Human Molecular Genetics, 2000, Vol. 9, No. 2 187-194
© 2000 Oxford University Press
Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase
The Murdoch Institute, Royal Children’s Hospital, Flemington Road, Parkville 3052, Australia and 1Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA
Received 17 August 1999; Revised and Accepted 24 November 1999.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
A double-stranded 9 bp GTGAAAAAG pJ
sequence found in human centromeric -satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible ‘spreading’ of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on -satellite-negative human neo- centromeres and on the active but not the inactive -satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G2 phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The centromere is an essential structure for the proper segregation of chromosomes in mitosis and meiosis. Centromere DNA of all higher eukaryotes studied to date has been shown to be composed of large arrays of tandemly repeated sequences (1). In humans and mouse, this DNA is the 171 bp
-satellite and 120 bp minor satellite sequences, respectively. A peculiarity of the centromeric repeats is their apparent lack of sequence homology through the phylogeny. The recent discovery of functional neocentromeres in humans (2–4) and Drosophila (5) that are devoid of the usual centromeric repeat DNA lends further support to the notion that a ‘magic’ centromere DNA sequence does not exist (1,4,6). The biological reasons for this centromere DNA plasticity and the mechanisms whereby the different species have evolved to compensate for this absence of centromere sequence conservation remain unclear.
An increasing number of centromere-binding proteins have been described (1,7–13). These proteins perform diverse roles including assembly and maintenance of centromere structure, sister chromatid cohesion, checkpoint control, chromosome movement and spindle microtubule dynamics. A number of these proteins are thought to interact with the mammalian centromere at the DNA, nucleosome or chromatin level. Four of these proteins (CENP-A, -B, -C and -G) are constitutive and specific to the centromere. CENP-A is a histone H3-related protein that probably replaces normal histone H3 to form a centromere-unique nucleosomal structure (14). A homologue of this protein, Cse4p, is found in Saccharomyces cerevisiae (15,16). CENP-B binds a 17 bp CENP-B box sequence motif found in the centromeric repeat DNA of a number of mammalian species, including those of human -satellite and mouse minor satellites (17,18). The significance of this protein is uncertain since the protein is absent on human and mouse Y centromeres, all African green monkey centromeres (made up of -satellite DNA) and analphoid human neocentromeres (1,4). The protein is non-essential in Cenpb-disrupted mice (19–21). CENP-C is an essential protein (22,23) that is thought to be important for centromere structure integrity and microtubule attachment (24). The highly basic nature of the protein and its significant homology with Mif2p, a centromere protein found in budding yeast that has been shown to interact with centromeric DNA in vivo (25), suggest that CENP-C may bind mammalian centromere DNA directly but its exact mode of action has not been established. CENP-G is a newly identified protein that associates with a subset of the human -satellite DNA and is present on the centromeres of all human chromosomes (26). The role of this protein also remains to be investigated. In addition to these intrinsic centromere proteins, two other proteins (topoisomerase II, HMG-I) are thought to be transiently associated with the mammalian centromere DNA during specific stages of the cell cycle (27,28).
In this study, we have used synthetic oligonucleotides derived from human -satellite DNA and a cloned neocentromere DNA in the affinity purification of a nuclear protein that we demonstrate to be PARP, a well studied enzyme that catalyses a ubiquitous poly(ADP-ribosyl)ation reaction in higher eukaryotes (29,30). We show that PARP is concentrated on active mammalian metaphase centromeres/neocentromeres, and discuss the significance of the observed association between PARP and the centromere.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Affinity purification of a 110 kDa protein
A double-stranded 9 bp GTGAAAAAG sequence motif of the human centromeric
-satellite DNA was previously shown to bind an unknown nuclear protein, pJ, in HeLa cell nuclear extract using gel-mobility shift assay (31). Here, we employed this oligonucleotide to affinity-purify its binding protein from cultured human and mouse cells. Following binding of nuclear proteins onto the affinity resin, bound proteins were eluted stepwise with different salt gradients. Figure 1a shows results obtained at 0.5 and 1.0 M salt concentrations, indicating the presence of highly purified human and mouse proteins of 110 kDa in the 1.0 M elution fraction [also in the 1.5 M salt fraction (data not shown)]. A relatively abundant protein of 45 kDa is often seen in the 0.5 M fraction and occasionally in the 1 and 1.5 M fractions as a minor band.
|
We investigated further the possibility that the 110 kDa protein may bind sequences found within neocentromere DNA. This investigation was made possible by the availability of the complete sequence of an 80 kb core centromere antigen-binding region of the mar del(10) neocentromere (32). Detailed computational analysis of this sequence has demonstrated many AT-rich islands. Of particular interest was an ~600 bp variable number of tandem repeats (VNTR) sequence known as AT28, which has an A + T content of >80% and consists of 28 bp basic repeating units with a consensus sequence of 5'-ATGTATATATGTGTATATAGACATAAAT. Because of the generally high A + T content of most centromeric sequences (1), we chose to test the AT-rich, double-stranded AT28 sequence as a possible substrate for affinity purification. The result demonstrated direct binding and a one-step purification of the 110 kDa protein from crude human nuclear extract (Fig. 1b).
As controls, we tested the affinity of the 110 kDa protein to bind a number of other double-stranded oligonucleotide sequences. These sequences included two variant dimeric oligonucleotides of the pJ motif (MDR1 and MDR2), a CENP-B box motif and four unrelated random oligonucleotides (RO1–RO4) (Table 1). Weak binding of the 110 kDa protein to MDR1 and MDR2 was observed (Fig. 1c), whereas no significant binding was detected for the CENP-B box and RO1–RO4 sequences (data not shown). These results suggested preferential binding of the 110 kDa protein to the pJ and AT28 sequences, and greatly reduced or no affinity for other sequence motifs.
|
Identification of the 110 kDa protein as PARP
The 110 kDa human protein purified using the pJ
-affinity resin was initially subjected to N-terminal microsequencing. The results indicated that the protein was blocked at the N-terminus, making this end inaccessible to direct sequencing. As an alternative approach, the purified protein was digested with trypsin and analysed by high-resolution HPLC. A database search of the resulting tryptic fingerprint pattern revealed a match with that of the human PARP enzyme. Microsequencing of three purified tryptic peptides confirmed their PARP identity (data not shown) and prompted further direct comparison and studies with commercially available PARP and anti-PARP antibodies. Using South-western blot analysis, the affinity-purified protein was shown to bind 32P-labelled pJ sequence identically to the commercial PARP (Fig. 1d). [32P]pJ binding was abolished when an excess of unlabelled pJ oligonucleotide was added in the probe mix as competitors (data not shown). In western blot analysis, both polyclonal and monoclonal anti-PARP antibodies cross-reacted with crude HeLa nuclear extract, mouse and human 110 kDa protein purified using the pJ oligonucleotide, as well as human 110 kDa protein purified using the AT28 oligonucleotide (Fig. 1e). These studies identified the affinity-purified 110 kDa protein as PARP.
Centromere localization of PARP
The polyclonal anti-PARP antibody was employed in immunofluorescence studies. The antibody was raised against a purified recombinant peptide corresponding to amino acids 71–329 of murine PARP (33). Figure 2a–c shows the results of immunofluorescence staining of metaphase chromosomes from cultured human, mouse and sheep cells. In order to determine clearly the position of the centromere, the slides were simultaneously stained with an anti-centromere antiserum CREST#6, which was known to cross-react with centromere proteins CENP-A and -B (2). The results indicated strong centromeric localization of PARP on all the chromosomes in the three species, with diffuse staining also seen on the chromosomal arms. Interestingly, the mouse chromosomes showed a larger area of enhanced anti-PARP staining relative to the CREST#6 antiserum staining, suggesting possible PARP association with both mouse minor and major satellite DNA.
|
p11.2),+invdup(20p)] containing a chromosome 20-derived neocentromere (39), a mouse embryonic stem cell line, and a sheep cell line, respectively, showing immunofluorescence colocalization of PARP (green) with centromere proteins (red), and a more generalized localization of PARP on chromosome arms. All the centromeres (including the neocentromere in the human metaphase preparation) showed distinctly enhanced PARP signals. (d and e) Localization of PARP on G1 and S/G2 interphase nuclei, respectively, of mouse embryonic stem cells. G1 and S/G2 cells were distinguished by the detection of only single centromeric foci in G1 phase (d-3) or the presence of paired centromeric signals in S/G2 phase (e-3). The intense patches of PARP staining seen in (d-2) and (e-2) correspond presumably to the nucleoli. Arrowheads point to foci of weak colocalization of PARP with centromeric antigens in S/G2 cells. PARP signals were detected using the polyclonal anti-PARP antibody, whereas centromere signals were detected using the CREST#6 antiserum. (1) Merged images; (2 and 3) split images for green and red, respectively.Analysis of PARP distribution during interphase was performed. Cells in G1 phase were identified by the presence of only single CREST immunofluorescence signals (corresponding to non-replicated chromosomes) (Fig. 2d), whereas cells in S/G2 phase were recognized by the detection of paired immunofluorescence signals due to centromere replication (Fig. 2e). Staining of these interphase cells with anti-PARP antibodies revealed high background signals throughout the nucleus, with especially prominent patches of staining seen in some intranuclear structures that presumably corresponded to the nucleoli. No specific colocalization of CREST with discrete PARP signals was observed in the G1 nucleus (Fig. 2d), whereas close examination of S/G2 nuclei revealed a weak colocalization in many discernible foci despite the high background level of PARP staining (Fig. 2e). These results suggest that PARP accumulation at the centromere may begin during S/G2 phase, and continue into and become increasingly prominent at the centromere as the chromosome condenses.
Absence of PARP on human non-centromeric heterochromatin
We were interested to know whether: (i) PARP binding distinguishes between centromeric heterochromatin and other non-centromeric heterochromatic regions of the human genome; (ii) PARP binding is specific for active centromeres only; and (iii) the protein recognizes the non-heterochromatic and analphoid neocentromeres. To address the first question, we closely examined the immunofluorescence results of human metaphases such as that shown in Figure 2a. The analysis indicated tight PARP and CREST#6 signals on all the human centromeres with no evidence of concentrated PARP staining at all non-centromeric heterochromatic regions of the genome (Fig. 2a, and data not shown). To gain further insight, we combined PARP immunofluorescence and fluorescence in situ hybridization (FISH) using a Y chromosome-specific -satellite probe to examine the Y chromosome. This chromosome was chosen because its long-arm heterochromatic region is well separated from the centromeric heterochromatin and because its -satellite-containing centromere is devoid of CENP-B proteins. Figure 3a indicates a distinctively enhanced binding of PARP to the centromere but not the q12 heterochromatic region of this chromosome, thus confirming preferential PARP binding for the centromeric heterochromatin.
|
Presence of PARP on the active but not the inactive centromere
In an earlier study a t(X;15) pseudo-dicentric human chromosome was shown to contain an active centromere derived from a translocated X chromosome and an inactive centromere derived from chromosome 15 (34). In that study only the active centromere bound centromere protein CENP-C, whereas both the active and inactive centromeres were shown to bind CENP-B. Here, we further characterized and confirmed the properties of the dicentric chromosome by demonstrating specific binding of the active but not the inactive centromere to another essential (35) centromere protein, INCENP, as well as establishing the presence of substantial amounts of
-satellite DNA on both the centromeres (Fig. 3b). Immunofluorescence analysis of the dicentric chromosome (Fig. 3c) indicated colocalization of the PARP signal with the anti-centromere antibody signal on the active centromere but not on the inactive centromere. The specificity of the CREST#6 anti-centromere antibody for CENP-A and -B, and the fact that CENP-B was known to bind both active and inactive -satellite-containing centromeres (34,36,37), explained the CREST#6 immunofluorescence signal on the inactive centromere (CENP-B only), and the significantly stronger CREST#6 signal seen on the active centromere (CENP-A + CENP-B).
PARP binding to human neocentromeres
Two previously reported human marker chromosomes containing neocentromeres, mar del(10) and inv dup(20), derived from the q25 region of chromosome 10 (2,38) and p12 region of chromosome 20 (39), respectively, were used for this study. Initial immunofluorescence analysis using the anti-PARP antibody on metaphase chromosomes indicated strong signals on all the centromeres including the neocentromeres (Fig. 2a, and data not shown). Subsequent experiments employed simultaneous anti-PARP immunofluorescence and FISH using a cloned probe for the mar del(10) neocentromere. The result indicated a positive colocalization of immunofluorescence with the neocentromere DNA signal (Fig. 3d) but not on the corresponding 10q25 region of a normal chromosome 10 in the absence of neocentromere formation (data not shown), thus confirming increased direct binding of PARP to the functional neocentromere.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The 9 bp GTGAAAAAG pJ
sequence motif used in the affinity purification procedure resulted in the isolation of a 110 kDa protein that, based on size, is different from the 15 kDa pJ protein previously shown to bind this sequence by gel-mobility shift assay (31). The reason for this discrepancy is at present unclear. Several lines of evidence indicate that the 110 kDa protein affinity-purified using the pJ or AT28 sequence is PARP. These include similar molecular weight and tryptic and sequence profiles, South-western blot comparison against commercial PARP and western blot analysis using anti-PARP antibodies. The decreased or zero binding seen when other related or unrelated oligonucleotides were used as affinity substrates further indicates considerable, but not absolute, binding specificity for the pJ and AT28 sequences. Immunofluorescence studies on human, mouse and sheep metaphase chromosomes establish PARP as a previously unsuspected protein of the mammalian centromere. Since PARP is a highly conserved protein in all higher eukaryotes, it is likely that the protein may also be a component of other non-mammalian centromeres. Cell cycle analysis indicates that PARP is present abundantly in the interphase nucleus. This observation is consistent with the reported role of this enzyme in many central nuclear functions (discussed below). Despite the high level of nuclear staining, making it difficult to detect PARP binding to specific substructures, some colocalization of the enzyme with centromeric antigens is discernible during S/G2 phase. Such a colocalization becomes more prominent as the chromosomes condense and the cells progress into metaphase. It is unclear whether this greater prominence is due to an increased PARP binding at the centromere or to the significantly decreased background signals following the disassembly of the nuclear membrane during the mitotic phase. Regardless, the S/G2 results suggest a possible functional role of PARP at the centromere at the time of, or shortly after, DNA replication.
Analysis of a pseudo-dicentric chromosome carrying an active and an inactive centromere, both containing -satellite sequences, indicates that PARP binding is unique to the active centromere and that this binding can discriminate against inactive centromeric heterochromatin. That PARP binding is not preferentially associated with constitutive heterochromatin is also demonstrated by our failure to detect elevated levels of the protein on the major block of heterochromatin at the Yq12 region. Investigation of two unrelated neocentromeres derived from chromosomes 10 and 20 further indicates association of PARP with non-heterochromatic neocentromeres. These observations clearly demonstrate that enhanced PARP binding correlates directly with centromere/neocentromere activities and that binding is independent of the heterochromatic properties of a chromosomal region.
PARP has been described as a DNA-binding protein that recognizes single-strand DNA breaks in a sequence-independent manner, symmetrically covering 7–8 nucleotides on each side of the break (40,41). The protein is highly conserved through evolution and enzymatically catalyses poly(ADP-ribosyl)ation reactions that appear ubiquitous in higher eukaryotes (42–44). DNA binding is believed to be a prerequisite for enzymatic activity of PARP. Despite extensive studies, the physiological role of poly(ADP-ribose) metabolism in cells remains unclear. Several hypotheses suggest an involvement in central nuclear processes, such as DNA repair, apoptosis, transcriptional regulation and differentiation, anti-recombination, chromosomal stability, cell cycle control, scaffold attachment and modulation of DNA or chromatin structures (reviewed in refs 29,30). In view of these diverse possibilities, it is of interest to speculate on the mode of interaction between PARP and the centromere, and the role PARP may play in the centromere.
Our finding that PARP binds in vitro strongly to two defined DNA sequence motifs found in normal human centromeres and a functional neocentromere suggests a possible mechanism whereby PARP may be recruited to the centromere through direct DNA recognition. In the case of normal human centromeres, the high prevalence of the pJ motif in -satellite DNA would provide a generous template for PARP binding. For the mar del(10) neocentromere, it is possible that sequences other than the AT28 DNA, such as the many AT-rich islands scattered throughout the cloned neocentromere DNA (32), may also serve as suitable substrates for PARP binding. It is now believed that there is no ‘magic’ centromere DNA sequence and that centromere DNA is, in general, not conserved throughout evolution (1,4,6). Our observation suggests the possibility that centromere/neocentromere recognition by PARP may occur in a sequence-independent manner that may offer a compensatory mechanism for the centromere DNA plasticity paradox.
Although the in vitro affinity binding studies suggest that direct interaction with centromere-specific DNA sequences may be responsible for the centromeric localization of PARP, other observations indicate that the nature of this interaction is somewhat more complex. First, the fact that centromerically inactive -satellite DNA on a dicentric chromosome and the DNA sequences on a normal chromosome 10 in the absence of neocentromere formation do not both show enhanced PARP binding suggests that sequence alone is insufficient and that binding is in some ways linked with centromere activity. Secondly, on mouse chromosomes, strong localization of PARP to a larger area (presumably due to major satellite DNA) than that occupied by the anti-centromere CREST antibodies (presumably due to minor satellite DNA) suggests that additional PARP binding can occur around the nucleus of the core centromere activity. This enlarged area of PARP binding is probably unlikely to be solely related to the heterochromatin- or sequence-nature of the mouse major satellite, since the human Yq12 and dicentric chromosome results suggest that heterochromatin or sequence alone is not sufficient for PARP binding. Instead, we propose a possible model for the mouse centromere where the nucleation of PARP on a preferred site (minor satellite) may promote or allow the ‘spreading’ of PARP binding to a surrounding less-preferred site (major satellite). Other workers have previously proposed a similar model for the spreading of centromere-marking factors to adjacent non-centromeric sequences as a way of imprinting a silent state of the centromere property onto neighbouring chromosomal regions (5,6).
What is the role of PARP at the centromere? Simplistically, a role related to the enzymatic function of this protein could be implicated, i.e. poly(ADP-ribosyl)ation modification of the protein itself (automodification) or of other protein acceptors (heteromodification) (29). The list of protein acceptors shown to be modified by PARP includes histones, topoisomerases, DNA polymerases, HMG-proteins, nuclear matrix proteins and protein kinases. Generally, modification of such potential target proteins through the addition of ADP-ribose moieties inhibits their activity, probably because the modification decreases their DNA-binding ability. It can therefore be proposed that PARP may be a negative epigenetic (6,45) regulator of the activity of one or more protein acceptors at the centromere. Two recent studies on the telomere have highlighted a role of PARP in the regulation of chromosomal structure and activity. First, Smith et al. (46) reported the identification of a PARP homologue (tankyrase) and ADP-ribosylation activity at human telomeres, and proposed a similar negative regulatory role for the protein. Secondly, d’Adda di Fagagna et al. (47) showed that PARP-deficient mice/cells display telomere shortening and severe chromosomal instability characterized by increased chromosome fusion and aneuploidy. In addition to these studies, the observation that mice deficient in PARP appear normal (48–50) implies functional redundancy of this protein, a possibility supported by the recent report of two novel PARP homologues (51). Further studies aimed at elucidating the role of PARP and putative functional homologue(s) in the centromere should be rewarding.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Cell lines
Human HeLa cells were used for the preparation of nuclear extracts for the affinity purification of PARP. Cell lines used for immunofluorescence and FISH analyses were: (i) two lymphoblastoid cell lines BE and JW carrying a neocentromeric marker chromosome derived from human chromosomes 10 (2) and 20 (39), respectively; (ii) a human t(X;15) pseudo-dicentric chromosome with an active X-derived centromere and an inactive 15-derived centromere (34); (iii) a mouse embryonic stem cell line R1(+/+B) derived from the R1 substrain (Murdoch Institute culture collection, Melbourne, Australia); and (iv) a Merino sheep fibroblast cell line S99 (Murdoch Institute culture collection).
Preparation of nuclear extract
HeLa cells (107) were harvested using trypsin, washed once in phosphate-buffered saline (PBS) and pelleted at 200 g. The cells were washed in 5 ml of Buffer A (10 mM HEPES–KOH pH 7.9, 10 mM KCl, 1.5 mM MgCl2) containing fresh protease inhibitors [10 mM dithiothreitol (DTT), 0.1% phenylmethylsulfonyl fluoride, 1 mg/ml leupeptin]. After repelleting, the cells were resuspended in 5 ml of Buffer A and incubated on ice for 20 min. On immediate addition of 325 µl of 10% NP-40 the cells were vortexed for 10 s and pelleted at 300 g. The nuclear pellet was resuspended in 2.5 ml of protein extraction buffer (420 mM NaCl, 20 mM HEPES–KOH pH 7.9, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol) containing protease inhibitors as above and incubated on ice for 20 min, mixing occasionally. The nuclei were then centrifuged at 500 g and the supernatant, containing the nuclear proteins, collected.
Affinity purification
Affinity purification of nuclear proteins was achieved using double-stranded oligonucleotides coated onto magnetic beads. Streptavidin-coated Dynabeads (175 µl of 1 mg/ml) (Dynal, Oslo, Norway) were incubated with 3 µg (100 ng/µl) of 5'-biotinylated oligonucleotides and 60 µl of PBS (pH 7.4) on a shaker at room temperature for 30 min. Nuclear extract (1.5 ml) was pre-incubated with 125 µl of 10 mM DTT, 125 µl of 1 µg/µl poly(dI·dC) and 0.25 ml of Gel Shift Buffer (GSB) (10 mM HEPES, 40 mM KCl, 2 mM MgCl2, 5% glycerol) and 0.5 ml of distilled water for 20 min at room temperature. The extract- and oligonucleotide-coated beads were combined for 20 min with gentle agitation at room temperature. The protein-bound beads were separated using a magnetic separator (Dynal) and washed once in GSB. Bound proteins were eluted using 300 µl of increasing concentrations of NaCl. This elution (10 µl) was analysed by polyacrylamide gel electrophoresis (PAGE) and visualized by silver staining.
Protein sequencing
Affinity-purified protein samples were de-salted and concentrated by methanol precipitation for 3 h at –80°C followed by centrifugation at 12 000 g for 10 min. Samples were separated by PAGE and electroblotted onto PVDF membrane. The membrane was stained by a brief (<5 min) incubation in Coomassie stain (0.2% Coomassie Blue R-250, 45% methanol, 10% acetic acid) and destained in 45% ethanol, 10% acetic acid. The membrane was allowed to dry and the desired protein band cut from the membrane for sequencing. N-terminal sequencing was performed by Edman degradation using a Perkin-Elmer (Foster City, CA) ABI Model 494 Procise sequencer with an on-line 140C Microgradient HPLC. For internal sequencing ~25 pmol were digested in trypsin and the resulting peptides were separated using the Pharmacia SMART system. Selected peptide fragments were sequenced using Edman chemistry as described above. To obtain the tryptic digest fragmentation pattern the gel slice containing sample protein was washed in 60:40 (v/v) 50 mM (NH4HCO3:acetonitrile several times to remove residual Coomassie stain. The gel slice was then dried by vacuum centrifugation for 20 min. The dried gel sample was then rehydrated in 20 µl of trypsin solution (12.5 ng/µl) in 50 mM (NH4HCO3 and incubated at 4°C for 45 min. The remaining solution was removed and the gel slice was incubated in 50 mM (NH4HCO3 for 4 h. The sample was then purified through a microcolumn filled with POROS R2 resin (PerSeptive Biosystems, Sydney, Australia) and spotted onto a MALDI plate with -cyano-hydroxycinnamic acid matrix and subjected to MALDI-TOF mass spectrometry using a PerSeptive Biosystems Voyager DE-STR mass spectrometer fitted with a 337 nm nitrogen laser. Spectra were produced from the summed average of 256 laser shots and calibrated using internal tryptic digest fragments 842.51 Da and 2211.09 Da. The resultant peak list was used to search the PeptIdent program available via the ExPasy server (http://www.expasy.ch ).
South-western blot analysis
Analysis was carried out in duplicate. HeLa nuclear extract (5 µg), 0.3 pmol of affinity-purified protein and 0.5 µg of commercial PARP protein were separated by PAGE and transferred to Hybond C at 80 mA for 2 h in transfer buffer (2.4 g/l Tris, 11.25 g/l glycine). Following this, the identically blotted membranes were rinsed for 5 min each in 6, 3, 1.5, 0.75, 0.375 and 0.18 M guanidine–HCl pH 7.9. The membranes were blocked overnight at 4°C in GSB containing 100 µg/µl salmon sperm DNA and 5% skimmed milk. Following this, the membranes were washed in rinse buffer pH 7.9 (GSB containing 0.25% skimmed milk, 1 mM DTT). Both membranes were incubated overnight at 4°C with 300 ng of radioactively end-labelled pJ probe diluted in 10 ml of rinse buffer containing 100 µg/µl salmon sperm. A 1000-fold excess of cold pJ was added to one membrane as competition. Membranes were washed by 3 x 30 min washes in rinse buffer pH 7.9 containing 100 µl of Triton X-100 at 4°C and visualized by autoradiography.
Western blot analysis
Western blot analysis was done using monoclonal anti-PARP antibody (Trevigen, Gaithersburg, MD), which recognizes full-length PARP and 85 kDa apoptosis-related cleavage fragment and polyclonal anti-PARP antibody (R&D Systems, Minneapolis, MN).
Protein samples were separated by PAGE and transferred to Hybond C as described for South-western blotting. The filter was then placed in blocking buffer containing TBS (25 mM Tris–HCl and 0.5 M NaCl) with 5% skimmed milk overnight at 4°C. Anti-PARP antibody was diluted 1:2000 in TBS with 1% skimmed milk and incubated at room temperature for 1 h. The membrane was washed for 3 x 15 min in wash buffer containing TBS and 0.1% Tween-20 at room temperature. Peroxidase-labelled secondary antibody was diluted 1:10 000 in TBS with 1% skimmed milk and incubated at room temperature for 1 h before 3 x 15 min washes in wash buffer at room temperature. Proteins were visualized using a chemiluminescence detection kit (Amersham Pharmacia Biotech, Uppsala, Sweden) and autoradiography.
FISH and immunofluorescence analysis
Single or simultaneous FISH and immunofluorescence detection of chromosomal proteins were performed as previously described (2). Human anti-centromere antibody CREST#6 was specific for centromere proteins CENP-A and -B (2). Rabbit anti-chicken INCENP antibody was a generous gift of W.C. Earnshaw (University of Edinburgh, Edinburgh, UK). Goat polyclonal anti-murine PARP antibody was purchased from R&D Systems.
|
ACKNOWLEDGEMENTS |
|---|
We thank the Australian Proteome Analysis Facility for tryptic peptide fingerprinting, Newcastle Protein for microsequencing of tryptic peptides and W.C. Earnshaw for the INCENP antibody. This work was supported by the National Health and Medical Research Council of Australia. K.H.A.C. is a Principal Research Fellow of the Council.
|
FOOTNOTES |
|---|
+ These authors contributed equally to this work
§ To whom correspondence should be addressed. Tel: +61 3 8341 6306; Fax: +61 3 9348 1391; Email: choo@cryptic.rch.unimelb.edu.au
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Choo, K.H.A. (1997) The Centromere. Oxford University Press, Oxford, New York, Tokyo.
2 du Sart, D., Cancilla, M.R., Earle, E., Mao, J., Saffery, R., Tainton, K.M., Kalitsis, P., Martyn, J., Barry, A.E. and Choo, K.H.A. (1997) A functional neo-centromere formed through activation of a latent human centromere and consisting of non--satellite DNA. Nature Genet., 16, 144–153.[Web of Science][Medline]
3 Depinet, T.W., Zackowski, J.L., Earnshaw, W.C., Kaffe, S., Sekhon, G.S., Stallard, R., Sullivan, B.A., Vance, G.H., Dyke, D.L.V., Willard, H.F. et al. (1997) Characterization of neo-centromeres in marker chromosomes lacking detectable -satellite DNA. Hum. Mol. Genet. 6, 1195–1204.
4 Choo, K.H.A. (1997) Centromere DNA dynamics: latent centromeres and neocentromere formation. Am. J. Hum. Genet., 61, 1225–1233.[Web of Science][Medline]
5 Williams, B.C., Murphy, T.D., Goldberg, M.L. and Karpen, G.H. (1998) Neocentromere activity of structurally acentric minichromosomes in Drosophila. Nature Genet., 18, 30–37.[Web of Science][Medline]
6 Karpen, G.H. and Allshire, R.C. (1997) The case for epigenetic effects on centromere identity and function. Trends Genet., 13, 489–496.[Web of Science][Medline]
7 Allshire, R.C. (1997) Centromeres, checkpoints and chromatid cohesion. Curr. Opin. Genet. Dev., 7, 264–273.[Web of Science][Medline]
8 Clarke, L. (1998) Centromeres: proteins, protein complexes, and repeated domains at centromeres of simple eukaryotes. Curr. Opin. Genet. Dev., 8, 212–218.[Web of Science][Medline]
9 Craig, J.M., Earnshaw, W.C. and Vagnarelli, P. (1998) Mammalian centromere: DNA sequence, protein composition, and role in cell cycle progression. Exp. Cell Res., 246, 249–262.
10 Rieder, C.L. and Salmon, E.D. (1998) The vertebrate cell kinetochore and its role during mitosis. Trends Cell Biol., 8, 310–317.[Web of Science][Medline]
11 Skibbens, R.V. and Hieter, P. (1998) Kinetochores and the checkpoint mechanism that monitors for defects in the chromosome segregation machinery. Annu. Rev. Genet., 32, 307–337.[Web of Science][Medline]
12 Amon, A. (1999) The spindle checkpoint. Curr. Opin. Genet. Dev., 9, 69–75.[Web of Science][Medline]
13 Dobie, K.W., Hari, K.L., Maggert, K.A. and Karpen, G.H. (1999) Centromere proteins and chromosome inheritance: a complex affair. Curr. Opin. Genet. Dev., 9, 206–217.[Web of Science][Medline]
14 Palmer, D.K., O’Day, K., Wener, M., Andrews, B. and Margolis, R. (1987) A 17-kD centromere protein (CENP-A) copurifies with nucleosome core particles and with histones. J. Cell Biol., 104, 805–815.
15 Stoler, S., Keith, K., Curnick, K. and Fitzgerald-Hayes, M. (1995) A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev., 9, 573–586.
16 Meluh, P.B., Yang, P., Glowczewski, L., Koshland, D. and Smith, M.M. (1998) Cse4p is a component of the core centromere of Saccharomyces cerevisiae. Cell, 94, 607–613.[Web of Science][Medline]
17 Masumoto, H., Masukata, H., Muro, Y., Nozaki, N. and Okazaki, T. (1989) A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA: a human centromeric satellite. J. Cell Biol., 109, 1963–1973.
18 Muro, Y., Masumoto, H., Yoda, K., Nozaki, N., Ohashi, M. and Okazaki, T. (1992) Centromere protein B assembles human centromeric -satellite DNA at the 17-bp sequence, CENP-B box. J. Cell Biol., 116, 585–596.
19 Hudson, D.F., Fowler, K.J., Earle, E., Saffery, R., Kalitsis, P., Trowell, H., Hill, J., Wreford, N.G., de Kretser, D.M., Cancilla, M.R. et al. (1998) Centromere protein B null mice are mitotically and meiotically normal but have lower body and testis weights. J. Cell Biol., 141, 309–319.
20 Kapoor, M., Montes de Oca Luna, R., Liu, G., Lozano, G., Cummings, C., Mancini, M., Ouspenski, I., Brinkley, B.R. and May, G.S. (1998) The cenpB gene is not essential in mice. Chromosoma, 107, 570–576.[Web of Science][Medline]
21 Perez-Castro, A.V., Shamanski, F.L., Meneses, J.J., Lovato, T.L., Vogel, K.G., Moyzis, R.K. and Pedersen, R. (1998) Centromeric protein B null mice are viable with no apparent abnormalities. Dev. Biol., 201, 135–143.[Web of Science][Medline]
22 Fukagawa, T. and Brown, W.R.A. (1997) Efficient conditional mutation of the vertebrate CENP-C gene. Hum. Mol. Genet., 6, 2301–2308.
23 Kalitsis, P., Fowler, K.J., Earle, E., Hill, J. and Choo, K.H.A. (1998) Targeted disruption of mouse centromere protein C gene leads to mitotic disarray and early embryo death. Proc. Natl Acad. Sci. USA, 95, 1136–1141.
24 Tomkiel, J., Cooke, C.A., Saitoh, H., Bernat, R.L. and Earnshaw, W.C. (1994) CENP-C is required for maintaining proper kinetochore size and for a timely transition to anaphase. J. Cell Biol., 125, 531–545.
25 Meluh, P.B. and Koshland, D. (1997) Budding yeast centromere composition and assembly as revealed by in vivo cross-linking. Genes Dev., 11, 3401–3412.
26 He, D., Zeng, C., Woods, K., Zhong, L., Turner, D., Busch, R.K., Brinkley, B.R. and Busch, H. (1998) CENP-G: a new centromeric protein that is associated with the -1 satellite DNA subfamily. Chromosoma, 107, 189–197.[Web of Science][Medline]
27 Rattner, J., Hendzel, M., Furbee, C., Muller, M. and Bazett-Jones, D. (1996) Topoisomerase II is associated with the mammalian centromere in a cell cycle- and species-specific manner and is required for proper centromere/kinetochore structure. J. Cell Biol., 134, 1097–1107.
28 Disney, J.E., Johnson, K.R., Magnuson, N.S., Sylvester, S.R. and Reeves, R. (1989) High-mobility group protein HMG-I localizes to G/Q- and C-bands of human and mouse chromosomes. J. Cell Biol., 109, 1975–1982.
29 Oei, S.L., Griesenbeck, J. and Schweiger, M. (1997) The role of poly(ADP-ribosyl)ation. Rev. Physiol. Biochem. Pharmacol., 131, 127–173.
30 Oliver, F.J., Menissier-de Murcia, J. and de Murcia, G. (1999) Poly(ADP-ribose) polymerase in the cellular response to DNA damage, apoptosis, and disease. Am. J. Hum. Genet., 64, 1282–1288.[Web of Science][Medline]
31 Gaff, C., du Sart, D., Kalitsis, P., Iannello, R., Nagy, A. and Choo, K.H.A. (1994) A novel nuclear protein binds centromeric satellite DNA. Hum. Mol. Genet., 3, 711–716.
32 Barry, A.E., Howman, E.V., Cancilla, M.R., Saffery, R. and Choo, K.H.A. (1999) Sequence analysis of an 80 kb human neocentromere. Hum. Mol. Genet., 8, 217–227.
33 Cleaver, J.E. and Morgan, W.F. (1991) Poly(ADP-ribose) polymerase: a perplexing participant in cellular responses to DNA breakage. Mutat. Res., 257, 1–18.[Web of Science][Medline]
34 Page, S.L., Earnshaw, W.C., Choo, K.H.A. and Shaffer, L.G. (1995) Further evidence that CENP-C is a necessary component of active centromeres: studies of a dic(X;15) with simultaneous immuno- fluorescence and FISH. Hum. Mol. Genet., 4, 289–294.
35 Cutts, S.M., Fowler, K.J., Kile, B.T., Hii, L., O’Dowd, R.A., Hudson, D.F., Saffery, R., Kalitsis, P., Earle, E. and Choo, K.H.A. (1999) Defective chromosome segregation, microtubule bundling, and nuclear bridging in Inner centromere protein (Incenp) gene-disrupted mice. Hum. Mol. Genet., 8, 1145–1155.
36 Earnshaw, W.C., Ratrie, H. and Stetten, G. (1989) Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma (Berl.), 98, 1–12.[Web of Science][Medline]
37 Sullivan, B. and Schwartz, S. (1995) Identification of centromeric antigens in dicentric Robertsonian translocations: CENP-C and CENP-E are necessary components of functional centromeres. Hum. Mol. Genet., 4, 2189–2197.
38 Voullaire, L.E., Slater, H.R., Petrovic, V. and Choo, K.H.A. (1993) A functional marker centromere with no detectable -satellite, satellite III, or CENP-B protein: activation of a latent centromere? Am. J. Hum. Genet., 52, 1153–1163.[Web of Science][Medline]
39 Voullaire, L.E., Saffery, R., Davies, J., Earle, E., Kalitsis, P., Slater, H., Irvine, D.V. and Choo, K.H.A. (1999) Trisomy 20p resulting from inverted duplication and neocentromere formation. Am. J. Med. Genet., 85, 403–408.[Web of Science][Medline]
40 Menissier-de Murcia, J., Molinete, M., Gradwohl, G., Simonin, F. and de Murcia, G. (1989) Zinc-binding domain of poly(ADP-ribose) polymerase participates in the recognition of single strand breaks on DNA. J. Mol. Biol., 210, 229–233.[Web of Science][Medline]
41 Gradwohl, G., Menissier-de Murcia, J., Molinete, M., Simonin, F., Koken, M., Hoeijmakers, J.H. and de Murcia, G. (1990) The second zinc-finger domain of poly(ADP-ribose) polymerase determines specificity for single-stranded breaks in DNA. Proc. Natl Acad. Sci. USA, 87, 2990–2994.
42 Uchida, K. and Miwa, M. (1994) Poly(ADP-ribose) polymerase: structural conservation among different classes of animals and its implications. Mol. Cell. Biochem., 138, 25–32.[Web of Science][Medline]
43 Chen, Y.M., Shall, S. and O’Farrell, M. (1994) Poly(ADP-ribose) polymerase in plant nuclei. Eur. J. Biochem., 224, 135–142.[Web of Science][Medline]
44 O’Farrell, M. (1995) ADP-ribosylation reactions in plants. Biochimie, 77, 486–491.[Medline]
45 Wiens, G.R. and Sorger, P.K. (1998) Centromeric chromatin and epigenetic effects in kinetochore assembly. Cell, 93, 313–316.[Web of Science][Medline]
46 Smith, S., Giriat, I., Schmitt, A. and de Lange, T. (1999) Tankyrase, a poly(ADP-ribose) polymerase at human telomeres. Science, 282, 1484–1487.
47 d’Adda di Fagagna, F., Hande, M.P., Tong, W.-M., Lansdorp, P.M., Wand, Z.-Q. and Jackson, S.P. (1999) Function of poly(ADP-ribose) polymerase in controlling telomere length and chromosomal stability. Nature Genet., 23, 76–80.[Web of Science][Medline]
48 Wang, Z., Auer, B., Stingl, L., Berghammer, H., Haidacher, D., Schweiger, M. and Wagner, E.F. (1995) Mice lacking ADPRT and poly(ADP-ribosyl)ation develop normally but are susceptible to skin disease. Genes Dev., 9, 509–520.
49 Menissier-de Murcia, J., Niedergang, C., Trucco, C., Ricoul, M., Dutrillaux, B., Mark, M., Oliver, F.J., Masson, M., Dierich, A., LeMeur, M. et al. (1997) Requirement of poly(ADP-ribose) polymerase in recovery from damage in mice and in cells. Proc. Natl Acad. Sci. USA, 94, 7303–7307.
50 Burkart, V., Wang, Z.-Q., Radons, J., Heller, B., Herceg, Z., Stingl, L., Wagner, E.F. and Kolb, H. (1999) Mice lacking the poly(ADP-ribose) polymerase gene are resistant to pancreatic ß-cell destruction and diabetes development induced by streptozocin. Nature Med., 5, 314–319.[Web of Science][Medline]
51 Johansson, M. (1999) A human poly(ADP-ribose) polymerase gene family (ADPRTL): cDNA cloning of two novel poly(ADP-ribose) polymerase homologues. Genomics, 57, 442–445.[Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Okada, T. Inoue, T. Kikuta, N. Kato, Y. Kanno, N. Hirosawa, Y. Sakamoto, T. Sugaya, and H. Suzuki Poly(ADP-Ribose) Polymerase-1 Enhances Transcription of the Profibrotic CCN2 Gene J. Am. Soc. Nephrol., May 1, 2008; 19(5): 933 - 942. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Beneke and A. Burkle Poly(ADP-ribosyl)ation in mammalian ageing Nucleic Acids Res., December 3, 2007; 35(22): 7456 - 7465. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. H. Wong, K. H. Brettingham-Moore, L. Chan, J. M. Quach, M. A. Anderson, E. L. Northrop, R. Hannan, R. Saffery, M. L. Shaw, E. Williams, et al. Centromere RNA is a key component for the assembly of nucleoproteins at the nucleolus and centromere Genome Res., August 1, 2007; 17(8): 1146 - 1160. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Y. Kim, T. Zhang, and W. L. Kraus Poly(ADP-ribosyl)ation by PARP-1: `PAR-laying' NAD+ into a nuclear signal Genes & Dev., September 1, 2005; 19(17): 1951 - 1967. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. C. Yung, S. Sato, and M. S. Satoh Poly(ADP-ribosyl)ation as a DNA Damage-induced Post-translational Modification Regulating Poly(ADP-ribose) Polymerase-1-Topoisomerase I Interaction J. Biol. Chem., September 17, 2004; 279(38): 39686 - 39696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Ohsaki, K. Ueda, S. Sakakibara, E. Do, K. Yada, and K. Yamanishi Poly(ADP-Ribose) Polymerase 1 Binds to Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Terminal Repeat Sequence and Modulates KSHV Replication in Latency J. Virol., September 15, 2004; 78(18): 9936 - 9946. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Sumer, J. M. Craig, M. Sibson, and K.H. A. Choo A Rapid Method of Genomic Array Analysis of Scaffold/Matrix Attachment Regions (S/MARs) Identifies a 2.5-Mb Region of Enhanced Scaffold/Matrix Attachment at a Human Neocentromere Genome Res., July 1, 2003; 13(7): 1737 - 1743. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Trofimova, A. Dimtchev, M. Jung, D. Rosenthal, M. Smulson, A. Dritschilo, and V. Soldatenkov Gene Therapy for Prostate Cancer by Targeting Poly(ADP-Ribose) Polymerase Cancer Res., December 1, 2002; 62(23): 6879 - 6883. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Saxena, L. H. Wong, P. Kalitsis, E. Earle, L. G. Shaffer, and K.H. A. Choo Poly(ADP-ribose) polymerase 2 localizes to mammalian active centromeres and interacts with PARP-1, Cenpa, Cenpb and Bub3, but not Cenpc Hum. Mol. Genet., September 15, 2002; 11(19): 2319 - 2329. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Saxena, R. Saffery, L. H. Wong, P. Kalitsis, and K. H. A. Choo Centromere Proteins Cenpa, Cenpb, and Bub3 Interact with Poly(ADP-ribose) Polymerase-1 Protein and Are Poly(ADP-ribosyl)ated J. Biol. Chem., July 19, 2002; 277(30): 26921 - 26926. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Liu, G. Wang, and A. G. Yakovlev Identification and Functional Analysis of the Rat Caspase-3 Gene Promoter J. Biol. Chem., March 1, 2002; 277(10): 8273 - 8278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Politi, G. Perini, S. Trazzi, A. Pliss, I. Raska, W. C. Earnshaw, and G. D. Valle CENP-C binds the alpha-satellite DNA in vivo at specific centromere domains J. Cell Sci., January 6, 2002; 115(11): 2317 - 2327. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Barry, M. Bateman, E. V. Howman, M. R. Cancilla, K. M. Tainton, D. V. Irvine, R. Saffery, and K.H. A. Choo The 10q25 Neocentromere and its Inactive Progenitor Have Identical Primary Nucleotide Sequence: Further Evidence for Epigenetic Modification Genome Res., June 1, 2000; 10(6): 832 - 838. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||