Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (99)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tabrizi, S. J.
Right arrow Articles by Schapira, A. H.V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tabrizi, S. J.
Right arrow Articles by Schapira, A. H.V.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2000, Vol. 9, No. 18 2683-2689
© 2000 Oxford University Press

Expression of mutant {alpha}-synuclein causes increased susceptibility to dopamine toxicity

Sarah J. Tabrizi1,+, Michael Orth+,1, J. Max Wilkinson2, Jan-Willem Taanman1, Thomas T. Warner1, J. Mark Cooper1 and Anthony H.V. Schapira1,3,§

1University Department of Clinical Neurosciences, 2Renal Unit, Royal Free and University College Medical School and 3Institute of Neurology, University College London, London NW3 2PF, UK

Received 12 July 2000; Revised and Accepted 1 September 2000.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mutations of the {alpha}-synuclein gene have been identified in autosomal dominant Parkinson’s disease (PD). Transgenic mice overexpressing wild-type human {alpha}-synuclein develop motor impairments, intraneuronal inclusions and loss of dopaminergic terminals in the striatum. To study the mechanism of action through which mutant {alpha}-synuclein toxicity is mediated, we have generated stable, inducible cell models expressing wild-type or PD-associated mutant (G209A) {alpha}-synuclein in human-derived HEK293 cells. Increased expression of either wild-type or mutant {alpha}-synuclein resulted in the formation of cytoplasmic aggregates which were associated with the vesicular (including monoaminergic) compartment. Expression of mutant {alpha}-synuclein induced a significant increase in sensitivity to dopamine toxicity compared with the wild-type protein expression. These results provide an explanation for the preferential dopaminergic neuronal degeneration seen in both the PD G209A mutant {alpha}-synuclein families and suggest that similar mechanisms may underlie or contribute to cell death in sporadic PD.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Parkinson’s disease (PD) is characterized by the loss of dopaminergic neurons in the substantia nigra pars compacta and by the formation of Lewy bodies in a proportion of surviving neurons. The identification of mutations in several different genes in familial parkinsonism (14), increased concordance amongst identical twins when studied with fluoro-dopa positron emission tomography (5), or if onset is before 50-years-old (6), and the increased familial frequency of PD (7) all support the proposition that there may be a significant genetic contribution to the aetiology of this disease. Mutations in the {alpha}-synuclein gene have now been identified in several PD families (1,2,8), although they are not common causes of either familial (9) or sporadic PD (10,11). The presence of {alpha}-synuclein has also been demonstrated in Lewy bodies in the brains of sporadic PD patients (12) suggesting the possibility that aggregation of this protein may be relevant to disease pathogenesis. In a recent report, transgenic mice overexpressing wild-type human {alpha}-synuclein developed deficits in motor performance, {alpha}-synuclein containing neuronal intranuclear and intracytoplasmic inclusions and loss of dopaminergic terminals in the striatum, proportional to the degree of {alpha}-synuclein expression (13). We have developed stable, inducible human-derived cell lines expressing wild-type or mutant (G209A) {alpha}-synuclein to investigate the morphological and biochemical consequences of wild-type and mutant protein expression.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
There was only very weak expression of {alpha}-synuclein in the pIND.{alpha}-syn- or pIND.{alpha}-syn/G209A-transfected cells in the absence of ponasterone A (Fig. 1A) and likewise no or only weak expression in the pIND.zero cells. This suggests that the background expression of pIND.{alpha}-syn and pIND.{alpha}-syn/G209A cells is the result of the host gene and not due to leakage of the introduced gene constructs. Furthermore, the level of {alpha}-synuclein expression (wild-type or mutant) was proportional to the concentration of ponasterone A used with the inducible cell lines (Fig. 2). Thus, the production of {alpha}-synuclein protein by these cell lines was tightly controlled by ponasterone A.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Immunocytochemical localization of {alpha}-synuclein in HEK293-derived cell lines. HEK293-derived cell line ECR293 was transfected with pIND, pIND.{alpha}-syn or pIND.{alpha}-syn/G209A. Wild-type or mutant {alpha}-synuclein clonal lines were chosen where >70% of cells expressed the induced protein. Immunocytochemistry was performed with antibodies to {alpha}-synuclein (AD, green fluorescence), the Golgi network (E), MitoTracker (F), ubiquitin (G), lysosomes (H), vesicle-associated membrane protein (VAMP) (I) and vesicular monoamine transporter (VMAT 1) (J). The cell nucleus was stained with propidium iodide as described. Nuclei were clearly visible but there was negligible background expression of {alpha}-synuclein (green fluorescence) in HEK293 cells with the wild-type or mutant constructs (A). Induction with ponasterone A increased expression of both wild-type (data not shown) and G209A mutant {alpha}-synuclein (B) with the formation of cytoplasmic but no nuclear aggregates for both wild-type (C) and mutant (D) {alpha}-synuclein. Dual staining with green fluorescence for the Golgi network (E) and lysosomes (H) showed separate localization for mutant (red fluorescence) and wild-type (data not shown) {alpha}-synuclein. Co-staining with the MitoTracker (red fluorescence) showed that {alpha}-synuclein was not localized in the mitochondria (F). This was confirmed with the COI subunit of cytochrome oxidase (data not shown). Dual labelling studies indicated that neither the mutant {alpha}-synuclein (red) nor wild-type {alpha}-synuclein (data not shown) aggregates stained for ubiquitin (green) (G). {alpha}-synuclein (red) did co-localize with VAMP (green) (I) as shown by the merged fluorescence (yellow) and with VMAT-1 (red) with green fluorescence for {alpha}-synuclein (J) although this was not exclusive to the distribution of either of the vesicle stains. Bars: (A and B) 20 µm; (C–J) 10 µm.

 


View larger version (64K):
[in this window]
[in a new window]
 
Figure 2. Western blots showing the induction of {alpha}-synuclein expression with ponasterone A. pIND (pIND.0), pIND.{alpha}-syn (IC) and pIND.{alpha}-syn/G209A (15M) transfected cell lines were grown, cell extracts prepared and western blots performed as described. Porin immunoreactivity was equal in all lanes and indicated equivalent protein loading (A). Both {alpha}-synuclein and HA antibodies detected a band representing the {alpha}-synuclein–HA complex at ~20 kDa with 5 µM ponasterone A in the wild-type and mutant {alpha}-synuclein cell lines but not in the pIND.zero lines (B and C). In all these three cell lines there was no detectable {alpha}-synuclein protein expression without ponasterone A. Increasing concentrations of ponasterone A (0.1, 0.5, 1.0, 3.0 and 5 µM) resulted in greater expression of the mutant protein (D). Similar results were obtained with the wild-type pIND.{alpha}-syn cell lines (data not shown).

 
Treatment of the pIND.{alpha}-syn or pIND.{alpha}-syn/G209A cell lines with 5 µM ponasterone A for 48 h led to the formation of intracellular aggregates containing {alpha}-synuclein (Fig. 1B–D). No difference in the number or location of aggregates formed was observed between cells expressing wild-type or mutant {alpha}-synuclein (Fig. 1C and D). {alpha}-synuclein did not co-localize with markers for the cell nucleus, Golgi, mitochondria or lysosomes (Fig. 1C–F and H). Neither the wild-type (data not shown) nor mutant {alpha}-synuclein deposits stained for ubiquitin (Fig. 1G). However, co-localization of both wild-type (data not shown) and mutant {alpha}-synuclein was observed with vesicle-associated membrane protein (VAMP), indicating that {alpha}-synuclein was associated with intracellular vesicles (Fig. 1I). Staining for vesicular monoamine transporter (VMAT 1) showed that a proportion of vesicles were positive for both this protein and {alpha}-synuclein (Fig. 1J).

The expression of wild-type or mutant {alpha}-synuclein did not cause any significant level of excess cell death (Fig. 3). This suggests that in the time-frame of expression used (96 h) neither wild-type nor mutant {alpha}-synuclein proteins were toxic.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Cell death in pIND.zero (open bars), pIND.{alpha}-syn (black bars) and pIND.{alpha}-syn/G209A (hatched bars) cell lines with increasing concentrations of dopamine. Incubations and quantitation of cell death were undertaken as described. In the absence of dopamine, there was no significant cell death in any cell line with 5 µM ponasterone A treatment over 96 h. All concentrations of dopamine used resulted in a significant increase in cell death. At 0.75 and 1.0 mM dopamine, the degree of cell death was significantly greater in the mutant {alpha}-synuclein cell line than in either the pIND.zero or pIND.{alpha}-syn lines (P = 0.0003 and P = 0.02, respectively).

 
In view of the likely co-localization of {alpha}-synuclein with dopamine-containing vesicles and the known toxicity of dopamine through its production of reactive oxygen species (14,15), we investigated the effect of wild-type and mutant {alpha}-synuclein expression on dopamine toxicity. Following treatment with ponasterone A (5 µM) for 48 h before and during the 48 h of dopamine exposure, pIND.zero cell lines showed a significant increase in cell death with 0.75 and 1 mM dopamine (P = 0.0002 for both) confirming the toxicity of dopamine in these cells (Fig. 3). These concentrations of dopamine are equivalent to those reported in the cell bodies of dopaminergic neurons (16).

Increasing dopamine concentrations resulted in excess cell death in the lines expressing either wild-type or mutant {alpha}-synuclein. At 0.5 mM dopamine both wild-type and mutant {alpha}-synuclein expression caused increased cell death compared with pIND.zero lines (P = 0.05 and P = 0.007, respectively) but there was no significant difference in susceptibility between the two {alpha}-synuclein lines. At higher concentrations of dopamine, however, mutant {alpha}-synuclein expression caused significantly greater cell death than wild-type (P = 0.0003 and P = 0.02 for 0.75 and 1 mM dopamine, respectively). There was no significant difference in cell toxicity between pIND.zero and wild-type {alpha}-synuclein lines at these concentrations.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
{alpha}-synuclein has been shown to bind to vesicles, be transported by the fast component of axonal transport in rat optic nerve and co-localize with synaptophysin in the presynaptic terminal (17,18). The G88C mutant form of {alpha}-synuclein had decreased vesicle binding compared with the mutant G209A or wild-type forms in this rat model. Our fluorescent immunocytochemical studies showed that, in human cultured cells, wild-type and mutant forms of human {alpha}-synuclein are also associated with the vesicular component within cells, including those vesicles expressing the monoamine transporter. Overexpression of human wild-type {alpha}-synuclein in a transgenic mouse model demonstrated accumulation of {alpha}-synuclein aggregates in the rough endoplasmic reticulum of cingulate cortex neurons (13) indicating that {alpha}-synuclein aggregates may also be located outside vesicles. In some cells of our model, increased expression of wild-type or mutant {alpha}-synuclein with ponasterone A led to diffuse, as opposed to aggregated, protein deposits. Why some cells did and others did not form aggregates was unclear. The observation that {alpha}-synuclein aggregates were not ubiquinated in our cell system was surprising. However, it may be that the time-scale for ubiquitination to be detected was too brief. Terminally differentiated cells are needed to assess whether ubiquitination occurs after more prolonged {alpha}-synuclein expression.

In our model, neither wild-type nor mutant G209A {alpha}-synuclein expression resulted in cell death. In a transient transfection model of G209A mutant {alpha}-synuclein expression in HEK293 cells, however, excess cell death was observed (19). The difference in these results may lie in the level of protein expression—the transient transfections perhaps producing greater levels of mutant protein. Nevertheless, our results are in accord with those of the mouse model of overexpression of human wild-type {alpha}-synuclein in which there was no evidence of excess cell death (13).

Based on our results, we suggest that at least part of the toxicity of mutant {alpha}-synuclein is mediated via its enhancement of dopamine toxicity. The mice overexpressing human wild-type {alpha}-synuclein developed intraneuronal inclusions, but no increased cell death of tyrosine hydroxylase (TH)-positive neurons (13). However, at 12 months, those mice with the highest {alpha}-synuclein expression levels had reduced striatal TH activity, decreased density of TH-positive terminals and a deficit in motor performance. Thus long-term wild-type {alpha}-synuclein overexpression is toxic. Our model would predict that overexpression of mutant G209A {alpha}-synuclein in such mice would induce a more rapid and intense loss of striatal TH-positive terminals and loss of dopamine-containing neurons, with an earlier onset of motor dysfunction. In this context, it is interesting to note that those families with the G209A mutation develop PD at a much earlier mean age than those with idiopathic PD and also have a more accelerated course with death an average 9.7 years after onset (20). Our results are also consistent with the Drosophila model of wild-type and mutant {alpha}-synuclein expression in which there is aggregate formation, relative selective dopaminergic cell loss and locomotor dysfunction (21). Furthermore, expression of human G209A mutant but not wild-type {alpha}-synuclein selectively led to apoptosis of dopamine neurons in rat primary mesencephalic cultures (22). Both the mutant and wild-type forms of human {alpha}-synuclein enhanced the toxicity of 6-hydroxydopamine. Similar results were also seen at low concentrations of the pre-aggregated fibrillogenic 61–95 kDa fragment of {alpha}-synuclein in the same model system (23).

At present the mechanism by which mutant {alpha}-synuclein increases dopamine toxicity is not known. {alpha}-synuclein is highly expressed in human brain presynaptic terminals (24) and in rat substantia nigra pars compacta (25), and is also a major component in the Lewy bodies of dopamine-containing neurons in PD brains (12). Thus, {alpha}-synuclein is expressed at sites of high dopamine content and it may function to modulate dopamine release (26).

Dopamine-induced cell death has been confirmed in a number of systems (2729). Dopamine is unstable and is readily oxidized to the dopamine quinone and generates superoxide and hydrogen peroxide. Dopamine can also covalently modify free cysteine, cysteine in glutathione and cysteinyl residues in protein (30). Sulphydryl groups on cysteines are often associated with active sites on proteins and thus their modification could alter function irreversibly. Interestingly, the formation of S-cysteinyl dopamine on protein is associated with the loss of monoaminergic striatal terminals in dopamine-induced toxicity (31). Thus, dopamine toxicity may be mediated via increased reactive oxygen species generation and by direct protein modification.

In our expression model, the synergistic toxic effect of mutant {alpha}-synuclein and dopamine occurs relatively rapidly. Dopamine-mediated free radical and sulphydryl group damage may increase the predisposition for mutant {alpha}-synuclein to form aggregates, a suggestion supported by the finding that {alpha}-synuclein aggregation was increased by ferric ion or by ferrous ion in the presence of hydrogen peroxide (32). However, during the time course of our experiments, increased aggregation of wild-type or mutant {alpha}-synuclein was not observed at light microscopic level in our cell system. The toxicity of dopamine may be increased by failure to compartmentalize it within vesicles. The damaging effects of dopamine would therefore be increased if mutant {alpha}-synuclein interfered with the function of the monoamine transporter, thereby increasing intracytoplasmic concentrations and the potential for cell damage sufficient to cause cell death. This hypothesis would be consistent with the results of our study, the defective modulation of dopamine release and significant decrease in striatal dopamine levels in {alpha}-synuclein knockout mice (26), as well as the observations described above in the G209A PD families. A defect of dopamine compartmentalization could promote a slow but progressive loss of striatal terminals and nigral neurons. The overexpression of wild-type {alpha}-synuclein might lead to a similar effect, but over a longer period—such as seen in the human wild-type {alpha}-synuclein transgenic mice described above (13).

The relevance of these data for patients with idiopathic PD without {alpha}-synuclein mutations might lie in the potential for wild-type {alpha}-synuclein to be the target protein for a variety of pathogenetic pathways including dopamine toxicity, oxidative stress and possibly mitochondrial dysfunction. The gradual accumulation of auto-oxidation products may promote {alpha}-synuclein aggregation, Lewy body formation and cell death over prolonged periods.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of cell model
Total RNA was isolated as described by Chomczynski and Sacchi (33) from lymphoblasts from a male PD patient with the G209A {alpha}-synuclein mutation (a kind gift from M. Polymeropoulos, NIH, Bethesda, MD) and control lymphoblasts with wild-type {alpha}-synuclein (from ECACC, Wiltshire, UK). cDNA was generated by RT–PCR using the cDNA Cycle kit (Invitrogen, Groningen, The Netherlands) according to the manufacturer’s instructions. The High Fidelity system (Roche/Boehringer, Mannheim, Germany) was used for all subsequent PCR. Full-length {alpha}-synuclein cDNA was amplified using 5'-CATTCGACGACAGTGTGGTGT-3' (nucleotides 16–37) as a forward primer and 5'-CTGCTGATGGAAGACTTCGAG-3' (nucleotides 586–607) as a reverse primer. In a subsequent PCR, the open reading frame of {alpha}-synuclein and its 31 nucleotide 5' untranslated region was amplified using 5'-AAGGTACCGACAGTGTGGTGTAAAGGAAT-3' as a forward primer (nucleotides 26–44 with a 5' KpnI site) and 5'-A­­­­ATGATCAAGCGTAGTCTGGGACGTCGTATGGGT­A­G­G­CTTCAGGTTCGTAGTCTTAC-3' as a reverse primer [nucleotides 456–478 with a 3' haemagglutinin (HA) epitope coding sequence and BclI site]. Both mutated G209A and wild-type {alpha}-synuclein amplified fragments were restricted with KpnI and BclI and ligated into the KpnI and BamHI sites of pIND (Invitrogen). The correct sequence was confirmed by Big Dye automated sequencing (ABI 310; Perkin Elmer, Warrington, UK). HEK293 cells with stable transfection of the pVgRxR plasmid (ECR 293; Invitrogen) were grown at 37°C in a humidified atmosphere containing 5% CO2 in growth medium consisting of Dulbecco’s modified Eagle’s medium (DMEM) and 4.5 µg/l glucose, 10% fetal calf serum, 50 U/ml penicillin, 50 µg/ml streptomycin, 400 µg/ml Zeocin, 50 µg/ml uridine and 110 µg/ml sodium pyruvate. ECR293 cells were transfected with 5 µg of pIND constructs containing either no insert or inserts encoding wild-type {alpha}-synuclein with a C-terminal HA epitope (pIND.{alpha}-syn) or G209A mutant {alpha}-synuclein with a C-terminal HA epitope (pIND.{alpha}-syn/G209A) using the Escort (Sigma, Poole, UK) lipofection method according to the manufacturer’s instructions. Twenty-four hours post-transfection, stable clones were selected in the presence of 400 µg/ml G418 and stable cell lines generated from individual clones. All cells resistant to G418 following transfection with pIND were used as a control cell line (pIND.zero cells). Clonal cell lines transfected with either pIND.{alpha}-syn or pIND.{alpha}-syn/G209A were treated with 5 µM ponasterone A for 48 h and screened by immunocytochemistry for the expression of {alpha}-synuclein–HA construct using an antibody to HA (1:200 dilution; Boehringer). DNA was extracted from each cell line and the {alpha}-synuclein insert was amplified using pIND multiple cloning site forward and reverse sequencing primers (Invitrogen) and sequenced as above to confirm the correct sequence.

Immunocytochemistry
Cells were harvested with Versene (1:5000; Gibco BRL, Paisley, UK) and plated out on glass coverslips in a 35 mm dish with 2 ml of medium. They were allowed to settle for 24 h before induction of {alpha}-synuclein expression with 5 µM ponasterone A. After 48 h of protein expression the coverslips were washed in phosphate-buffered saline (PBS). Cells were fixed for 20 min in 4% (w/v) paraformaldehyde and then for 15 min at –20°C in methanol. All the following incubations took place in a humid chamber at 37°C. Fixation was followed by blocking with 10% normal goat serum in PBS for 1 h followed by incubation with the primary antibody for 3 h. After three washes in PBS, primary antibodies raised in mouse were developed for 1 h with respective goat anti-mouse Alexa 488 conjugates (1:200; Molecular Probes, Eugene, OR) whereas the rabbit or goat primary antibodies were detected with goat anti-rabbit or donkey anti-goat Alexa 568 conjugates, respectively (1:1000; Molecular Probes). After three washes in PBS, coverslips were mounted on glass slides in Citifluor with 1 µg/ml DAPI. Dual labelling consisted of an incubation with the rabbit or goat primary antibody and the appropriate fluorescent secondary antibody, followed by a mouse monoclonal antibody and anti-mouse fluorescent secondary antibody. The following primary antibodies were used: {alpha}-synuclein either mouse monoclonal antibody (mAb) (1:200; Zymed, San Francisco, CA) or rabbit polyclonal antibody (1:2000; Chemicon, Temecula, CA), HA (mAb anti-HA, 1:200; Roche/Boehringer), cytochrome c oxidase (mAb anti-COX I subunit, 1:200; Molecular Probes), lysosomes (mAb anti-lysosomal associated membrane protein 1, 1:400; PharMingen, San Diego, CA), Golgi (mAb anti-Golgi zone, 1:200; Chemicon), VAMP (mAb), anti-VAMP (1:200; Chemicon), VMAT 1 (goat polyclonal antibody, anti-VMAT 1, 1:50; Santa Cruz Biotechnology, Santa Cruz, CA) and ubiquitin (mAb anti-ubiquitin, 1:300; Chemicon). In addition, cells were labelled with propidium iodide (1 µg/ml) and Mitotracker (CMXRos-H2, 3 µM; Molecular Probes). Slides were evaluated with a krypton–argon laser (MRC 600; BioRad, Hercules, CA) attached to an Olympus BH2-RFCA fluorescence microscope.

Western blotting
Cells were plated at 40% confluency and allowed to settle for 24 h before the addition of ponasterone A (0–5 µM). After 48 h the cells were scraped, washed in PBS and solubilized in 100 mM Tris–HCl, 8% (w/v) SDS, 24% (w/v) glycerol, 0.5% (v/v) mercaptoethanol, pH 6.9, containing a cocktail of protease inhibitors. Samples were heated at 37°C for 10 min, centrifuged at 16 060 g for 10 min, separated on a 15% polyacrylamide gel containing SDS and transferred to PVDF membrane (Immobilon-P; Millipore, Bedford, MA) following standard techniques (34). Equal protein loading was verified by comparison with a gel stained with Coomassie in parallel. Blots were blocked using 10% (w/v) proprietary milk powder, incubated with anti-HA rat mAb (1:3000; Boehringer) as primary and sheep anti-rat Ig–horseradish peroxidase (HRP) (Fab fragments, 1:3000; Boehringer) as the secondary antibody. Blots were also incubated with anti-{alpha}-synuclein mAb (1:4000; Zymed) and anti-porin (1:25 000; Calbiochem, Nottingham, UK) mouse monoclonal antibodies as primary and rabbit anti-mouse HRP (1:3000; BioRad) as secondary antibody. All blots were developed by chemiluminescence detection (NEN, Life Science Products, Boston, MA).

Cell death experiments
Cells were harvested with Versene (1:5000; Gibco BRL), counted with a haemocytometer and plated out at a density of ~62 500 cells/well of a 12-well plate. After 1 day, 5 µM ponasterone A was added. After 48 h the medium was replaced with phenol-red free medium containing ponasterone A (0–5 µM) and dopamine (0–1000 µM) for 48 h. The supernatant of each well was aspirated, the cells washed with PBS and harvested by the addition of Versene and 10% (v/v) Triton X-100. Pairs of supernatant and cells of the same well were stored at –80°C until assayed for lactate dehydrogenase (LDH) spectrophotometrically (35) or using a LDH Cytotoxicity Detection kit (TaKaRa Biomedicals, Tokyo, Japan). The ratio of LDH activity in the supernatant to the total LDH activity was taken as the percentage of cell death. Protein was determined with the BCA kit (Pierce, Rockford, IL) using bovine serum albumin as standard.


    ACKNOWLEDGEMENTS
 
The authors would like to thank V. Georgiadis for help with the western blot. This study was supported by grants from the Parkinson’s Disease Society (UK), the Medical Research Council, the Wellcome Trust, the British Medical Association and the Deutsche Forschungsgemeinschaft.


    FOOTNOTES
 
+ These authors contributed equally to this work Back

§ To whom correspondence should be addressed. Tel: +44 207 830 2012; Fax: +44 207 431 1577; Email: schapira@rfhsm.ac.uk Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Polymeropoulos, M.H., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., Dutra, A., Pike, B., Root, H., Rubenstein, J., Boyer, R. et al. (1997) Mutation in the {alpha}-synuclein gene identified in families with Parkinson’s disease. Science, 276, 2045–2047.[Abstract/Free Full Text]

2 Kruger, R., Kuhn, W., Muller, T., Woitalla, D., Graber, M., Kosel, S., Przuntek, H., Epplen, J.T., Schols, L. and Riess, O. (1998) Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson’s disease. Nature Genet., 18, 106–108.[Web of Science][Medline]

3 Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi, M., Mizuno, Y. and Shimizu, N. (1998) Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature, 392, 605–608.[Medline]

4 Leroy, E., Boyer, R., Auburger, G., Leube, B., Ulm, G., Mezey, E., Harta, G., Brownstein, M.J., Jonnalagada, S., Chernova, T. et al. (1998) The ubiquitin pathway in Parkinson’s disease. Nature, 395, 451–452.[Medline]

5 Piccini, P., Burn, D.J., Ceravolo, R., Maraganore, D. and Brooks, D.J. (1999) The role of inheritance in sporadic Parkinson’s disease: evidence from a longitudinal study of dopaminergic function in twins. Ann. Neurol., 45, 577–582.[Web of Science][Medline]

6 Tanner, C.M., Ottman, R., Goldman, S.M., Ellenberg, J., Chan, P., Mayeux, R. and Langston, J.W. (1999) Parkinson’s disease in twins: an etiologic study. J. Am. Med. Assoc., 281, 341–346.[Abstract/Free Full Text]

7 Gasser, T. (1998) Genetics of Parkinson’s disease. Ann. Neurol., 44, S53–S57.[Web of Science][Medline]

8 Markopolou, K., Wzolek, Z.K., Pfeiffer, R.F. and Chase, B.A. (1999) Reduced expression of the G209A {alpha}-synuclein allele in familial parkinsonism. Ann. Neurol., 46, 374–381.[Web of Science][Medline]

9 Vaughan, J.R., Farrer, M.J., Wszolek, K., Gasser, T., Durr, A., Agid, Y., Bonifati, V., De Michele, G., Volpe, G., Lincoln, S. et al. (1998) Sequencing of the {alpha}-synuclein gene in a large series of cases of familial Parkinson’s disease fails to reveal any further mutations. Hum. Mol. Genet., 7, 751–753.[Abstract/Free Full Text]

10 Warner, T.T. and Schapira, A.H.V. (1998) The role of alpha-synuclein gene mutation in patients with sporadic Parkinson’s disease in the UK. J. Neurol. Neurosurg. Psychiatry, 65, 378–379.[Abstract/Free Full Text]

11 Farrer, M., Wavrant-De Vrieze, F., Crook, R., Boles, L., Perez-Tur, J., Hardy, J., Johnson, W.G., Steele, J., Maraganore, D., Gwinn, K. and Lynch, T. (1998) Low frequency of {alpha}-synuclein mutations in familial Parkinson’s disease. Ann. Neurol., 43, 394–397.[Web of Science][Medline]

12 Spillantini, M.G., Schmidt, M.L., Lee, V.M., Trojanowski, J.Q., Jakes, R. and Goedert, M. (1997) Alpha-synuclein in Lewy bodies. Nature, 388, 839–840.[Medline]

13 Masliah, E., Rockenstein, E., Vienbergs, I., Mallory, M., Hashimoto, M., Takeda, A., Sisk, Y.S.A. and Mucke, L. (2000) Dopaminergic loss and inclusion body formation in {alpha}-synuclein mice: implications for neurodegenerative disorders. Science, 287, 1265–1269.[Abstract/Free Full Text]

14 Tse, D.C., McCreery, R.L. and Adams, R.N. (1976) Potential oxidative pathways of brain catecholamines. J. Med. Chem., 19, 37–40.[Web of Science][Medline]

15 Graham, D.G. (1978) Oxidative pathways for catecholamines in the genesis of neuromelanin and cytotoxic quinones. Mol. Pharmacol., 14, 633–643.[Abstract/Free Full Text]

16 Jonsson, G. (1971) Quantitation of fluorescence of biogenic monoamines. Prog. Histochem. Cytochem., 2, 299–344.

17 Jensen, P.H., Nielsen, M.S., Jakes, R., Dotti, C.G. and Goedert, M. (1998) Binding of alpha-synuclein to brain vesicles is abolished by familial Parkinson’s disease mutation. J. Biol. Chem., 273, 26292–26294.[Abstract/Free Full Text]

18 Murphy, D.D., Rueter, S.M., Trojanowski, J.Q. and Lee, V.M.Y. (2000) Synucleins are developmentally expressed, and alpha-synuclein regulates the size of the presynaptic vesicular pool in primary hippocampal neurons. J. Neurosci., 20, 3214–3220.[Abstract/Free Full Text]

19 Ostrerova, N., Petrucelli, L., Farrer, M., Mehta, N., Choi, P., Hardy, J. and Wolizin, B. (1999) {alpha}-synuclein shares physical and functional homology with 14-3-3-proteins. J. Neurosci., 19, 5782–5791.[Abstract/Free Full Text]

20 . Golbe, LI.., Farrell, T.M. and Davis, P.H. (1988) Case-control study of early life dietary factors in Parkinson’s disease. Arch. Neurol., 45, 1350–1353.[Abstract/Free Full Text]

21 Feany, M.B. and Bender, W.W. (2000) A Drosophilia model of Parkinson’s disease. Nature, 404, 394–398.[Medline]

22 Zhou, W.B., Hurlbert, M.S., Schaack, K., Prasad, K.N. and Freed, C.R. (2000) Overexpression of human alpha-synuclein causes dopamine neuron death in rat primary culture and immortalized mesencephalon-derived cells. Brain Res., 866, 33–43.[Web of Science][Medline]

23 Forloni, G., Bertani, H., Calella, A.M., Thaler, F. and Invernizzi, R. (2000) {alpha}-synuclein and Parkinson’s disease: selective neurodegenerative effect of {alpha}-synuclein fragment on dopaminergic neurons in vitro and in vivo. Ann. Neurol., 47, 632–640.[Web of Science][Medline]

24 Irizarry, M.C., Kim, T.W., McNamara, M., Tanzi, R.E., George, J.M., Clayton, D.F. and Hyman, B.T. (1996) Characterization of the precursor protein of the non A beta component of senile plaques (NACP) in the human central nervous system. J. Neuropathol. Exp. Neurol., 55, 889–895.[Web of Science][Medline]

25 Kholodilov, N.G., Neystat, M., Oo, T.F., Larsen, K.E., Sulzer, D. and Burne, R.E. (1999) Increased expression of rat synuclein in the substantia nigra pars compacta identified by mRNA differential display in a model of developmental target injury. J. Neurochem., 73, 2586–2599.[Web of Science][Medline]

26 Abeliovich, A., Schmitz, Y., Fariñas, I., Choi-Lundberg, D., Ho, W.S., Castillo, P.E., Shinsky, N., Verdugo, J.M.G., Armanini, M., Ryan, A. et al. (2000) Mice lacking {alpha}-synuclein display functional deficits in the nigrostriatal dopamine system. Neuron, 25, 239–252.[Web of Science][Medline]

27 Lai, C.T. and Yu, P.H. (1997) Dopamine and L-dopa induced cytotoxicity towards catecholaminergic neuroblastoma. Biochem. Pharmacol., 53, 363–371.[Web of Science][Medline]

28 Ziv, I., Melamed, E., Nardi, N., Lurie, D., Achiron, A., Offen, D. and Barzilai, A. (1994) Dopamine induces apoptosis-like cell death in cultured sympathetic neurons—a possible novel pathogenetic mechanism in Parkinson’s disease. Neurosci. Lett., 170, 136–140.[Web of Science][Medline]

29 Alexander, T., Sortwell, C.E., Sladek, C.D., Roth, R.H. and Steece-Collier, K. (1997) Comparison of neurotoxicity following repeated administration of L-dopa, D-dopa and dopamine to embryogenic mesencephalic dopamine neurons in cultures derived from Fischer 344 and Sprague-Dawley donors. Cell Transplant., 6, 309–315.[Web of Science][Medline]

30 LaVoie, M.J. and Hastings, T.G. (1999) Peroxynitrite and nitrite induced oxidation of dopamine: implications for nitric oxide in dopaminergic cell loss. J. Neurochem., 73, 2546–2554.[Web of Science][Medline]

31 Hastings, T.G., Lewis, D.A. and Zigmond, M.J. (1996) Role of oxidation in the neurotoxic effects of intrastriatal dopamine injections. Proc. Natl Acad. Sci. USA, 93, 1956–1961.[Abstract/Free Full Text]

32 Hashimoto, M., Hsu, L.J., Xia, Y., Takeda, A., Sisk, A., Sundsmo, M. and Masliah, E. (1999) Oxidative stress induces amyloid-like aggregate formation of NACP-{alpha}-synuclein in vitro. Neuroreport, 106, 717–721.

33 Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162, 156–159.[Web of Science][Medline]

34 Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of protein form polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl Acad. Sci. USA, 76, 4350–4354.[Abstract/Free Full Text]

35 Clark, J.B. and Nicklas, W.J. (1970) The metabolism of rat brain mitochondria; preparation and characterisation. J. Biol. Chem., 245, 4724–4731.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
FASEB J.Home page
M. Ahmad, S. Attoub, M. N. Singh, F. L. Martin, and O. M. A. El-Agnaf
{gamma}-Synuclein and the progression of cancer
FASEB J, November 1, 2007; 21(13): 3419 - 3430.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
A. H.V. Schapira
Etiology of Parkinson's disease
Neurology, May 23, 2006; 66(10_suppl_4): S10 - S23.
[Abstract] [Full Text]


Home page
Hum Mol GenetHome page
W. W. Smith, H. Jiang, Z. Pei, Y. Tanaka, H. Morita, A. Sawa, V. L. Dawson, T. M. Dawson, and C. A. Ross
Endoplasmic reticulum stress and mitochondrial cell death pathways mediate A53T mutant alpha-synuclein-induced toxicity
Hum. Mol. Genet., December 15, 2005; 14(24): 3801 - 3811.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
M. Perluigi, H. F. Poon, W. Maragos, W. M. Pierce, J. B. Klein, V. Calabrese, C. Cini, C. De Marco, and D. A. Butterfield
Proteomic Analysis of Protein Expression and Oxidative Modification in R6/2 Transgenic Mice: A Model of Huntington Disease
Mol. Cell. Proteomics, December 1, 2005; 4(12): 1849 - 1861.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. V. Kalivendi, S. Cunningham, S. Kotamraju, J. Joseph, C. J. Hillard, and B. Kalyanaraman
{alpha}-Synuclein Up-regulation and Aggregation during MPP+-induced Apoptosis in Neuroblastoma Cells: INTERMEDIACY OF TRANSFERRIN RECEPTOR IRON AND HYDROGEN PEROXIDE
J. Biol. Chem., April 9, 2004; 279(15): 15240 - 15247.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Zhou and C. R. Freed
Tyrosine-to-Cysteine Modification of Human {alpha}-Synuclein Enhances Protein Aggregation and Cellular Toxicity
J. Biol. Chem., March 12, 2004; 279(11): 10128 - 10135.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Ninkina, K. Papachroni, D. C. Robertson, O. Schmidt, L. Delaney, F. O'Neill, F. Court, A. Rosenthal, S. M. Fleetwood-Walker, A. M. Davies, et al.
Neurons Expressing the Highest Levels of {gamma}-Synuclein Are Unaffected by Targeted Inactivation of the Gene
Mol. Cell. Biol., November 15, 2003; 23(22): 8233 - 8245.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
A.H. V. Schapira
Neuroprotection in PD--A role for dopamine agonists?
Neurology, September 23, 2003; 61(90063): S34 - 42.
[Full Text]


Home page
J. Neurosci.Home page
D. C. Mash, Q. Ouyang, J. Pablo, M. Basile, S. Izenwasser, A. Lieberman, and R. J. Perrin
Cocaine Abusers Have an Overexpression of alpha -Synuclein in Dopamine Neurons
J. Neurosci., April 1, 2003; 23(7): 2564 - 2571.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Kirik, L. E. Annett, C. Burger, N. Muzyczka, R. J. Mandel, and A. Bjorklund
Nigrostriatal alpha -synucleinopathy induced by viral vector-mediated overexpression of human alpha -synuclein: A new primate model of Parkinson's disease
PNAS, March 4, 2003; 100(5): 2884 - 2889.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Lotharius, S. Barg, P. Wiekop, C. Lundberg, H. K. Raymon, and P. Brundin
Effect of Mutant alpha -Synuclein on Dopamine Homeostasis in a New Human Mesencephalic Cell Line
J. Biol. Chem., October 4, 2002; 277(41): 38884 - 38894.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z.-Z. Pan, W. Bruening, B. I. Giasson, V. M.-Y. Lee, and A. K. Godwin
gamma -Synuclein Promotes Cancer Cell Survival and Inhibits Stress- and Chemotherapy Drug-induced Apoptosis by Modulating MAPK Pathways
J. Biol. Chem., September 13, 2002; 277(38): 35050 - 35060.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. P. Mattson, S. L. Chan, and W. Duan
Modification of Brain Aging and Neurodegenerative Disorders by Genes, Diet, and Behavior
Physiol Rev, July 1, 2002; 82(3): 637 - 672.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
D. Kirik, C. Rosenblad, C. Burger, C. Lundberg, T. E. Johansen, N. Muzyczka, R. J. Mandel, and A. Bjorklund
Parkinson-Like Neurodegeneration Induced by Targeted Overexpression of alpha -Synuclein in the Nigrostriatal System
J. Neurosci., April 1, 2002; 22(7): 2780 - 2791.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Hashimoto, L. J. Hsu, E. Rockenstein, T. Takenouchi, M. Mallory, and E. Masliah
alpha -Synuclein Protects against Oxidative Stress via Inactivation of the c-Jun N-terminal Kinase Stress-signaling Pathway in Neuronal Cells
J. Biol. Chem., March 22, 2002; 277(13): 11465 - 11472.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
A. H. V. Schapira
Neuroprotection and dopamine agonists
Neurology, February 1, 2002; 58(90001): S9 - 18.
[Abstract] [Full Text]


Home page
J. Neurosci.Home page
L. Stefanis, K. E. Larsen, H. J. Rideout, D. Sulzer, and L. A. Greene
Expression of A53T Mutant But Not Wild-Type alpha -Synuclein in PC12 Cells Induces Alterations of the Ubiquitin-Dependent Degradation System, Loss of Dopamine Release, and Autophagic Cell Death
J. Neurosci., December 15, 2001; 21(24): 9549 - 9560.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
E. Paxinou, Q. Chen, M. Weisse, B. I. Giasson, E. H. Norris, S. M. Rueter, J. Q. Trojanowski, V. M.-Y. Lee, and H. Ischiropoulos
Induction of {alpha}-Synuclein Aggregation by Intracellular Nitrative Insult
J. Neurosci., October 15, 2001; 21(20): 8053 - 8061.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Petersen, K. E. Larsen, G. G. Behr, N. Romero, S. Przedborski, P. Brundin, and D. Sulzer
Expanded CAG repeats in exon 1 of the Huntington's disease gene stimulate dopamine-mediated striatal neuron autophagy and degeneration
Hum. Mol. Genet., June 1, 2001; 10(12): 1243 - 1254.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Y. Tanaka, S. Engelender, S. Igarashi, R. K. Rao, T. Wanner, R. E. Tanzi, A. Sawa, V. L. Dawson, T. M. Dawson, and C. A. Ross
Inducible expression of mutant {{alpha}}-synuclein decreases proteasome activity and increases sensitivity to mitochondria-dependent apoptosis
Hum. Mol. Genet., April 1, 2001; 10(9): 919 - 926.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Y. Sung, J. Kim, S. R. Paik, J. H. Park, Y. S. Ahn, and K. C. Chung
Induction of Neuronal Cell Death by Rab5A-dependent Endocytosis of alpha -Synuclein
J. Biol. Chem., July 13, 2001; 276(29): 27441 - 27448.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (99)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tabrizi, S. J.
Right arrow Articles by Schapira, A. H.V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tabrizi, S. J.
Right arrow Articles by Schapira, A. H.V.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?