Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (33)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lahn, B. T.
Right arrow Articles by Page, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lahn, B. T.
Right arrow Articles by Page, D. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2000, Vol. 9, No. 2 311-319
© 2000 Oxford University Press

A human sex-chromosomal gene family expressed in male germ cells and encoding variably charged proteins

Bruce T. Lahn+ and David C. Page

Howard Hughes Medical Institute, Whitehead Institute and Department of Biology, Massachusetts Institute of Technology, 9 Cambridge Center, Cambridge, MA 02142, USA

Received 1 October 1999; Revised and Accepted 5 November 1999.

DDBJ/EMBL/GenBank accession nos AF159127AF159129 and AF000979.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Approximately 12 X-Y homologous gene pairs have been identified in the non-recombining portions of human sex chromosomes. These X-Y gene pairs fall into two categories. In the first category, both X and Y homologs are ubiquitously expressed. In the second category, the X homolog is ubiquitously expressed, whereas the Y homolog is expressed exclusively in the testis. Here we describe a family of human X-Y genes that cannot be assigned to either category. Designa

ted VCX/Y (Variable Charge X/Y; VCY previously known as BPY1), this gene family has multiple members on both X and Y, and all appear to be expressed exclusively in male germ cells. Members of the VCX/Y family share a high degree of sequence identity, with the exception that a 30 nucleotide unit is tandemly repeated in X-linked members but is present only once in Y-linked members. These atypical features suggest that the VCX/Y family has evolved in a manner previously unrecognized for mammalian X-Y genes. We also found that a copy of VCX is present in CRI-S232, a previously described genomic fragment derived from the X chromosome. Studies have shown that aberrant recombination between arrays of CRI-S232-homologous repeats flanking the steroid sulfatase (STS) gene results in STS deletion, which is manifested clinically as X-linked ichthyosis. The revelation that CRI-S232 contains VCX offers a more precise description of the genetic etiology of X-linked ichthyosis: it results from aberrant recombination between VCX gene arrays that flank the STS locus.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mammalian sex chromosomes evolved from a pair of autosomes (14). An irreversible process during sex chromosome evolution is the suppression of X-Y recombination over progressively larger regions (5). This process affected the two sex chromosomes in radically different ways. Within the non-recombining portion of the X (NRX; the portion that does not recombine with the Y), genes remain well preserved. In contrast, within the non-recombining portion of the Y (NRY), most genes have degenerated (5,6). There are, however, exceptions to the general trend of Y chromosome degeneration: a handful of ancestral genes were found to have persisted in the NRY as well as the NRX of extant mammals, where they exist as differentiated homologs (7). Prior studies of these X-Y homologous genes have shown that two adaptive processes may have been responsible for the persistence of their Y-linked members. The first is the conservation of certain essential housekeeping genes on both X and Y chromosomes to ensure double dosage of these genes in males and females (7). Y-linked genes preserved by this process resemble their X homologs in that they encode widely distributed housekeeping proteins. In addition, their X homologs escape X-inactivation to fulfill the double dosage requirement (7,8). The second process is the selection for, and subsequent preservation of, genes on the Y that have acquired male-beneficial functions (9,10). Y-linked genes preserved by this process are distinct from their widely expressed X homologs in that they are expressed only in the testis (911).

We had previously identified a single cDNA sequence corresponding to the BPY1 (Basic Protein Y 1) gene(s) on the human Y chromosome (7). For reasons that will become obvious in later text, this gene is now renamed VCY for Variable Charge Y. VCY is expressed only in the testis, and encodes a small, positively charged protein of unknown function. We initially thought that, like most other testis-specific genes on the human Y chromosome, VCY lacked X homologs (7). This conclusion was overturned when we isolated additional cDNA clones using VCY cDNA as a probe, and showed that many of these clones derive from close homologs of VCY on the human X chromosome (named VCX for Variable Charge X). Expression analysis showed, to our surprise, that all copies of VCX and VCY are transcribed exclusively in the testis, most likely in male germ cells. This feature distinguishes this X-Y gene family from the two previously recognized categories of X-Y genes. Models are proposed for the evolution of this gene family on human sex chromosomes.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
When the previously isolated VCY cDNA clone was used to probe human genomic Southern blots, complex banding patterns were observed in both males and females, suggesting the existence of VCY-homologous sequences outside the Y chromosome. When the same probe was used to screen a human testis cDNA library, 14 clones were isolated. These 14 clones make up four distinct cDNA species (Fig. 1). One cDNA species (represented by five clones) is identical in sequence to VCY as previously reported. The remaining three cDNA species are distinguishable by the fact that a 30 nucleo­tide unit is tandemly repeated twice (six clones), eight times (one clone) or 10 times (three clones) within each cDNA sequence. This repeat unit is present only once in VCY. Outside the repeat regions, the four cDNA species share 96% or greater pairwise nucleotide identity within their open reading frames. PCR amplifications of genomic DNAs using cDNA-based primers revealed that there is a single intron, 192 nucleotides in length, in VCY and its homologs (indicated in Fig. 1A).




View larger version (78K):
[in this window]
[in a new window]
 
Figure 1. Alignment of nucleotide and deduced protein sequences of the four cDNA species. Dot, identity to consensus; dash, absence of base or amino acid. (A) Nucleotide alignment of Y-linked VCY (previously known as BPY1) and its X-linked homologs that contain 2 (VCX-2r), 8 (VCX-8r) or 10 (VCX-10r) of the 30 nucleotide repeat units. Repeats are numbered. Start and stop codons are shaded. The single intron, the polyadenylation signal, and several restriction sites (TaqI, BglI and BglII) are indicated. Locations of primers used for radiation hybrid mapping of VCX, and for RT–PCR expression analysis of VCX and VCY, are indicated by arrows (see Fig. 5 for details of the RT–PCR analysis). (B) Protein alignment of VCY, VCX-2r, VCX-8r and VCX-10r. Repeats are numbered. The putative bipartite nuclear localization signal is indicated. (C) Nucleotide alignment of the 10 repeats of VCX-10r. Repeats 1 and 10 are the most divergent; repeats 2–9 alternate imperfectly between two sequence types. (D) Protein alignment of the 10 repeats of VCX-10r. Like nucleotide sequence, repeats 2–9 alternate between two sequence types. (E) Charge diagrams of the four protein species. Open bar, the 10 a.a. repeat motif; solid bar, non-repeat region. The amount of calculated charge (at pH 7) carried by each segment of the proteins is indicated. The calculated isoelectric point (pI) of each protein is indicated.

 
Additional studies (detailed below) showed that the cDNA species with one internal repeat unit corresponds to two identical copies of VCY on the Y chromosome, and that the cDNA species with two or more internal repeats correspond to multiple homologs of VCY on the X chromosome (named VCX). To distinguish between VCX genes with different numbers of repeats, an appendix will be used to indicate repeat number. The VCX gene(s) with two repeats, for example, will be referred to as VCX-2r.

We speculated that additional VCX or VCY genes might exist, carrying repeat arrays different in length from those represented by the cDNA clones that we had isolated. To address this possibility, Southern blots were generated from BglI–BglII double-digested genomic DNAs of unrelated individuals, and probed with a fragment from the previously isolated VCY cDNA. BglI and BglII were chosen because their restriction sites (indicated in Fig. 1A) flank the repeat regions in all four cDNA species. Numerous bands were detected in each individual (Fig. 2). One band is apparently Y-linked, present only in males. This band corresponds in length to VCY, which contains only one internal repeat unit. The other bands correspond in length to genes that contain two or more repeats. The two- and eight-repeat-containing bands are present in all males and females tested. The remaining bands, which contain >8 and up to 30 internal repeats, are highly polymorphic, and do not appear to be male-specific.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 2. Southern blot detection of VCY homologous sequences. Genomic DNA samples from unrelated males and females were double digested with BglI and BglII, and probed with a VCY cDNA fragment that lies between BglI and BglII sites (Fig. 1A). The estimated number of repeats (based on 30 bp/repeat) within each VCY homologous fragment is indicated.

 
To obtain meiotic segregation patterns of the VCX and VCY genes, Southern blots were generated from TaqI-digested genomic DNA samples of two unrelated three-generation kindreds, and probed with the same VCY cDNA fragment. Again, numerous bands were detected in each individual (Fig. 3). Two monomorphic bands show Y linkage, as they are present only in males, and are passed consistently from father to son. The remaining bands are polymorphic and are apparently X linked, passed consistently from father to daughter, but never from father to son. These X-specific bands are tightly linked to each other, segregating as a single locus in all cases except one, where a recombination event occurred between the two maternal haplotypes (indicated in Fig. 3).



View larger version (67K):
[in this window]
[in a new window]
 
Figure 3. Southern blot analysis of segregation patterns of VCY homologous fragments in two kindreds. Genomic DNAs were digested with TaqI, and probed with the same VCY cDNA fragment as used in Figure 2. Y-specific bands (present only in males) are indicated. In most cases, the parental haplotype is transmitted without recombination. In one female (R), recombination between the two maternal haplotypes has occurred. One individual carries a fragment that is not present in either of his parents (indicated by a question mark). This fragment may be the result of a new mutation.

 
One apparent contradiction between the BglI–BglII and the TaqI Southern analyses is the presence of a single male-specific band corresponding to VCY in the former, but two male-specific bands in the latter. We speculated that two copies of VCY might exist on the Y chromosome (distinguishable by TaqI digest), each of which contains one repeat unit (therefore not distinguishable by BglI–BglII double digest). To investigate this possibility, six Y chromosomal BAC clones were isolated by probing a genomic BAC library with the VCY cDNA fragment. Southern blots of the six clones prepared either by BglI–BglII double digest, or by TaqI single digest were probed with the same VCY cDNA fragment (Fig. 4). In the case of the BglI–BglII double digest, a single band was observed for all six clones. This band is identical in size to the male-specific VCY band in the BglI–BglII genomic Southern analysis (compare Fig. 4 with Fig. 2), indicating that all six clones contain VCY. In the case of the TaqI digest, two bands of different sizes were observed, corresponding in size to the two male-specific bands in the TaqI genomic Southern analysis (compare Fig. 4 with Fig. 3). Five BAC clones contain either of the two bands; one clone contains both bands. These results confirm the presence of two copies of VCY on the Y chromosome, which are separated by <140 kb—the length of the BAC clone that contains both copies of VCY (the size of this BAC clone was estimated by restriction fingerprinting). Partial sequencing of the BAC clones revealed complete nucleo­tide identity between open reading frames of the two VCY copies. The fact that a single VCY band in the BglI–BglII Southern blot corresponds to two copies of the gene raises the possibility that other bands in the Southern blot may also represent multiple gene copies that each have the same number of internal repeats. By counting the number of X-specific bands in the BglI–BglII genomic Southern analysis, and taking into consideration that more intense bands may represent multiple copies (Fig. 2), we estimated that ~12 VCX genes may be present on a typical X chromosome.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 4. Southern blot analysis of six VCY-containing genomic BAC clones. The clones were either double digested with BglI and BglII, or digested with TaqI, and probed with the same VCY cDNA fragment as in Figures 2 and 3.

 
We had previously mapped VCY to Y chromosome deletion interval 5G (7). By designing primers specific to VCX sequences (locations of primers indicated in Fig. 1A) and typing them on a radiation hybrid (RH) panel (12), we localized VCX to the same RH map position as the steroid sulfatase (STS) locus on distal Xp, corresponding to cytogenetic band Xp22.3 (see ref. 5 for a map of the X chromosome that depicts the STS locus).

We conclude that the VCX and VCY genes constitute a large family. Two copies are located no more than 140 kb from each other on the Y. The remaining dozen or so copies are located in close proximity on the X. A 30 nucleotide unit is present once in the two Y-linked copies, but is tandemly repeated two or more times in all the X-linked copies. Amplification of the X-linked copies has occurred at both the level of entire genes and the level of the 30 nucleotide repeat unit within each gene.

The gene family encodes proteins with variable charge
The 30 nucleotide repeat unit in the VCX/Y gene family encodes a 10 amino acid motif that is rich in the acidic residue Glu, and is predicted to be highly negatively charged. Outside the repeat regions, the VCX/Y proteins are predicted to be highly positively charged, owing to an abundance of the basic residues Arg and Lys (Fig. 1B). Therefore, the number of repeats in a given protein should, in theory, exert a strong influence on its overall charge. The Y-encoded VCY proteins contain only one repeat motif. Their overall charge is predicted to be highly positive, with a calculated isoelectric point (pI) of 9.4. In contrast, the X-encoded VCX proteins contain two or more repeats. Their overall calculated charge ranges from moderately negative (pI 5.5 in the case of two repeats), to highly negative (pI 4.3 in the case of 10 repeats) (Fig. 1E). Sequence variations at 3' ends of VCX/Y coding regions (where there is a high concentration of nucleotide substitutions amongst the various VCX/Y cDNA sequences) also contribute to the charge differential between X-encoded and Y-encoded proteins (Fig. 1A and E). This charge variability is the rationale for referring to these genes as Variable Charge X and Variable Charge Y.

Two features of the deduced VCX/Y proteins—their small size and high charge—resemble those of chromatin-associated proteins such as histones and HMG proteins. Based on this resemblance, we had previously speculated that VCY might interact with nucleic acids (7). Motif searches against the PROSITE and SWISS-PROT databases for protein families and domains identified a putative bipartite nuclear localization signal near the N-terminus of VCX/Y (Fig. 1B), suggesting that they are nuclear proteins. (A description of bipartite nuclear localization signals is available at http://www.expasy.ch/cgi-bin/get-prodoc-entry?PDOC00015 .) Searches for structural patterns failed to identify any folded motifs (i.e. {alpha}-helices or ß-sheets) in these proteins, suggesting that they are unlikely to fold into stable structures on their own without interacting with other cellular components such as nucleic acids or protein factors (13). These features are consistent with, but provide no direct evidence for, the VCX/Y proteins being components of chromatin.

Expression of the VCX/Y family is likely restricted to male germ cells
We had previously probed a multiple-tissue northern blot with a VCY cDNA fragment, and observed signal only in the testis (7). Since the probe did not distinguish among the various members of the VCX/Y family, the northern data suggested that expression of the entire family is restricted to the testis. We confirmed the testis-specific expression of VCX/Y by performing multiple-tissue RT–PCR using primers specific for VCX, VCY or both (Fig. 5A).




View larger version (85K):
[in this window]
[in a new window]
 
Figure 5. RT–PCR analysis of VCX/Y expression. Four separate PCR assays were performed on the cDNA of each tissue. Locations of primers in the VCX and VCY genes are indicated in Figure 1A. VCX/Y, primers that amplify both VCX and VCY; VCX, primers that amplify VCX only; VCY, primers that amplify VCY only; CDYL, positive control primers that amplify the ubiquitously transcribed CDYL (21). (A) Expression in multiple tissues of normal males. (B) Expression in normal versus germ cell-deficient testis. The apparent banding pattern difference between (A) and (B) in the normal testis lane is due to polymorphism of the internal repeat array sizes in the VCX genes between the two cDNA samples (which are derived from two individuals).

 
To examine whether the family is expressed in germ cells or in the somatic portion of the testis, we performed RT–PCR on a biopsy sample of a testis that lacked germ cells (Sertoli cells only). In this case, VCX/Y transcripts were not detected, suggesting that expression of the family is restricted to male germ cells (Fig. 5B). However, our data cannot rule out the possibility that the VCX/Y family is in fact expressed in the somatic portion of the testis, and that the failure to detect VCX/Y transcript in the germ cell-deficient testis is due to the somatic expression being dependent on the presence of germ cells.

For most X-chromosomal genes that have Y-linked homologs, it is of interest to address their X-inactivation status in female cells. But in the case of the VCX genes, we were unable to address this issue since the only place where these genes are detectably expressed is the testis, a tissue present only in males.

A copy of VCX is present in the genomic clone CRI-S232
The repetitive nature of the VCX/Y family on sex chromosomes and the close proximity of the VCX genes to the X-linked STS locus are reminiscent of the CRI-S232 homologous sequences on human sex chromosomes (14). CRI-S232 is a previously isolated anonymous human genomic clone. When CRI-S232 was used to probe genomic Southern blots, it detected multiple polymorphic fragments that mapped to distal Xp, adjacent to the STS locus, as well as a set of monomorphic fragments that mapped to proximal Yq (14). The CRI-S232 clone has been restriction mapped and partially sequenced (15). Comparison of the CRI-S232 partial sequence with VCX/Y cDNA sequences revealed that CRI-S232 contains a copy of VCX (Fig. 6).



View larger version (9K):
[in this window]
[in a new window]
 
Figure 6. Organization of CRI-S232 and its resident copy of VCX. The portion of the diagram that depicts CRI-S232 genomic structure is adapted from a figure by Knowlton et al. (14). Two sequence elements, RU1 and RU2 as referred to by Knowlton et al. (14), are shaded. RU1 corresponds to the tandem array found in the VCX transcripts. It contains 11 copies of the 30 nucleotide repeat unit. RU2 is a low-complexity sequence element (14). A putative VCX transcript is drawn above its corresponding genomic region.

 
It has been shown that CRI-S232-homologous sequences on the X chromosome reside on both sides of STS, and that recombination between these flanking sequences accounts for the majority of STS deletions (16). The clinical manifestation of STS deletion is ichthyosis, or scaly skin syndrome (17). The common occurrence of this aberrant recombination has resulted in a high allele frequency of STS deletion (~0.01%) in the population (16). Our finding that CRI-S232 contains a copy of VCX offers a more precise description of the molecular etiology of STS deletions, namely that this frequent genetic defect is the result of aberrant recombination between VCX gene arrays flanking the STS locus.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The process of Y degeneration is so effective during sex chromosome evolution that only those genes with particular functional characteristics could persist. Previous studies of X-Y homologous genes within human NRX and NRY have shown that the persistence of their Y-linked members is the result of two adaptive processes: (i) conservation of certain ubiquitously expressed housekeeping genes (7); or (ii) evolution of male-specific function and testis-specific expression (9,10). Most X-homologous genes on the human Y chromosome have apparently been maintained through the former process, as both X and Y homologs of these genes encode ubiquitously expressed housekeeping proteins (7). Only two X-homologous genes on the human Y are known to have been preserved through the process of male specialization: SRY, the male-determining gene (18), and RBMY, a putative spermatogenic factor (19). Both SRY and RBMY have evolved male-specific functions, whereas their homologs on the X, SOX3 and RBMX, respectively, retain broad patterns of expression that presumably resemble the ancestral expression status (911). RBMY has undergone amplification (19), which is a hallmark of Y genes expressed exclusively in the testis. Some of these testis-specific genes arrived on the Y by transposition or retroposition of autosomal genes, rather than by persistence (20,21). In the mouse, there are three additional examples—Zfx/y, Ube1x/y and Dffrx/y—of X-Y genes that have become testis-specific on the Y, while maintaining ubiquitous expression on the X (2226). Like RBMY in humans, Zfy and Ube1y in the mouse have undergone amplification on the Y chromosome (22,24,27).

Certain features of VCY resemble those of RBMY: both VCY and RBMY are expressed exclusively in the testis and have undergone amplification on the Y chromosome. But the resemblance does not extend to their X homologs. VCX, like VCY, is expressed only in the testis, and has undergone amplification. RBMX on the other hand, is widely expressed in somatic tissues and is present in a single copy (28).

What then is the adaptive process that contributed to the preservation of VCY on the human Y chromosome? In the absence of additional data on the function of the VCX/Y gene family, we will offer two speculative models: (i) the teamwork model; and (ii) the selfish-gene model.

According to the teamwork model, various members of the VCX/Y protein family complement each other in function to collectively mediate a certain process in spermatogenesis. By this model, the VCY genes have been preserved during evolution because their spermatogenic functions are somewhat distinct from those of the VCX genes.

The selfish-gene model is inspired by previous studies of sex chromosome meiotic drive in certain insect species. In these species, ‘selfish’ genes are believed to have evolved first on the X chromosome, causing the X to be transmitted more often than the Y. The Y chromosome counters by evolving suppressors of the X-linked selfish genes (2933). In Drosophila melanogaster, two sex chromosome loci—Stellate on the X and crystal on the Y—have been implicated in sex chromosome meiotic drive, and are thought to be selfish genetic elements (31,32). The VCX/Y gene family resembles Stellate/crystal in that it is amplified on both sex chromosomes, with X- and Y-linked members active only in male germ cells. Such resemblance, together with the extreme charge differential between X- and Y-encoded proteins, raises the tantalizing possibility that VCX and VCY are selfish genes, wherein X-encoded proteins (which are highly negatively charged) and Y-encoded proteins (which are highly positively charged) antagonize each other in a race to distort the transmission ratio of the sex chromosomes to their advantage. In humans, slightly more males are conceived than females (34). If the VCX/Y gene family members are indeed selfish genetic elements as we speculated, they may play a role in such sex ratio distortion.

The VCX/Y gene family has been evolving rapidly on human sex chromosomes, as shown by its poor conservation in mammals. Low-stringency hybridization to zoo-blots with the CRI-S232 clone (which contains a copy of VCX) has previously shown that CRI-S232 homologous sequences are detectable only in simian primates, but not in prosimians or non-primate mammals (16). This result is consistent with our inability to isolate mouse homologs of VCX/Y despite repeated attempts. The lack of conservation of the VCX/Y family reflects either rapid sequence change of ancient genes, or recent de novo emergence of this gene family in the simian lineage.

Members of the VCX/Y family share a high degree of sequence similarity. Of the four VCX/Y cDNA species that we identified, the three VCX species share 99% pairwise nucleo­tide identity within their open reading frames (not considering the internal repeats) (Fig. 1A). Partial sequencing of VCY BAC clones showed that the two copies of VCY share complete identity in their open reading frames. Between VCX and VCY, sequence similarity is slightly lower, ~96%. These observations indicate that the multiple members of the VCX/Y family derived from a single sequence very recently during evolution through gene amplification, and possibly, subsequent gene conversion amongst amplified copies. They also suggest that the amplification of VCX on the X and VCY on the Y occurred after the divergence of X- and Y-linked sequences.

Close examination of nucleotide substitutions between VCX and VCY suggest that sequences of this gene family have undergone positive selection. All 13 substitutions between the VCX and VCY coding regions (>348 bases; not considering the internal repeats) are non-synonymous (they alter amino acids). Given that ~25% of random nucleotide substitutions should be silent (35), the probability that all 13 substitutions would be non-silent is only 2.4%. More likely, these substitutions are the result of positive selection for novel protein sequences with altered cellular functions.

X-linked members of the VCX/Y family exhibit an extremely high degree of polymorphism in the lengths of the internal tandem arrays present in each gene (Fig. 2). This high degree of polymorphism is most likely the result of rapid and continual expansions and contractions of individual arrays within each gene, which may be due to uneven crossovers between homologous chromosomes or sister chromatids. Such uneven crossovers may also produce polymorphism in the copy number of VCX, a prediction that we did not test since the precise copy number of VCX was difficult to ascertain.

It is rare that a gene family possesses so many atypical properties as does VCX/Y. The stage is now set for further investigation of this gene family, especially at the level of protein function, to better understand its precise role in spermatogenesis, and its evolution on human sex chromosomes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Identification of cDNA clones
The BglI and BglII flanked region (Fig. 1A) of the previously isolated VCY (previously known as BPY1) cDNA clone (7) was labeled with [32P]dCTP by random priming, and used to screen a human adult testis cDNA {lambda} phage library (Clontech, Palo Alto, CA). Library blots were incubated with probe overnight at 65°C in 0.5 M NaiPO4 (pH 7), 7% sodium dodecyl sulfate (SDS), followed by three washes of 15 min each at 65°C in 0.1x standard saline citrate, 0.1% SDS.

Identification of BAC clones
RPCI-11 human BAC library filters (36) (Roswell Park Cancer Institute, Buffalo, NY) were screened with the same probe and conditions as that used for identifying VCY-homologous cDNA clones. Positive clones were further screened by a previously described VCY-specific PCR assay (7) to identify VCY clones. Clone numbers for the six BACs are listed in Figure 4.

Southern blot analyses
For genomic Southern blots, each lane contained 7 µg of genomic DNA. For Southern blotting of the BAC clones, each lane contained 5 ng of BAC DNA. Hybridization probe and conditions were the same as those used for identifying VCY homologous cDNA clones.

Radiation hybrid mapping of VCX
Using PCR, 93 RH cell lines of the GeneBridge 4 panel (12) (Research Genetics, Huntsville, AL) were assayed for the presence of VCX. Locations of PCR primers in VCX are indicated in Figure 1A; their sequences are GGCCAAGGCCA­CGGAGG and TGGTGAGATCTCTGAGGTCT. Thermo­cycling conditions: 30 cycles of 1 min at 94°C, 45 s at 60°C, and 45 s at 72°C. Analysis of the PCR results positioned VCX with respect to the RH map constructed at the Whitehead/MIT Center for Genome Research (37) (http://www-genome.wi.mit.edu/cgi-bin/contig/phys_map ). VCX had exactly the same RH map location as the STS gene.

Protein pattern and profile searches
Searches for protein motifs were performed against the PROSITE and SWISS-PROT databases using web-based search engines ScanProsite and ProfileScan. Both search engines can be found at http://www.expasy.ch/prosite/ .

RT–PCR analysis of VCX/Y expression
Testis, brain, prostate, liver and heart cDNA samples from normal males were purchased from Clontech. To make cDNA from the testis biopsy sample, total RNA was first extracted using Trizol reagent (Gibco BRL, Gaithersburg, MD), followed by cDNA synthesis using the Advantage kit (Clontech). Locations of PCR primers used to generate the data shown in Figure 5 are indicated in Figure 1A; their sequences are as follows:

VCX/Y, CAGGAAAGAGGAAGTCCTCC

and TGGTGAGATCTCTGAGGTCT;

VCX, GGCCAAGGCCACGGAGG

and TGGTGAGATCTCTGAGGTCT;

VCY, GGCCAAGGCCAAGGAGA

and ATGGGCGCCCCTTACTCA;

CDYL, GTACATCTCCGTTCATGGATG

and CTGATAGCTTCTGCCATTTTAG.

All primer pairs spanned introns. PCR conditions were the same as that used for radiation hybrid mapping of VCX.

GenBank accession numbers
GenBank accession numbers for VCX and VCY cDNA sequences are as follows: VCX-2r, AF159127; VCX-8r, AF159128; VCX-10r, AF159129; VCY, AF000979. The VCY cDNA sequence was previously published (7).


    ACKNOWLEDGEMENTS
 
We thank R. Oates for patient samples; H. Skaletsky for database searches and sequence analysis; L. Brown, T. Kawaguchi and R. Saxena for technical advice; and J. Berger, P. Carr and S. Rozen for discussions and comments on the manuscript. This work was supported by the National Institutes of Health.


    FOOTNOTES
 
+ To whom correspondence should be addressed at present address: Department of Human Genetics, University of Chicago, 924 East 57th Street, Chicago, IL 60637, USA. Tel: +1 773 834 4393; Fax: +1 773 834 0505: Email: blahn@genetics-uchicago.edu Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Bull, J.J. (1983) Evolution of Sex Determining Mechanisms. Benjamin Cummings, Menlo Park, CA.

2 Graves, J.A. (1996) Mammals that break the rules: genetics of marsupials and monotremes. Annu. Rev. Genet., 30, 233–260.[Web of Science][Medline]

3 Charlesworth, B. (1996) The evolution of chromosomal sex determination and dosage compensation. Curr. Biol., 6, 149–162.[Web of Science][Medline]

4 Rice, W.R. (1996) Evolution of the Y sex chromosome in animals. BioScience, 46, 331–343.

5 Lahn, B.T. and Page, D.C. (1999) Four evolutionary strata on the human X chromosome. Science, 286, 964–967.[Abstract/Free Full Text]

6 Jegalian, K. and Page, D.C. (1998) A proposed path by which genes common to mammalian X and Y chromosomes evolve to become X inactivated. Nature, 394, 776–780.[Medline]

7 Lahn, B.T. and Page, D.C. (1997) Functional coherence of the human Y chromosome. Science, 278, 675–680.[Abstract/Free Full Text]

8 Brown, C.J., Carrel, L. and Willard, H.F. (1997) Expression of genes from the human active and inactive X chromosomes. Am. J. Hum. Genet., 60, 1333–1343.[Web of Science][Medline]

9 Delbridge, M.L., Lingenfelter, P.A., Disteche, C.M. and Graves, J.A. (1999) The candidate spermatogenesis gene RBMY has a homologue on the human X chromosome. Nature Genet., 22, 223–224.[Web of Science][Medline]

10 Mazeyrat, S., Saut, N., Mattei, M.-G. and Mitchell, M.J. (1999) RBMY evolved on the Y chromosome from a ubiquitously transcribed X-Y identical gene. Nature Genet., 22, 224–226.[Web of Science][Medline]

11 Foster, J.W. and Graves, J.A. (1994) An SRY-related sequence on the marsupial X chromosome: implications for the evolution of the mammalian testis-determining gene. Proc. Natl Acad. Sci. USA, 91, 1927–1931.[Abstract/Free Full Text]

12 Gyapay, G., Schmitt, K., Fizames, C., Jones, H., Vega-Czarny, N., Spillett, D., Muselet, D., Prud’Homme, J.F., Dib, C., Auffray, C. et al. (1996) A radiation hybrid map of the human genome. Hum. Mol. Genet., 5, 339–346.[Abstract/Free Full Text]

13 Creighton, T.E. (1993) Proteins: Structures and Molecular Properties. W.H. Freeman and Co., New York, NY.

14 Knowlton, R.G., Nelson, C.A., Brown, V.A., Page, D.C. and Donis-Keller, H. (1989) An extremely polymorphic locus on the short arm of the human X chromosome with homology to the long arm of the Y chromosome. Nucleic Acids Res., 17, 423–437.[Abstract/Free Full Text]

15 Li, X.M., Yen, P.H. and Shapiro, L.J. (1992) Characterization of a low copy repetitive element S232 involved in the generation of frequent deletions of the distal short arm of the human X chromosome. Nucleic Acids Res., 20, 1117–1122.[Abstract/Free Full Text]

16 Yen, P.H., Li, X.M., Tsai, S.P., Johnson, C., Mohandas, T. and Shapiro, L.J. (1990) Frequent deletions of the human X chromosome distal short arm result from recombination between low copy repetitive elements. Cell, 61, 603–610.[Web of Science][Medline]

17 Yen, P.H., Allen, E., Marsh, B., Mohandas, T., Wang, N., Taggart, R.T. and Shapiro, L.J. (1987) Cloning and expression of steroid sulfatase cDNA and the frequent occurrence of deletions in STS deficiency: implications for X-Y interchange. Cell, 49, 443–454.[Web of Science][Medline]

18 Sinclair, A.H., Berta, P., Palmer, M.S., Hawkins, J.R., Griffiths, B.L., Smith, M.J., Foster, J.W., Frischauf, A.M., Lovell-Badge, R. and Goodfellow, P.N. (1990) A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature, 346, 240–244.[Medline]

19 Ma, K., Inglis, J.D., Sharkey, A., Bickmore, W.A., Hill, R.E., Prosser, E.J., Speed, R.M., Thomson, E.J., Jobling, M., Taylor, K. et al. (1993) A Y chromosome gene family with RNA-binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell, 75, 1287–1295.[Web of Science][Medline]

20 Saxena, R., Brown, L.G., Hawkins, T., Alagappan, R.K., Skaletsky, H., Reeve, M.P., Reijo, R., Rozen, S., Dinulos, M.B., Disteche, C.M. and Page, D.C. (1996) The DAZ gene cluster on the human Y chromosome arose from an autosomal gene that was transposed, repeatedly amplified and pruned. Nature Genet., 14, 292–299.[Web of Science][Medline]

21 Lahn, B.T. and Page, D.C. (1999) Retroposition of autosomal mRNA yielded testis-specific gene family on human Y chromosome. Nature Genet., 21, 429–433.[Web of Science][Medline]

22 Mardon, G. and Page, D.C. (1989) The sex-determining region of the mouse Y chromosome encodes a protein with a highly acidic domain and 13 zinc fingers. Cell, 56, 765–770.[Web of Science][Medline]

23 Mardon, G., Luoh, S.W., Simpson, E.M., Gill, G., Brown, L.G. and Page, D.C. (1990) Mouse Zfx protein is similar to Zfy-2: each contains an acidic activating domain and 13 zinc fingers. Mol. Cell. Biol., 10, 681–688.[Abstract/Free Full Text]

24 Kay, G.F., Ashworth, A., Penny, G.D., Dunlop, M., Swift, S., Brockdorff, N. and Rastan, S. (1991) A candidate spermatogenesis gene on the mouse Y chromosome is homologous to ubiquitin-activating enzyme E1. Nature, 354, 486–489.[Medline]

25 Handley, P.M., Mueckler, M., Siegel, N.R., Ciechanover, A. and Schwartz, A.L. (1991) Molecular cloning, sequence, and tissue distribution of the human ubiquitin-activating enzyme E1. Proc. Natl Acad. Sci. USA, 88, 258–262.[Abstract/Free Full Text]

26 Brown, G.M., Furlong, R.A., Sargent, C.A., Erickson, R.P., Longepied, G., Mitchell, M., Jones, M.H., Hargreave, T.B., Cooke, H.J. and Affara, N.A. (1998) Characterisation of the coding sequence and fine mapping of the human DFFRY gene and comparative expression analysis and mapping to the Sxrb interval of the mouse Y chromosome of the Dffry gene. Hum. Mol. Genet., 7, 97–107.[Abstract/Free Full Text]

27 Mitchell, M.J., Woods, D.R., Tucker, P.K., Opp, J.S. and Bishop, C.E. (1991) Homology of a candidate spermatogenic gene from the mouse Y chromosome to the ubiquitin-activating enzyme E1. Nature, 354, 483–486.[Medline]

28 Soulard, M., Della Valle, V., Siomi, M.C., Pinol-Roma, S., Codogno, P., Bauvy, C., Bellini, M., Lacroix, J.C., Monod, G., Dreyfuss, G. et al. (1993) hnRNP G: sequence and characterization of a glycosylated RNA-binding protein. Nucleic Acids Res., 21, 4210–4217.[Abstract/Free Full Text]

29 Wilkinson, G.S., Presgraves, D.C. and Crymes, L. (1998) Male eye span in stalk-eyed flies indicates genetic quality by meiotic drive suppression. Nature, 391, 276–279.

30 Atlan, A., Mercot, H., Landre, C., Montchamp-Moreau, C. (1997) The Sex-ratio in Drosophila simulans: geographical distribution of distortion and resistance. Evolution, 51, 1886–1895.

31 Hurst, L.D. (1996) Further evidence consistent with Stellate’s involvement in meiotic drive. Genetics, 142, 641–643.[Web of Science][Medline]

32 Palumbo, G., Bonaccorsi, S., Robbins, L.G. and Pimpinelli, S. (1994) Genetic analysis of Stellate elements of Drosophila melanogaster. Genetics, 138, 1181–1197.[Abstract]

33 Hurst, L.D. (1992) Is Stellate a relict meiotic driver? Genetics, 130, 229–230.[Web of Science][Medline]

34 James, W.H. (1987) The human sex ratio. Part 1: A review of the literature. Hum. Biol., 59, 721–752.[Web of Science][Medline]

35 Li, W.H. (1997) Molecular Evolution. Sinauer Associates, Sunderland, MA.

36 Osoegawa, K., Woon, P.Y., Zhao, B., Frengen, E., Tateno, M., Catanese, J.J. and de Jong, P.J. (1998) An improved approach for construction of bacterial artificial chromosome libraries. Genomics, 52, 1–8.[Web of Science][Medline]

37 Hudson, T.J., Stein, L.D., Gerety, S.S., Ma, J., Castle, A.B., Silva, J., Slonim, D.K., Baptista, R., Kruglyak, L., Xu, S.H. et al. (1995) An STS-based map of the human genome. Science, 270, 1945–1954.[Abstract]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
K. Stouffs, H. Tournaye, I. Liebaers, and W. Lissens
Male infertility and the involvement of the X chromosome
Hum. Reprod. Update, June 10, 2009; (2009) dmp023v1.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
M. V. Han, J. P. Demuth, C. L. McGrath, C. Casola, and M. W. Hahn
Adaptive evolution of young gene duplicates in mammals
Genome Res., May 1, 2009; 19(5): 859 - 867.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
L Kent, J Emerton, V Bhadravathi, E Weisblatt, G Pasco, L R Willatt, R McMahon, and J R W Yates
X-linked ichthyosis (steroid sulfatase deficiency) is associated with increased risk of attention deficit hyperactivity disorder, autism and social communication deficits
J. Med. Genet., August 1, 2008; 45(8): 519 - 524.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
B. K. Bhowmick, Y. Satta, and N. Takahata
The origin and evolution of human ampliconic gene families and ampliconic structure
Genome Res., April 1, 2007; 17(4): 441 - 450.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
K. Vandepoele, N. Van Roy, K. Staes, F. Speleman, and F. van Roy
A Novel Gene Family NBPF: Intricate Structure Generated by Gene Duplications During Primate Evolution
Mol. Biol. Evol., November 1, 2005; 22(11): 2265 - 2274.
[Abstract] [Full Text] [PDF]


Home page
JBJSHome page
L. L. Tosi, B. D. Boyan, and A. L. Boskey
Does Sex Matter in Musculoskeletal Health? The Influence of Sex and Gender on Musculoskeletal Health
J. Bone Joint Surg. Am., July 1, 2005; 87(7): 1631 - 1647.
[Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Van Esch, K. Hollanders, L. Badisco, C. Melotte, P. Van Hummelen, J. R. Vermeesch, K. Devriendt, J.-P. Fryns, P. Marynen, and G. Froyen
Deletion of VCX-A due to NAHR plays a major role in the occurrence of mental retardation in patients with X-linked ichthyosis
Hum. Mol. Genet., July 1, 2005; 14(13): 1795 - 1803.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Y. Ma, S. Zhang, Q. Xia, G. Zhang, X. Huang, M. Huang, C. Xiao, A. Pan, Y. Sun, R. Lebo, et al.
Molecular characterization of the TCP11 gene which is the human homologue of the mouse gene encoding the receptor of fertilization promoting peptide
Mol. Hum. Reprod., January 1, 2002; 8(1): 24 - 31.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
K. Stouffs, W. Lissens, L. Van Landuyt, H. Tournaye, A. Van Steirteghem, and I. Liebaers
Characterization of the genomic organization, localization and expression of four PRY genes (PRY1, PRY2, PRY3 and PRY4)
Mol. Hum. Reprod., July 1, 2001; 7(7): 603 - 610.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
Y. Ji, E. E. Eichler, S. Schwartz, and R. D. Nicholls
Structure of Chromosomal Duplicons and their Role in Mediating Human Genomic Disorders
Genome Res., May 1, 2000; 10(5): 597 - 610.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (33)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lahn, B. T.
Right arrow Articles by Page, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lahn, B. T.
Right arrow Articles by Page, D. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?