Human Molecular Genetics, 2000, Vol. 9, No. 3 353-361
© 2000 Oxford University Press
Altered cholesterol metabolism in human apolipoprotein E4 knock-in mice
Project 8 and 1Reproductive Engineering Section, Mitsubishi Kasei Institute of Life Sciences, 11 Minamiooya, Machida, Tokyo 194-8511, Japan, 2Pharmaceuticals Research Laboratory 1, Mitsubishi-Tokyo Pharmaceuticals Inc., Yokohama Research Center, 1000 Kamoshida-cho, Aoba-ku, Yokohama 227-8502, Japan
Received 15 September 1999; Revised and Accepted 1 December 1999.
| ABSTRACT |
|---|
|
|
|---|
The
4 allele of apolipoprotein E (apoE) is associated with an increased risk of developing Alzheimers disease (AD). To accurately determine the isoform-specific effects of human apoE on brain functions under physiological and pathological situations, we created mice expressing human apoE4 isoform in place of mouse apoE by utilizing the gene-targeting technique on the embryonic stem cells (knock-in). The homozygous
4 (4/4) mice correctly expressed human apoE4 in the serum and the brain. The human apoE in the brain was found primarily in the astrocytes as was the mouse apoE in the wild-type (+/+) mice. In the 4/4 mice, the serum cholesterol level was 2.5-fold that of the +/+ littermate controls on a regular diet. This marked elevation was accounted for by an accumulation of very low and low density lipoproteins. In the brains of the 4/4 mice, however, the amounts of total cholesterol and phospholipids were significantly decreased compared with the +/+ littermates. These findings indicate that cholesterol and lipid metabolism is markedly altered in the 4/4 mice. Our human apoE4 knock-in mice will be useful in clarifying the role of apoE in the etiologies of AD and cardiovascular diseases in relation to cholesterol and lipid metabolism. | INTRODUCTION |
|---|
|
|
|---|
Apolipoprotein E (apoE) is a constituent of several classes of plasma lipoproteins and plays an important role in the transport of cholesterol and phospholipids among various cells of the body (1). It serves as the ligand that mediates the uptake of lipoprotein particles into cells via the low density lipoprotein receptor (LDLR) and the LDLR-related protein (LRP). The brain is second next to the liver in the content of apoE mRNA (2), which is predominantly synthesized by astrocytes (3,4). Although much remains to be clarified about the lipid and lipoprotein metabolism in the brain, recent studies have revealed that apoE is present in high density lipoprotein (HDL)-like lipoprotein particles in the cerebrospinal fluid (CSF) (57).
Human apoE is a 299 amino acid protein that occurs in three major isoforms (apoE2, apoE3 and apoE4) encoded by three APOE alleles (
2,
3 and
4) differing with respect to the presence of cysteine or arginine at two polymorphic sites. ApoE3, the most common isoform, has cysteine at amino acid position 112 and arginine at 158; apoE2 has cysteine at both 112 and 158, and apoE4 has arginine at both sites (1). Numerous epidemiologic studies have established that the
4 allele is associated with an increased risk of developing both familial late-onset and sporadic Alzheimers disease (AD) (810). ApoE immunoreactivity has been detected in senile plaques (11) and neurofibrillary tangles (NFTs) (12), the two hallmarks of AD. Increased plaques have been found in the brains of
4 homozygotes (13,14). Studies have reported binding of apoE to amyloid ß-peptide (Aß) (8,15,16) and to tau protein (17), the principal constituent of NFTs.
ApoE was originally identified as a 37 kDa protein associated with regenerating nerves (18), and better defined in later studies on crushed sciatic nerves (1921) and lesioned brain (22,23). Following brain injury, synthesis of apoE by astrocytes is upregulated, and it is considered to play important roles in the mobilization and redistribution of cholesterol and phospholipids during membrane remodeling (24). Under these conditions of increased cholesterol availability, cholesterol synthesis is repressed both in the peripheral nerve (25) and the brain (23).
The cholesterol content of the brain decreases with age (26), and even further in AD (27). Recent studies with cultured cells implicate cholesterol-rich membrane microdomains in processing of the amyloid precursor protein (APP) (see below). Interestingly, a recent work showed that apoE4 induces neuronal cell death under conditions of suppressed cholesterol synthesis (28), suggesting that apoE4 may possibly be less efficient than apoE3 in reparative function in the brain under compromised cholesterol supply. Thus, cholesterol is an intriguing possible link between apoE and AD etiology.
When allele-specific differences in apoE function need to be identified in vivo, it is desirable to have mouse lines in which the murine apoE is replaced by human apoE isoforms expressed under the natural regulation of this protein. Thus, Sullivan et al. (29,30) produced human apoE3 and apoE2 knock-in mouse lines, and most recently succeeded in apoE4 mice (31). The E4 homozygotes were found to have plasma cholesterol levels similar to the E3 mice, whereas E2 mice exhibited hypercholesterolemia. We independently undertook generation of human apoE knock-in mice, using a different construct design of targeting vector. Our E4 homozygous mice exhibit an elevated serum cholesterol level compared with the wild-type mice, whereas brain cholesterol content was significantly decreased. This suggests that our human apoE4 knock-in mice will provide useful animal models for AD research in relation to cholesterol and lipid metabolism.
| RESULTS |
|---|
|
|
|---|
Generation of human apoE4 knock-in mice
The knock-in gene-targeting vector was designed to replace all of the mouse Apoe coding sequences including part of exon 2, entire exon 3 and most of exon 4, with the human apoE4 cDNA (Fig. 1A). To retain normal mouse Apoe regulatory sequences as much as possible, the translation initiation codon of the human apoE4 cDNA in the knock-in allele was placed at the same position as that of the mouse Apoe in the wild-type locus. Thus, non-coding mouse sequences including exon 1, intron 1 and the first 18 bp of exon 2 were retained in the knock-in allele (see Materials and Methods).
|
The knock-in construct was introduced into E14TG2aIV embryonic stem (ES) cells (32) by electroporation, and cell clones were selected by growth in media containing G418/gancyclovir. Drug-resistant ES clones were screened for homologous recombination by Southern blot hybridization using 3' flanking sequences outside the gene-targeting vector, exon 4 or neo probes (data not shown). We identified 7 of 125 G418/gancyclovir-resistant ES clones as having the correct insertion, and two clones (#129 and #145) were used for further studies. In these knock-in ES cells, human apoE immunoreactivity could be demonstrated by western blotting the cell lysates with monoclonal antibody (mAb) 868E5 (see below), whereas mouse apoE was detected both in wild-type and knock-in ES cells with mAb 874B7 (data not shown).
The two independently targeted ES cell clones were injected into C57BL/6N blastocysts, and chimeric mice were generated. Male chimeric mice were mated with C57BL/6N females to produce heterozygous (4/+) mice. The knock-in allele was transmitted to four of seven agouti coat color offspring derived from the #129 ES cell clone (data not shown). The heterozygous (4/+) mice in the F2 generation were crossed, and produced litters of normal size with a normal Mendelian segregation pattern of the knock-in allele. Genotypes of F3 generation mice were determined using Southern blot analysis of tail-tip DNA digested with HindIII (Fig. 1B). The results reported here were obtained with F3 generation animals of mouse line TgH(HAPE4)129. The amino acid sequence of the entire transgene product was confirmed to be that of the correct human apoE4 (33,34) by cDNA cloning and sequencing of human apoE mRNA from the liver of a transgenic mouse of this line.
Expression of human apoE4 from the knock-in allele
To examine the expression of human apoE4 from the knock-in allele, sera from the 4/4, 4/+ and +/+ mice were analyzed by western blot analysis (Fig. 2A). Human apoE4 protein was detected with human apoE-specific rat mAb 868E5 (35) in sera of the 4/4 and 4/+ mice at the same 37 kDa position as in a control human serum (Fig. 2A, upper panel). Western blot analysis with mouse apoE-specific hamster mAb 874B7 (35) showed that mouse apoE was present only in the 4/+ and +/+ and not in the 4/4 mice (Fig. 2A, lower panel), indicating that the mouse Apoe coding sequence was completely replaced in the 4/4 mice. Although we cannot precisely compare the amount of human and mouse apoE proteins on western blots due to the likely difference in the affinity of antibodies, it seemed that the level of human apoE4 in the serum of the 4/4 mice was comparable to that of mouse apoE in the wild-type mice. We further showed that apoE in the knock-in mice was recognized by anti-apoE4 specific antibody Ab 412-1-12-2 which binds an apoE4-specific epitope (36) (Fig. 2B).
|
In these experiments the extent of sialylation of apoE, as estimated from the characteristic upper bands (5), seems to be less in the mouse than in the human (Fig. 2A). The possibility that the sialylation of apoE is differently regulated in the two species remains to be studied.
We next examined the expression of human apoE4 in the brains of the knock-in mouse. Western blotting experiments showed that the human apoE of 37 kDa was expressed in the 4/4 and 4/+ mouse brains (Fig. 2C). Histological pattern of apoE expression was then studied by immunohistochemistry on frozen sections of paraformaldehyde-fixed brains of the three genotypes (Fig. 3). Human apoE was detected in the astrocytes and neuropil in the hippocampus (Fig. 3A) and neocortex of the 4/4 mice, where no immunoreactivity for mouse apoE was detectable (Fig. 3B). No clear apoE immunoreactivity was seen over neuronal somata, although the fluorescence microscopy could not rule out a weak staining of neuronal processes in addition to astrocytic processes in the neuropil. This pattern of apoE staining was similar to the distribution of mouse apoE in the +/+ mouse brain (Fig. 3F). Heterozygous brains showed staining of both human and mouse apoEs with intermediate intensity (Fig. 3C and D). Thus the expression of the human apoE protein in our knock-in mice is apparently under the endogenous regulatory control.
|
Lipid and lipoprotein phenotypes
As an initial step in studying the functional impact of expression of human apoE protein, the levels of total cholesterol (TC) and triglycerides (TG) in the 4/4, 4/+, +/+ and apoE-deficient (/) (37) mice were analyzed in the sera obtained after a 6 h fast (Table 1). Serum TC level in the 4/4 mice (251 ± 23 mg/dl) was 2.5-fold greater than that in the +/+ mice (101 ± 8 mg/dl), but still much lower than in the / mice (697 ± 60 mg/dl). Males showed higher TC levels than females: 289 mg/dl versus 212 for 4/4 mice, and 115 versus 87 for +/+ mice (n = 3 each). In the 4/+ mice, serum TC levels were slightly lower than in the +/+ mice. There was no significant difference in TG levels among the 4/4, 4/+ and +/+ mice. Similar results have been obtained for another independent knock-in line TgH(HAPE4)145. For this line TC was 234 mg/dl for 4/4 compared with 131 for +/+ (n = 5 each). The nature of elevated serum TC levels was further studied by analyzing lipoprotein profiles by fast protein liquid chromatography (FPLC) fractionation. As shown in Figure 4A and B, the main cholesterol carrier in serum was HDL (fractions 1725) in the +/+ and 4/+ mice. In the 4/4 mice, however, 60% of TC was found in regions corresponding to the VLDL and LDL (fractions 116) (Fig. 4C).
|
|
The distribution of apoE was analyzed by western blot analysis of the FPLC fractions (Fig. 4, lower panels). In the +/+ and 4/+ mice, the mouse apoE was mostly found in the HDL (fractions 1725) and also LDL (fractions 1016) regions with only a minor portion showing up in the VLDL region (fractions 6 and 7). The distribution pattern of human apoE4 in the 4/+ mice was very similar to that of mouse apoE in the +/+ and 4/+ mice. In contrast, the majority of apoE was present in the VLDL and LDL regions with two peaks at fractions 67 and 1213 in the 4/4 mice, in addition to the presence in the HDL region. On western blot analysis with anti-mouse apoE, three discrete bands of 34, 36 and 39 kDa were detected. The relative abundance of the three molecular species appeared to vary with fractions: the 39 kDa species was relatively more abundant in the VLDL, the 36 kDa species in the LDL and the 34 kDa species in the HDL regions. With the anti-human apoE antibody, all fractions displayed the 37 kDa band accompanied by a weak low molecular weight band, a likely partial degradation fragment (38) (Fig. 4B and C).
As the serum cholesterol level was markedly elevated in the 4/4 knock-in mice, it was of particular interest to examine the brain lipids. The brain size was not significantly different among mice of 4/4, 4/+ and +/+ genotypes. Total cholesterol level of the whole brain, however, was reduced by >30% in the 4/4 brain compared with the +/+ brain (Table 2). A less pronounced reduction in TC was also observed in the brains of the heterozygotes. A significant reduction in the brain phospholipid content was also found in the 4/4 mice, but not in the heterozygotes.
|
No difference in gross morphology of the brain was apparent among the 4/4, 4/+ and +/+ mice. No significant difference was noted among the three genotypes in a preliminary histological survey, in which brain sections from 3-month-old mice were stained by thionin or by antibodies specific to GFAP (astrocyte marker), VAMP-2 (synapse marker) or mouse apoJ. A more thorough study is needed to establish absence of altered anatomical phenotype in the knock-in brains.
| DISCUSSION |
|---|
|
|
|---|
We have produced a line of human apoE4 knock-in mice in which the expression of human apoE4 is under the control of the enhancer/promoter of endogenous mouse Apoe gene, and mouse apoE expression was completely eliminated. In these mice, serum cholesterol level was 2.5 times that of the +/+ littermate controls. This marked elevation of serum cholesterol was shown to be primarily due to an accumulation of very low and low density lipoproteins. The brains of 4/4 mice had significantly reduced total cholesterol and phospholipids compared with the littermate controls.
Transgenic mouse models
A number of research groups have in the past produced mice expressing human apoE isoforms instead of the mouse protein through pronuclear injection of human apoE cDNAs placed under various heterologous promoters, and breeding with the apoE-deficient (knock-out) lines generated earlier to eliminate the mouse protein (3941). In this type of transgenic mouse generally, the levels and patterns of transgene expression vary from line to line due to differences in the chromosomal integration sites with unavoidable position effects as well as uncontrollable copy numbers of inserted transgenes. Thus, no two lines can be precisely matched for studying subtle isoform differences. Moreover, expression of apoE in cell types other than the natural expressers through use of heterologous promoters may not provide a valid model animal for AD research. GFAP promoter has been used by some to direct expression of human apoE to astrocytes (39,40). However, the expression pattern of apoE in the normal mouse brain does not exactly coincide with that of GFAP (35). Expected absence of apoE in the periphery in such mice should cause disturbances in the systemic lipid metabolism (42,43) that may have indirect consequences in the central nervous system (CNS).
A most desirable approach, therefore, is to place the transgene expression under the control of endogenous regulatory elements. Xu et al. (44) introduced large segments of human genomic DNA encompassing the APOE locus with attendant human regulatory regions, but the fact that the transgene constructs did not match precisely among the three apoE alleles, combined with uncontrolled integration loci and copy numbers, renders interpretation of results subject to ambiguity.
Sullivan et al. (29,30) pioneered the generation of human apoE3 and apoE2 mice, and Knouff et al. (31) recently reported their apoE4 mice. They took advantage of homologous recombination to replace a segment of DNA at the Apoe locus with homologous segments of human genomic DNA. The plasma TC level of their E4 homozygotes was not significantly different from that of E3 homozygotes. We used a targeting vector of different design employing human apoE cDNA coding region flanked by appropriate murine genomic DNAs (Fig. 1A).
Hypercholesterolemia in the apoE4 knock-in mice
Our homozygous apoE4 mice displayed marked hypercholesterolemia (249%) compared with the wild-type littermates (Table 1). Preliminary results with our E3 homozygotes of F3 generation indicated that their average TC value is 125 mg/dl (n = 6) compared with 93 mg/dl (n = 5) for their wild-type littermates, indicating that the hypercholesterolemia of E4 mice is an allele-specific phenotype.
The apparent discrepancy in the cholesterol phenotype between Knouff et al.s E4 mice and ours is not likely due to a difference in the fat or cholesterol content of the mouse diet, because a high fat chow did not differentiate cholesterol phenotypes of Knouff et al.s E4 and E3 mice (31). Nevertheless, a possibility cannot be excluded that some other component of the diet may have contributed to the discrepancy. This can be tested by exchanging mice or diets. The difference in the construction of transgenes may also be responsible. The Apoe/APOE gene of our knock-in mice lacks introns 2 and 3, whereas Knouff et al.s mice (31) carry a chimeric intron 1 and human introns 2 and 3, possibly leading to a subtle difference in the regulation of apoE expression. This could be tested by careful comparative analyses of apoE protein expression.
Our analysis of lipoprotein profile (Fig. 4) showed a large increase in VLDL- and LDL-cholesterol without significant changes in the HDL-cholesterol. Interestingly in the humans also,
4 carriers have increased plasma cholesterol and LDL (45,46). ApoE4 has been shown to distribute relatively preferentially to VLDL rather than HDL when compared with apoE3 (47,48). A higher catabolic rate of apoE4-bearing VLDL (49) has been offered as an explanation of higher plasma cholesterol levels observed among human
4 carriers (45). In this explanation apoE4-bearing VLDL delivers cholesterol more efficiently to the liver, and also accelerates the conversion of VLDL remnants to LDL driving its accumulation. Both will lead to a down-regulation of LDL receptor and further accumulation of LDL. It is tempting to speculate that a similar mechanism may operate in our 4/4 mice.
Brain cholesterol
As a first step toward understanding the physiological and pathological roles of apoE, brain lipids were measured in our apoE4 mice. In contrast to the serum, the homozygote brain showed 32% reduction in total cholesterol, and 17% reduction in phospholipids, when compared with the wild-type littermates. These measurements mostly reflect cell-associated lipids rather than lipoproteins in the interstitial fluid, and thus do not necessarily contradict the elevated cholesterol level found in the serum. Nonetheless, it raises a possibility that the mechanisms of brain parenchymal cholesterol metabolism and traffic may be substantially different from those on the other side of the bloodbrain barrier. In fact, apoE and apoAI are the major apolipoproteins, but apoB is not found, in the CNS (5), and LRP is considered to be an important apoE receptor in the brain in addition to the LDL receptor (13). The decreased brain cholesterol content of the E4 knock-in mice is not likely to be the consequence of interspecies inconsistency between the human apoE and the murine apoE receptors in the brain, since our preliminary results indicate that the brain cholesterol content of our apoE3 knock-in mice is not significantly different from that of wild-type littermates. An interesting possibility would be some property peculiar to the apoE4 protein, such as a hypothetical ability to extract cholesterol from myelin more efficiently, that manifests itself primarily in the CNS tissues. Published studies of human apoE knock-in mice by Sullivan et al. and Knouff et al. (2931) were devoted to hematologic and vascular studies, and to our knowledge no data are available for comparison regarding their brain cholesterol levels.
The reduced cholesterol content in the brains of apoE4 knock-in mice is particularly intriguing because of recent recognition that Aß can be detected in association with cholesterol-rich membrane microdomains (50,51), and that cholesterol availability affects APP processing in cultured cells (5257) and in the brain (58). Contents of cholesterol and other lipids have been found to be decreased in AD brains (27). Whether this is the result of degenerative loss of synapses and cells, or it has etiological significance remains to be studied. Much more needs to be learned about cholesterol metabolism in aging and AD brains. A more detailed analysis of cholesterol and other lipids in the brains of our apoE4 mice is also urgent, as well as analyses of APP metabolism there. Equally awaited is the study of doubly transgenic mice to be produced by breeding the apoE humanized lines of mice with the APP-overexpressing transgenic lines that develop pathological changes (59,60) and to determine how human apoE isoforms differentially affect Aß production and deposition in the brain.
Dynamic up-regulation of apoE expression after physical injury has long been known in the peripheral nervous system and CNS (19,21,22). More recent studies on experimental ischemia (61), head injury in humans (62) and brain lesions in apoE-deficient mice (63) further support the idea that apoE plays a part in neural repair processes. Perhaps this is a reflection of increased importance of cholesterol recycling in the brain parenchyma, which does not have ready access to the cholesterol in general circulation (64). Since AD entails sporadic neuronal deaths during characteristically protracted course of the disease, small differences among apoE isoforms in the efficiency of cholesterol transport could have substantial cumulative effects on the timing of clinical onset of AD. Such a possibility could be tested by comparing apoE3 and apoE4 mice with respect to their reactions to one-time and synchronous neuronal insults such as caused by neurotoxin administration (65) or appropriate surgical lesion experiments (66). Our mice may be useful also in testing the involvement of apoE in neuronal plasticity (24,67).
It is hoped that the apoE4 mice reported here will be useful in producing relevant animal models not only for atherosclerosis research but also for clarifying the precise role of apoE in the etiology of AD, and developing effective measures to halt the progression of the disease.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mice
Mice of C57BL/6N strain were obtained from Japan Clea (Tokyo, Japan). ApoE-deficient mice of C57BL/6J-Apoe tm1Unc (37) were obtained from the Jackson Laboratory (Bar Harbor, ME). All mice were reared on a normal diet of MF (Oriental Yeast, Chiba, Japan) containing 4.9% fat, 0.075% cholesterol, 23.8% protein, 6.2% ash and 2.7% fiber.
Construction of targeting vector
The targeting construct was made by two-step ligations of DNA fragments. First, a 6.0 kb fragment including mouse Apoe gene 5' flanking region, exon 1, intron 1 and the first 18 bp of exon 2 (strain 129/SvJ), a human apoE4 cDNA fragment corresponding to nucleotides 59 to +1027 (68), and a loxP-PGK-neo-loxP (69) fragment were ligated and subcloned into pBluescript II SK (pTG1). The human apoE4 cDNA originated from pKCRHAPE (Japan patent 60-126989, 1985), a vector for expression of human apoE3. A 280bp Eco47IIISacII fragment was excised from pKCRHAPE and subcloned into pBluescript. A point mutation resulting in Cys112
Arg substitution was introduced by a Pfu DNA polymerase-based mutagenesis using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) with a pair of mutagenic primers (E34F, 5'-ACATGGAGGACGTGCGCGGCCGCCTGGTG-3'; E34R, 5'-CACCAGGCGGCCGCGCACGTCCTCCATG-3'). The desired point mutation and the entire coding sequences were confirmed by DNA sequence analysis. Next, a 9.0 kb fragment excised from pTG1 and a 2.6 kb fragment of mouse Apoe gene 3' flanking region were inserted into an F3 vector, which includes a thymidine kinase gene driven by the promoter of pMC1neo (70), giving rise to the targeting vector, pTG2.
Generation of homozygous human apoE4 knock-in mice
The targeting vector, pTG2, was linearlized with SalI and electroporated into ES cells, E14TG2aIV (32), at 1000 V with a capacitance of 3 µF using a Bio-Rad (Hercules, CA) Gene Pulsar. After double selection with G418 (175 µg/ml) and gancyclovir (2 µM), 125 resistant clones were picked, among which seven targeted ES cell clones were identified by Southern blot analysis. The targeted ES cells were injected into C57BL/6N blastocysts, which were then implanted into the pseudopregnant recipients to produce chimeric mice. Chimeric male mice were mated to C57BL/6N females to examime germ-line transmission of the transgene. The agouti coat color male offspring, which were heterozygous for the human apoE4, were mated to C57BL/6N females to produce the F2 generation. Mice heterozygous for the human apoE4 in the F2 generation were intercrossed to generate homozygous human apoE4 knock-in mice. Wild-type littermates from these crosses were used as controls. The floxed neo in the transgene has not been eliminated from the knock-in mice described in this work.
Genomic Southern blot analysis
ES cell DNA was isolated by digesting cells in lysis buffer A (0.2% SDS, 100 µg/ml of proteinase K, 200 mM NaCl, 100 mM Tris pH7.5, 5 mM EDTA) at 55°C overnight and dissolved with TE buffer after ethanol precipitation. Tail-tip DNA was isolated by digesting tail-tip clippings in lysis buffer B (1% SDS, 2 mg/ml proteinase K, 100 mM NaCl, 50 mM Tris pH 8.0, 100 mM EDTA) at 55°C overnight, and dissolved with TE after phenol extraction, chloroform extraction and ethanol precipitation. Genomic DNAs were digested with HindIII, analyzed by electrophoresis, and transferred to the nylon membrane. Transferred DNA was hybridized in hybridization buffer (7% SDS, 50% formamide, 5x SSC, 2% blocking reagent, 50 mM sodium phosphate pH 7.0, 0.1% N-lauroylsarcosine) overnight at 42°C to a DIG-labelled 1.1 kb probe, corresponding to the XmnINcoI fragment in the 3' flanking region shown in Figure 1. The hybridized membrane was washed twice for 15 min at 68°C with 0.1x SSC, 0.1% SDS, and subsequently incubated with Fab fragments of anti-DIG antibody conjugated with alkaline phosphatase. The chemiluminescence signal was detected using CSPD (Roche Molecular Biochemicals, Mannheim, Germany).
To clone the human apoE4 cDNA from the knock-in mice, poly(A)+ RNA was isolated from the liver, and first-strand cDNA was synthesized using SuperScript Preamplification System (Gibco BRL, Rockville, MD). The human apoE4 cDNA was amplified by PCR using oligonucleotides MF (CAATTGGGAAGATGAAGGTTCTGTGGGCTG) and TR (CGGCGTTCAGTGATTGTCGCTGGGCACAGG). The PCR fragment of the expected size was cloned into pGEM-T-Easy Vector (Promega, Madison, WI), and sequenced to confirm the absence of inadvertent mutations in the expressed transgene.
Western blot analysis
Human serum (0.5 µl) or mouse fasted sera (1 µl) were combined with 10 µl of SDSPAGE sample buffer (2.3% SDS, 5% 2-mercaptoethanol, 10% glycerol, 62.5 mM TrisHCl buffer, pH 6.8) and boiled for 3 min. Whole brains were homogenized in 2 ml of homogenization buffer (5 mM EDTA, 1 mM PMSF, 10 µM leupeptin, 10 µM pepstatin A, 150 mM NaCl, 10 mM sodium phosphate pH 7.2) in a glassTeflon Potter homogenizer. Aliquots of the homogenate containing 50 µg protein were dissolved with 10 µl of SDSPAGE sample buffer and boiled for 3 min. The samples were separated by 10% acrylamide SDSPAGE, and transferred to PVDF membrane. The blots were blocked with 3% non-fat dried milk/phosphate-buffered saline, and incubated for 1 h at room temperature with the primary antibodies: rat monoclonal 868E5 (35), hamster monoclonal 874B7 (35) or mouse monoclonal Ab 412-1-7 (36) followed by washing and appropriate biotinylated secondary antibodies. The signal was detected by using Vectastain ABC kit (Vector, Burlingame, CA) combined with either chloronaphthol as chromogen or enhanced chemiluminescence (Pierce, Rockford, IL).
Lipid and lipoprotein analysis
Three or four mice of each sex of each genotype (10 weeks) were fasted for 6 h, and blood was collected from abdominal vena cava under Nembutal anesthesia. Brains were removed immediately after exsanguination, and frozen on dry ice. Chloroformmethanol (1:1) extracts of the brains were dried under nitrogen gas and re-extracted with choloformmethanol (2:1). The lower phase was evaporated and extracted with isopropanol for analyses. Levels of total serum cholesterol and triglyceride were determined using enzymatic assay kits, Determiner TC555 and Determiner TGS555 (Kyowa Medex, Tokyo, Japan), respectively. For FPLC size fractionation, 50 µl of mouse serum was injected onto Superose 6 column (FPLC system; Amersham Pharmacia Biotech, Uppsala, Sweden) and eluted at a constant flow rate of 0.5 ml/min with 1 mM EDTA and 50 mM phosphate buffer. Fractions of 0.5 ml were collected and cholesterol concentrations measured enzymatically, and apoE distribution was studied by western blotting.
Immunohistochemistry
Mice were fixed under deep Nembutal anesthesia by cardiac perfusion with chilled 4% paraformaldehyde in 0.1 M phosphate buffer pH 7.2. Brains were removed, post-fixed overnight in the same fixative at 4°C, and cryoprotected in 20% sucrose/phosphate-buffered saline. Cryostat sections of 13 µm were cut and picked up on glass. The sections were exposed overnight either to hamster mAb 884F11 (35) as hybridoma supernatant or rabbit anti-human ApoE(IBL#18171) at 1:200 dilution in Tris-buffered saline with 0.3% Triton X-100. The bound antibodies were visualized either by biotinylated anti-hamster Ig (#127-065-160, 1:200; Jackson ImmunoResearch, West Grove, PA) or biotinylated anti-rabbit Ig (RPN1004, 1:200; Amersham Pharmacia Biotech), followed by Oregon Green-labeled streptavidin (S-6369, 1:200; Molecular Probes, Eugene, OR). Fluorescence images were examined under Olympus BX50 fluorescence microscope, captured by Hamamatsu C5810 Color Chilled 3CCD Camera and MacSCOPE software, and printed by Fujix Pictrography 3000.
| ACKNOWLEDGEMENTS |
|---|
This work was possible through the use of the E14TG2aIV ES cells generously made available by Dr A.G. Smith. Dr T. Kitamoto kindly provided us with the neo cassette. We acknowledge a helpful gift of cDNA for human apoE3 from Dr M. Seki and his colleagues at the Mitsubishi Chemical Corporation Yokohama Research Center. Our thanks are due to Dr N. Nukina for his generous gift of Ab 412-1-12-2 specific to human apoE4, to Dr K. Ikeda for a gift of anti-apoE antiserum, and to Mr S. Kamijo for expert support concerning mouse stocks. We are grateful to Drs S. Yokoyama, H. Yamaguchi and K. Yanagisawa for helpful discussions, and to Dr K. Imahori for encouragement.
| FOOTNOTES |
|---|
+ Present address: Laboratory for Neurodegeneration and Signaling, Brain Science Institute, RIKEN (Institute of Physical and Chemical Research), 2-1 Hirosawa, Wako, Saitama 351-0198, Japan
§ To whom correspondence should be addressed. Tel: +81 42 724 6276; Fax: +81 42 724 6314; Email: fujita@ls.m-kagaku.co.jp ![]()
| REFERENCES |
|---|
|
|
|---|
1 Mahley, R.W. (1988) Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science 240, 622630.
2 Elshourbagy, N.A., Liao, W.S., Mahley, R.W. and Taylor, J.M. (1985) Apolipoprotein E mRNA is abundant in the brain and adrenals, as well as in the liver, and is present in other peripheral tissues of rats and marmosets. Proc. Natl Acad. Sci. USA, 82, 203207.
3 Boyles, J.K., Pitas, R.E., Wilson, E., Mahley, R.W. and Taylor, J.M. (1985) Apolipoprotein E associated with astrocytic glia of the central nervous system and with nonmyelinating glia of the peripheral nervous system. J. Clin. Invest., 76, 15011513.
4 Pitas, R.E., Boyles, J.K., Lee, S.H., Foss, D. and Mahley, R.W. (1987) Astrocytes synthesize apolipoprotein E and metabolize apolipoprotein E containing lipoproteins. Biochim. Biophys. Acta, 917, 148161.[Medline]
5 Pitas, R.E., Boyles, J.K., Lee, S.H., Hui, D. and Weisgraber, K.H. (1987) Lipoproteins and their receptors in the central nervous system. Characterization of the lipoproteins in cerebrospinal fluid and identification of apolipoprotein B, E (LDL) receptors in the brain. J. Biol. Chem., 262, 1435214360.
6 Chiba, H., Mitamura, T., Fujisawa, S., Ogata, A., Aimoto, Y., Tashiro, K. and Kobayashi, K. (1991) Apolipoproteins in rat cerebrospinal fluid: a comparison with plasma lipoprotein metabolism and effect of aging. Neurosci. Lett., 133, 207210.[Web of Science][Medline]
7 LaDu, M.J., Gilligan, S.M., Lukens, J.R., Cabana, V.G., Reardon, C.A., Van Eldik, L.J. and Holtzman, D.M. (1998) Nascent astrocyte particles differ from lipoproteins in CSF. J. Neurochem., 70, 20702081.[Web of Science][Medline]
8 Strittmatter, W.J., Saunders, A.M., Schmechel, D., Pericak-Vance, M., Enghild, J., Salvesen, G.S. and Roses, A.D. (1993) Apolipoprotein E: high-avidity binding to ß-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimers disease. Proc. Natl Acad. Sci. USA, 90, 19771981.
9 Poirier, J., Davignon, J., Bouthillier, D., Kogan, S., Bertrand, P. and Gauthier, S. (1993) Apolipoprotein E polymorphism and Alzheimers disease. Lancet, 342, 697699.[Web of Science][Medline]
10 Roses, A.D. (1996) Apolipoprotein E alleles as risk factors in Alzheimers disease. Annu. Rev. Med., 47, 387400.[Web of Science][Medline]
11 Namba, Y., Tomonaga, M., Kawasaki, H., Otomo, E. and Ikeda, K. (1991) Apolipoprotein E immunoreactivity in cerebral amyloid deposits and neurofibrillary tangles in Alzheimers disease and kuru plaque amyloid in Creutzfeldt-Jakob disease. Brain Res., 541, 163166.[Web of Science][Medline]
12 Yamaguchi, H., Ishiguro, K., Sugihara, S., Nakazato, Y., Kawarabayashi, T., Sun, X. and Hirai, S. (1994) Presence of apolipoprotein E on extracellular neurofibrillary tangles and on meningeal blood vessels precedes the Alzheimer ß-amyloid deposition. Acta Neuropathol. (Berl.), 88, 413419.[Medline]
13 Rebeck, G.W., Reiter, J.S., Strickland, D.K. and Hyman, B.T. (1993) Apolipoprotein E in sporadic Alzheimers disease: allelic variation and receptor interactions. Neuron, 11, 575580.[Web of Science][Medline]
14 Schmechel, D.E., Saunders, A.M., Strittmatter, W.J., Crain, B.J., Hulette, C.M., Joo, S.H., Pericak-Vance, M.A., Goldgaber, D. and Roses, A.D. (1993) Increased amyloid ß-peptide deposition in cerebral cortex as a consequence of apolipoprotein E genotype in late-onset Alzheimer disease. Proc. Natl Acad. Sci. USA, 90, 96499653.
15 Wisniewski, T., Golabek, A., Matsubara, E., Ghiso, J. and Frangione, B. (1993) Apolipoprotein E: binding to soluble Alzheimers ß-amyloid. Biochem. Biophys. Res. Commun., 192, 359365.[Web of Science][Medline]
16 LaDu, M.J., Falduto, M.T., Manelli, A.M., Reardon, C.A., Getz, G.S. and Frail, D.E. (1994) Isoform-specific binding of apolipoprotein E to ß-amyloid. J. Biol. Chem., 269, 2340323406.
17 Strittmatter, W.J., Saunders, A.M., Goedert, M., Weisgraber, K.H., Dong, L.-M., Jakes, R., Huang, D.Y., Pericak-Vance, M., Schmechel, D. and Roses, A.D. (1994) Isoform-specific interactions of apolipoprotein E with microtubule-associated protein tau: implications for Alzheimer disease. Proc. Natl Acad. Sci. USA, 91, 1118311186.
18 Müller, H.W., Gebicke-Härter, P.J., Hangen, D.H. and Shooter, E.M. (1985) A specific 37,000-dalton protein that accumulates in regenerating but not in nonregenerating mammalian nerves. Science, 228, 499501.
19 Ignatius, M.J., Gebicke-Härter, P.J., Skene, J.H.P., Schilling, J.W., Weisgraber, K.H., Mahley, R.W. and Shooter, E.M. (1986) Expression of apolipoprotein E during nerve degeneration and regeneration. Proc. Natl Acad. Sci. USA, 83, 11251129.
20 Snipes, G.J., McGuire, C.B., Norden, J.J. and Freeman, J.A. (1986) Nerve injury stimulates the secretion of apolipoprotein E by nonneuronal cells. Proc. Natl Acad. Sci. USA, 83, 11301134.
21 Boyles, J.K., Zoellner, C.D., Anderson, L.J., Kosik, L.M., Pitas, R.E., Weisgraber, K.H., Hui, D.Y., Mahley, R.W., Gebicke-Härter, P.J., Ignatius, M.J. and Shooter, E.M. (1989) A role for apolipoprotein E, apolipoprotein A-I, and low density lipoprotein receptors in cholesterol transport during regeneration and remyelination of the rat sciatic nerve. J. Clin. Invest., 83, 10151031.
22 Poirier, J., Hess, M., May, P.C. and Finch, C.E. (1991) Astrocytic apolipoprotein E mRNA and GFAP mRNA in hippocampus after entorhinal cortex lesioning. Mol. Brain Res., 11, 97106.[Medline]
23 Poirier, J., Bacchichet, A., Dea, D. and Gauthier, S. (1993) Cholesterol synthesis and lipoprotein reuptake during synaptic remodelling in hippocampus in adult rats. Neuroscience, 55, 8190.[Web of Science][Medline]
24 Poirier, J. (1994) Apolipoprotein E in animal models of CNS injury and in Alzheimers disease. Trends Neurosci., 17, 525530.[Web of Science][Medline]
25 Goodrum, J.F. (1990) Cholesterol synthesis is down-regulated during regeneration of peripheral nerve. J. Neurochem., 54, 17091715.[Web of Science][Medline]
26 Svennerholm, L., Boström, K., Jungbjer, B. and Olsson, L. (1994) Membrane lipids of adult human brain: lipid composition of frontal and temporal lobe in subjects of age 20 to 100 years. J. Neurochem., 63, 18021811.[Web of Science][Medline]
27 Svennerholm, L. and Gottfries, C.-G. (1994) Membrane lipids, selectively diminished in Alzheimer brains, suggest synapse loss as a primary event in early-onset form (type I) and demyelination in late-onset form (type II). J. Neurochem., 62, 10391047.[Web of Science][Medline]
28 Michikawa, M. and Yanagisawa, K. (1998) Apolipoprotein E4 induces neuronal cell death under conditions of suppressed de novo cholesterol synthesis. J. Neurosci. Res., 54, 5867.[Web of Science][Medline]
29 Sullivan, P.M., Mezdour, H., Aratani, Y., Knouff, C., Najib, J., Reddick, R.L., Quarfordt, S.H. and Maeda, N. (1997) Targeted replacement of the mouse apolipoprotein E gene with the common human APOE3 allele enhances diet-induced hypercholesterolemia and atherosclerosis. J. Biol. Chem., 272, 1797217980.
30 Sullivan, P.M., Mezdour, H., Quarfordt, S.H. and Maeda, N. (1998) Type III hyperlipoproteinemia and spontaneous atherosclerosis in mice resulting from gene replacement of mouse Apoe with human APOE*2. J. Clin. Invest., 102, 130135.[Web of Science][Medline]
31 Knouff, C., Hinsdale, M.E., Mezdour, H., Altenburg, M.K., Watanabe, M., Quarfordt, S.H., Sullivan, P.M. and Maeda, N. (1999) ApoE structure determines VLDL clearance and atherosclerosis risk in mice. J. Clin. Invest., 103, 15791586.[Web of Science][Medline]
32 Hooper, M., Hardy, K., Handyside, A., Hunter, S. and Monk, M. (1987) HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature, 326, 292295.[Medline]
33 Das, H.K., McPherson, J., Bruns, G.A.P., Karathanasis, S.K. and Breslow, J.L. (1985) Isolation, characterization, and mapping to chromosome 19 of the human apolipoprotein E gene. J. Biol. Chem., 260, 62406247.
34 Weisgraber, K.H. (1994) Apolipoprotein E: structurefunction relationships. Adv. Prot. Chem., 45, 249302.[Web of Science][Medline]
35 Fujita, S.C., Sakuta, K., Tsuchiya, R. and Hamanaka, H. (1999) Apolipoprotein E is found in astrocytes but not microglia in the normal mouse brain. Neurosci. Res., 35, 123133.[Web of Science][Medline]
36 Nukina, N., Uchida, K., Sakamoto, T., Ide, K. and Kanazawa, I. (1995) Monoclonal antibody against the polymorphic site distinguishes apolipoprotein E4 from other isoforms. Biochem. Biophys. Res. Commun., 216, 467472.[Web of Science][Medline]
37 Piedrahita, J.A., Zhang, S.H., Hagaman, J.R., Oliver, P.M. and Maeda, N. (1992) Generation of mice carrying a mutant apolipoprotein E gene inactivated by gene targeting in embryonic stem cells. Proc. Natl Acad. Sci. USA, 89, 44714475.
38 Wetterau, J.R., Aggerbeck, L.P., Rall Jr, S.C. and Weisgraber, K.H. (1988) Human apolipoprtoein E3 in aqueous solution. I. Evidence for two structural domains. J. Biol. Chem., 263, 62406248.
39 Smith, J.D., Sikes, J. and Levin. J.A. (1998) Human apolipoprotein E allele-specific brain expressing transgenic mice. Neurobiol. Aging, 19, 407413.[Web of Science][Medline]
40 Sun, Y., Wu, S., Bu, G., Onifade, M.K., Patel, S.N., LaDu, M.J., Fagan, A.M. and Holtzman, D.M. (1998) Glial fibrillary acidic protein-apolipoprotein E (apoE) transgenic mice: astrocyte-specific expression and differing biological effects of astrocyte-secreted apoE3 and apoE4 lipoproteins. J. Neurosci., 18, 32613272.
41 Raber, J., Wong, D., Buttini, M., Orth, M., Bellosta, S., Pitas, R.E., Mahley, R.W. and Mucke, L. (1998) Isoform-specific effects of human apolipoprotein E on brain function revealed in ApoE knockout mice: increased susceptibility of females. Proc. Natl Acad. Sci. USA, 95, 1091410919.
42 Zhang, S.H., Reddick, R.L., Piedrahita, J.A. and Maeda, N. (1992) Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science, 258, 468471.
43 Plump, A.S., Smith, J.D., Hayek, T., Aalto-Setälä, K., Walsh, A., Verstuyft, J.G., Rubin, E.M. and Breslow, J.L. (1992) Severe hypercholesterolemia and atherosclerosis in aplipoprotein E-deficient mice created by homologous recombination in ES cells. Cell, 71, 343353.[Web of Science][Medline]
44 Xu, P.-T., Schmechel, D., Rothrock-Christian, T., Burkhart, D.S., Qiu, H.-L., Popko, B., Sullivan, P., Maeda, N., Saunders, A.M., Roses, A.D. and Gilbert, J.R. (1996) Human apolipoprotein E2, E3, and E4 isoform-specific transgenic mice: human-like pattern of glial and neuronal immunoreactivity in central nervous system not observed in wild-type mice. Neurobiol. Dis., 3, 229245.[Web of Science][Medline]
45 Davignon, J., Gregg, R.E. and Sing, C.F. (1988) Apolipoprotein E polymorphism and atherosclerosis. Arteriosclerosis, 8, 121.
46 Jarvik, G.P., Wijsman, E.M., Kukull, W.A., Schellenberg, G.D., Yu, C. and Larson, E.B. (1995) Interactions of apolipoprotein E genotype, total cholesterol level, age, and sex in prediction of Alzheimers disease: a case-control study. Neurology, 45, 10921096.
47 Steinmetz, A., Jakobs, C., Motzny, S. and Kaffarnik, H. (1989) Differential distribution of apolipoprotein E isoforms in human plasma lipoproteins. Arteriosclerosis, 9, 405411.
48 Dong, L.-M., Wilson, C., Wardell, M.R., Simmons, T., Mahley, R.W., Weisgraber, K.H. and Agard, D.A. (1994) Human apolipoprotein E: role of arginine 61 in mediating the lipoprotein preferences of the E3 and E4 isoforms. J. Biol. Chem., 269, 2235822365.
49 Gregg, R.E., Zech, L.A., Schaefer, E.J., Stark, D., Wilson, D. and Brewer Jr, H.B. (1986) Abnormal in vivo metabolism of apolipoprotein E4 in humans. J. Clin. Invest., 78, 815821.
50 Lee, S.-J., Liyanage, U., Bickel, P.E., Xia, W., Lansbury Jr, P.T. and Kosik, K.S. (1998) A detergent-insoluble membrane compartment contains Aß in vivo. Nature Med., 4, 730734.[Web of Science][Medline]
51 Morishima-Kawashima, M. and Ihara, Y. (1998) The presence of amyloid ß-protein in the detergent-insoluble membrane compartment of human neuroblastoma cells. Biochemistry, 37, 1524715253.[Medline]
52 Bodovitz, S. and Klein, W.L. (1996) Cholesterol modulates
-secretase cleavage of amyloid precursor protein. J. Biol. Chem., 271, 44364440.
53 Racchi, M., Baetta, R., Salvietti, N., Ianna, P., Franceschini, G., Paoletti, R., Fumagalli, R., Govoni, S., Trabucchi, M. and Soma, M. (1997) Secretory processing of amyloid precursor protein is inhibited by increase in cellular cholesterol content. Biochem J., 322, 893898.
54 Ikezu, T., Trapp, B.D., Song, K.S., Schlegel, A., Lisanti, M.P. and Okamoto, T. (1998) Caveolae, plasma membrane microdomains for
-secretase-mediated processing of the amyloid precursor protein. J. Biol. Chem., 273, 1048510495.
55 Simons, M., Keller, P., De Strooper, B., Beyreuther, K., Dotti, C.G. and Simons, K. (1998) Cholesterol depletion inhibits the generation of ß-amyloid in hippocampal neurons. Proc. Natl Acad. Sci. USA, 95, 64606464.
56 Mizuno, T., Haass, C., Michikawa, M. and Yanagisawa, K (1998) Cholesterol-dependent generation of a unique amyloid ß-protein from apically missorted amyloid precursor protein in MDCK cells. Biochim. Biophys. Acta, 1373, 119130.[Medline]
57 Mizuno, T., Nakata, M., Naiki, H., Michikawa, M., Wang, R., Haass, C. and Yanagisawa, K. (1999) Cholesterol-dependent generation of a seeding amyloid ß-protein in cell culture. J. Biol. Chem., 274, 1511015114.
58 Howland, D.S., Trusko, S.P., Savage, M.J., Reaume, A.G., Lang, D.M., Hirsch, J.D., Maeda, N., Siman, R., Greenberg, B.D., Scott, R.W. and Flood, D.G. (1998) Modulation of secreted ß-amyloid precursor protein and amyloid ß-peptide in brain by cholesterol. J. Biol. Chem., 273, 1657616582.
59 Price, D.L., Tanzi, R.E., Borchelt, D.R. and Sisodia, S.S. (1998) Alzheimers disease: genetic studies and transgenic models. Annu. Rev. Genet., 32, 461493.[Web of Science][Medline]
60 Lamb, B.T., Bardel, K.A., Kulnane, L.S., Anderson, J.J., Holtz, G., Wagner, S.L., Sisodia, S.S. and Hoeger, E.J. (1999) Amyloid production and deposition in mutant amyloid presursor protein and presenilin-1 yeast artificial chromosome transgenic mice. Nature Neurosci., 2, 695697.[Web of Science][Medline]
61 Kida, E., Pluta, R., Lossinsky, A.S., Golabek, A.A., Choi-Miura, N.-H., Wisniewski, H.M. and Mossakowski, M.J. (1995) Complete cerebral ischemia with short-term survival in rat induced by cardiac arrest. II. Extracellular and intracellular accumulation of apolipoproteins E and J in the brain. Brain Res., 674, 341346.[Web of Science][Medline]
62 Nicoll, J.A.R., Roberts, G.W. and Graham, D.I. (1995) Apolipoprotein E
4 allele is associated with deposition of amyloid ß-protein following head injury. Nature Med., 1, 135137.[Web of Science][Medline]
63 Fagan, A.M., Murphy, B.A., Patel, S.N., Kilbridge, J.F., Mobley, W.C., Bu, G. and Holtzman, D.M. (1998) Evidence for normal aging of the septo-hippocampal cholinergic system in apoE (/) mice but impaired clearance of axonal degeneration products following injury. Exp. Neurol., 151, 314325.[Web of Science][Medline]
64 Edmond, J., Korsak, R.A., Morrow, J.W., Torok-Both, G. and Catlin, D.H. (1991) Dietary cholesterol and the origin of cholesterol in the brain of developing rats. J. Nutr., 121, 13231330.
65 Sperk, G. (1993) Kainic acid seizures in the rat. Prog. Neurobiol., 42, 132.
66 Cotman, C.W. and Nieto-Sampedro, M. (1984) Cell biology of synaptic plasticity. Science, 225, 12871294.
67 Arendt, T., Schindler, C., Brückner, M.K., Eschrich, K., Bigl, V., Zedlick, D. and Marcova, L. (1997) Plastic neuronal remodeling is impaired in patients with Alzheimers disease carrying apolipoprotein
4 allele. J. Neurosci., 17, 516529.
68 McLean, J.W., Elshourbagy, N.A., Chang, D.J., Mahley, R.W. and Taylor, J.M. (1984) Human apolipoprotein E mRNA. cDNA cloning and nucleotide sequencing of a new variant. J. Biol. Chem., 259, 64986504.
69 Kitamoto, T., Nakamura, K., Nakao, K., Shibuya, S., Shin, R.-W., Gondo, Y., Katsuki, M. and Tateishi, J. (1996) Humanized prion protein knock-in by cre-induced site-specific recombination in the mouse. Biochem. Biophys. Res. Commun., 222, 742747.[Web of Science][Medline]
70 Thomas, K.R. and Capecchi, M.R. (1987) Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell, 51, 503512.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
T. Yamada, T. Someya, and S. Fujita Immunotargeting of Apolipoprotein E in Amyloid: An Initial Trial in Mice Ann. Clin. Lab. Sci., January 1, 2009; 39(2): 134 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
C-M Lai, S A Dunlop, L A May, M Gorbatov, M Brankov, W-Y Shen, N Binz, Y K. Lai, C E Graham, C J Barry, et al. Generation of transgenic mice with mild and severe retinal neovascularisation Br J Ophthalmol, July 1, 2005; 89(7): 911 - 916. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Mann, F. E. Thorngate, Y. Katoh-Fukui, H. Hamanaka, D. L. Williams, S. Fujita, and B. T. Lamb Independent effects of APOE on cholesterol metabolism and brain A{beta} levels in an Alzheimer disease mouse model Hum. Mol. Genet., September 1, 2004; 13(17): 1959 - 1968. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Gong, M. Kobayashi, H. Hayashi, K. Zou, N. Sawamura, S. C. Fujita, K. Yanagisawa, and M. Michikawa Apolipoprotein E (ApoE) Isoform-dependent Lipid Release from Astrocytes Prepared from Human ApoE3 and ApoE4 Knock-in Mice J. Biol. Chem., August 9, 2002; 277(33): 29919 - 29926. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lesuisse, G. Xu, J. Anderson, M. Wong, J. Jankowsky, G. Holtz, V. Gonzalez, P. C. Y. Wong, D. L. Price, F. Tang, et al. Hyper-expression of human apolipoprotein E4 in astroglia and neurons does not enhance amyloid deposition in transgenic mice Hum. Mol. Genet., October 1, 2001; 10(22): 2525 - 2537. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Raffai, L.-M. Dong, R. V. Farese Jr., and K. H. Weisgraber Introduction of human apolipoprotein E4 ""domain interaction"" into mouse apolipoprotein E PNAS, September 5, 2001; (2001) 201279298. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Morishima-Kawashima, N. Oshima, H. Ogata, H. Yamaguchi, M. Yoshimura, S. Sugihara, and Y. Ihara Effect of Apolipoprotein E Allele {{epsilon}}4 on the Initial Phase of Amyloid {beta}-Protein Accumulation in the Human Brain Am. J. Pathol., December 1, 2000; 157(6): 2093 - 2099. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Raffai, L.-M. Dong, R. V. Farese Jr., and K. H. Weisgraber Introduction of human apolipoprotein E4 "domain interaction" into mouse apolipoprotein E PNAS, September 25, 2001; 98(20): 11587 - 11591. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









