36 Gehring, W.J., Qian, Y.Q., Billeter, M., Furukubo-Tokunaga, K., Schier, A.F., Resendez-Perez, D., Affolter, M., Otting, G. and Wuthrich, K. (1994) Homeodomain-DNA recognition. Cell, 78, 211223.[Web of Science][Medline]
37 Scott, M.P., Tamkun, J.W. and Hartzell, G.W.D. (1989) The structure and function of the homeodomain. Biochim. Biophys. Acta, 989, 2548.[Medline]
38 Wilson, D.S., Sheng, G., Jun, S. and Desplan, C. (1996) Conservation and diversification in homeodomain-DNA interactions: a comparative genetic analysis. Proc. Natl Acad. Sci. USA, 93, 68866891.
39 Banerjee-Basu, S. and Baxevanis, A.D. (1999) Threading analysis of the Pitx2 homeodomain: predicted structural effects of mutations causing Rieger syndrome and iridogoniodysgenesis. Hum. Mutat.,14, 312319.[Web of Science][Medline]
40 ONeil, K.T. and DeGrado, W.F. (1990) A thermodynamic scale for the helix-forming tendencies of the commonly occurring amino acids. Science, 250, 646651.
41 Amendt, B.A., Sutherland, L.B., Semina, E.V. and Russo, A.F. (1998) The molecular basis of Rieger syndrome. Analysis of Pitx2 homeodomain protein activities. J. Biol. Chem., 273, 2006620072.
42 Hessabi, B., Ziegler, P., Schmidt, I., Hessabi, C. and Walther, R. (1999) The nuclear localization signal (NLS) of PDX-1 is part of the homeodomain and represents a novel type of NLS. Eur. J. Biochem., 263, 170177.[Web of Science][Medline]
43 Dingwall, C. and Laskey, R.A. (1991) Nuclear targeting sequencesa consensus? Trends Biochem. Sci., 16, 478481.[Web of Science][Medline]
44 Gorlich, D. (1997) Nuclear protein import. Curr. Opin. Cell Biol., 9, 412419.[Web of Science][Medline]
45 Lindberg, C., Wunderlich, M., Ratliff, J., Dinsmore, J. and Jacoby, D.B. (1998) Regulated expression of the homeobox gene, rPtx2, in the developing rat. Dev. Brain Res., 110, 215226.[Medline]
46 Shin, S.H., Kogerman, P., Lindstrom, E., Toftgard, R. and Biesecker, L.G. (1999) GLI3 mutations in human disorders mimic Drosophila cubitus interruptus protein functions and localization. Proc. Natl Acad. Sci. USA, 96, 28802884.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
T. Footz, F. Idrees, M. Acharya, K. Kozlowski, and M. A. Walter Analysis of Mutations of the PITX2 Transcription Factor Found in Patients with Axenfeld-Rieger Syndrome Invest. Ophthalmol. Vis. Sci., June 1, 2009; 50(6): 2599 - 2606. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Park, Y. Jamshidi, D. Vaideanu, M. Bitner-Glindzicz, S. Fraser, and J. C. Sowden Genetic Risk for Primary Open-Angle Glaucoma Determined by LMX1B Haplotypes Invest. Ophthalmol. Vis. Sci., April 1, 2009; 50(4): 1522 - 1530. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Venugopalan, M. A. Amen, J. Wang, L. Wong, A. C. Cavender, R. N. D'Souza, M. Akerlund, S. L. Brody, T. A. Hjalt, and B. A. Amendt Novel expression and transcriptional regulation of FoxJ1 during oro-facial morphogenesis Hum. Mol. Genet., December 1, 2008; 17(23): 3643 - 3654. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. S. How, T. Aung, X. Chew, V. H. K. Yong, M. C. C. Lim, K. Y. C. Lee, J.-Y. Toh, Y. Li, J. Liu, and E. N. Vithana Lack of Association between Interleukin-1 Gene Cluster Polymorphisms and Glaucoma in Chinese Subjects Invest. Ophthalmol. Vis. Sci., May 1, 2007; 48(5): 2123 - 2126. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Strungaru, I. Dinu, and M. A. Walter Genotype-Phenotype Correlations in Axenfeld-Rieger Malformation and Glaucoma Patients with FOXC1 and PITX2 Mutations Invest. Ophthalmol. Vis. Sci., January 1, 2007; 48(1): 228 - 237. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Asai-Coakwell, C. Backhouse, R. J. Casey, P. J. Gage, and O. J. Lehmann Reduced Human and Murine Corneal Thickness in an Axenfeld-Rieger Syndrome Subtype Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4905 - 4909. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Weisschuh, P. Dressler, F. Schuettauf, C. Wolf, B. Wissinger, and E. Gramer Novel Mutations of FOXC1 and PITX2 in Patients with Axenfeld-Rieger Malformations. Invest. Ophthalmol. Vis. Sci., September 1, 2006; 47(9): 3846 - 3852. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Diehl, S. Zareparsi, M. Qian, R. Khanna, R. Angeles, and P. J. Gage Extraocular Muscle Morphogenesis and Gene Expression Are Regulated by Pitx2 Gene Dose Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 1785 - 1793. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Cella, J. P. Cabral de Vasconcellos, M. Barbosa de Melo, B. Kneipp, F. F. Costa, C. A. Longui, and V. P. Costa Structural Assessment of PITX2, FOXC1, CYP1B1, and GJA1 Genes in Patients with Axenfeld-Rieger Syndrome with Developmental Glaucoma Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 1803 - 1809. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. B. Berry, M. A. Lines, J. M. Oas, T. Footz, D. A. Underhill, P. J. Gage, and M. A. Walter Functional interactions between FOXC1 and PITX2 underlie the sensitivity to FOXC1 gene dose in Axenfeld-Rieger syndrome and anterior segment dysgenesis Hum. Mol. Genet., March 15, 2006; 15(6): 905 - 919. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Garcia-Barcelo, M.-t. So, D. K.-c. Lau, T. Y.-y. Leon, Z.-w. Yuan, W.-s. Cai, V. C.-h. Lui, M. Fu, J.-A. Herbrick, E. Gutter, et al. Population Differences in the Polyalanine Domain and 6 New Mutations in HLXB9 in Patients with Currarino Syndrome Clin. Chem., January 1, 2006; 52(1): 46 - 52. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Evans and P. J. Gage Expression of the homeobox gene Pitx2 in neural crest is required for optic stalk and ocular anterior segment development Hum. Mol. Genet., November 15, 2005; 14(22): 3347 - 3359. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Ploski, M. K. Shamsher, and A. Radu Paired-Type Homeodomain Transcription Factors Are Imported into the Nucleus by Karyopherin 13 Mol. Cell. Biol., June 1, 2004; 24(11): 4824 - 4834. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liu, J. Selever, M.-F. Lu, and J. F. Martin Genetic dissection of Pitx2 in craniofacial development uncovers new functions in branchial arch morphogenesis, late aspects of tooth morphogenesis and cell migration Development, December 22, 2003; 130(25): 6375 - 6385. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, H. Zhao, X. Zhang, and H. Feng Novel Identification of a Four-base-pair Deletion Mutation in PITX2 in a Rieger Syndrome Family Journal of Dental Research, December 1, 2003; 82(12): 1008 - 1012. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Saleem, T. C. Murphy, J. M. Liebmann, and M. A. Walter Identification and Analysis of a Novel Mutation in the FOXC1 Forkhead Domain Invest. Ophthalmol. Vis. Sci., November 1, 2003; 44(11): 4608 - 4612. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Suh, P. J. Gage, J. Drouin, and S. A. Camper Pitx2 is required at multiple stages of pituitary organogenesis: pituitary primordium formation and cell specification Development, March 3, 2003; 129(2): 329 - 337. [Abstract] [Full Text] [PDF] |
||||
![]() |
P Debeer, C Bacchelli, P J Scambler, L De Smet, J-P Fryns, and F R Goodman Severe digital abnormalities in a patient heterozygous for both a novel missense mutation in HOXD13 and a polyalanine tract expansion in HOXA13 J. Med. Genet., November 1, 2002; 39(11): 852 - 856. [Full Text] [PDF] |
||||
![]() |
M. A. Lines, K. Kozlowski, and M. A. Walter Molecular genetics of Axenfeld-Rieger malformations Hum. Mol. Genet., May 15, 2002; 11(10): 1177 - 1187. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Gould and S. W. M. John Anterior segment dysgenesis and the developmental glaucomas are complex traits Hum. Mol. Genet., May 15, 2002; 11(10): 1185 - 1193. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Espinoza, C. J. Cox, E. V. Semina, and B. A. Amendt A molecular basis for differential developmental anomalies in Axenfeld-Rieger syndrome Hum. Mol. Genet., April 1, 2002; 11(7): 743 - 753. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Priston, K. Kozlowski, D. Gill, K. Letwin, Y. Buys, A. V. Levin, M. A. Walter, and E. Heon Functional analyses of two newly identified PITX2 mutants reveal a novel molecular mechanism for Axenfeld-Rieger syndrome Hum. Mol. Genet., August 1, 2001; 10(16): 1631 - 1638. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Saadi, E. V. Semina, B. A. Amendt, D. J. Harris, K. P. Murphy, J. C. Murray, and A. F. Russo Identification of a Dominant Negative Homeodomain Mutation in Rieger Syndrome J. Biol. Chem., June 15, 2001; 276(25): 23034 - 23041. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||














