Human Molecular Genetics, 2000, Vol. 9, No. 3 387-394
© 2000 Oxford University Press
Huntingtin is required for normal hematopoiesis
1Center for Molecular Medicine and Therapeutics, University of British Columbia, Department of Medical Genetics, 950 West 28th Avenue, Vancouver, British Columbia, Canada V5Z 4H4, 2The Terry Fox Laboratory, British Columbia Cancer Agency, 601 West 10th Avenue, Vancouver, British Columbia, Canada V5Z 1L3, 3Department of Genetics and Development, Columbia University, Russ Berrie Center, Room 607, 1150 St Nicholas Avenue, New York, NY 10032, USA, 4Department of Pathology, Columbia University and 5Department of Medicine, University of British Columbia
Received 1 October 1999; Revised and Accepted 7 December 1999.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Huntington’s disease (HD) is a neurodegenerative disease associated with polyglutamine expansion in huntingtin, a widely expressed protein. The function of huntingtin is unknown although huntingtin plays a fundamental role in development since gene targeted HD –/– mouse embryos die shortly after gastrulation. Expression of huntingtin is detected in spleen and thymus but its role in hematopoiesis has not been examined. To determine the function of huntingtin and to provide insight into potential pathologic mechanisms in HD, we analyzed the role of huntingtin in hematopoietic development. Expression of huntingtin was analyzed in a variety of hematopoietic cell types, and in vitro hematopoiesis was assessed using an HD +/– and several HD –/– embryonic stem (ES) cell lines. Although wild-type, HD +/– and HD –/– ES cell lines formed primary embryoid bodies (EBs) with similar efficiency, the numbers of hematopoietic progenitors detected at various stages of the in vitro differentiation were reduced in HD +/– and HD –/– ES cell lines examined. Expression analyses of hematopoietic markers within the EBs revealed that primitive and definitive hematopoiesis occurs in the absence of huntingtin. However, further analysis using a suspension culture in the presence of hematopoietic cytokines demonstrated a highly significant gene dosage-dependent decrease in proliferation and/or survival of HD +/– and HD –/– cells. Enrichment for the CD34+ cells within the EB confirmed that the impairment is intrinsic to the hematopoietic cells. These obser- vations suggest that huntingtin expression is required for the generation and expansion of hematopoietic cells and provides an alternative system in which to assess the function of huntingtin.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder characterized by preferential loss of cortical and striatal projection neurons through apoptosis (1–5). Clinical symptoms include cognitive decline, dementia and involuntary movements with an onset usually in mid-adulthood. The underlying mutation in HD leads to polyglutamine expansion in the N-terminal portion of huntingtin and the length of the polyglutamine tract is inversely correlated with the onset of the disease (6,7). This feature of polyglutamine-induced neurotoxicity is shared by several other neurodegenerative diseases including spinocerebellar ataxia types 1, 2, 3, 6 and 7, dentatorubral-pallidoluysian atrophy, and spinal and bulbar muscular atrophy (7,8). Huntingtin has recently been identified as a substrate for caspases, and the generation of an N-terminal proteolytic fragment encompassing the polyglutamine expansion is likely a crucial and toxic event in disease progression (9–14).
Thus far, attempts to identify the cellular function of huntingtin have been of limited success. A fundamental role of huntingtin was demonstrated by the generation of gene-targeted HD–/– mouse embryos which die between embryonic day (E) 7.5 and E8.5 (15–17) indicating that huntingtin expression is required for normal development. Nevertheless, despite high expression of huntingtin in neuronal cell types, in vitro differentiation of HD–/– embryonic stem (ES) cells into neurons is not overtly impaired (18). These neurons express functional voltage-gated and receptor-operated ion channels and establish functional synapses. Intriguingly, if expression of huntingtin is reduced by >50% a phenotype is uncovered with similarity to caspase-3 knock-out mice (19,20). The developing embryos show exencephaly with protruding fore and midbrain structures that mostly consist of post-mitotic neuronal cells. These findings indicate that huntingtin may itself play a role in regulating the balance between cell proliferation and cell death.
Huntingtin is a large cytosolic protein of ~340 kDa without any known functional domains. Subcellular and immunolocalization studies indicate that huntingtin may be involved in intracellular transport since it co-purifies with membranes, and it is often found in close association with vesicles and microtubules (21,22). Application of the yeast two-hybrid system has lead to the identification of several huntingtin-interacting proteins whose functions have yet to be determined: HAP1 (huntingtin-associated protein) (23), HIP1 (huntingtin-interacting protein) (24,25), SH3GL3 (26), several novel WW-domain containing proteins (27) and the nuclear receptor co-repressor (28).
Early embryonic lethality in HD–/– gene-targeted mice renders it more difficult to identify the cellular function of huntingtin. Recent studies indicate that both huntingtin and HIP1 are expressed in hematopoietic cells (29–31). Therefore, analyses of hematopoietic development in the absence of huntingtin could provide insight into the cellular function of huntingtin and its role in proliferation and cell death. The in vitro differentiation of ES cells into hematopoietic progenitors has proven to be an invaluable tool for assessing the effect of genetic alterations such as homozygous deletion of GATA-1 (32) or SCL/Tal-1 (33). Numerous studies have shown that gene expression patterns and the appearance of hematopoietic progenitor cells closely mimics early in vivo events (34,35). We have exploited this model of in vitro hematopoiesis to determine whether huntingtin is involved in the generation and expansion of hematopoietic progenitors during the earliest stages of ontogeny. Our studies reveal that huntingtin expression is required for normal hematopoiesis in the ES cell model. In the absence of huntingtin, progenitor numbers are reduced and the recovery of viable cells in suspension culture in the presence of hematopoietic cytokines is markedly diminished. These studies demonstrate that huntingtin plays a role in the generation and expansion of hematopoietic progenitor cells. Furthermore, the hematopoietic system provides an alternative model of cell proliferation, differentiation and survival in which to assess the function of huntingtin.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Huntingtin expression in embryonic and adult hematopoietic tissues
To determine whether huntingtin could play an intrinsic role in hematopoiesis, expression of huntingtin was assessed in mouse fetal and adult hematopoietic tissues (Fig. 1). Semi-quantitative reverse transcription–polymerase chain reaction (RT–PCR) revealed that huntingtin mRNA is present in mouse E13.5 yolk sac, E14.5 fetal liver, adult bone marrow and ES cell-derived hematopoietic cells (Fig. 1A). Moreover, huntingtin mRNA is expressed in hematopoietic cell populations derived from E14.5 fetal liver and adult bone marrow including the stem cell-enriched Sca-1+Lin– population, as well as the Sca-1+, Sca-1+Lin+ and the mature Sca-1– cell subpopulations that were isolated by fluorescence-activated cell sorting (data not shown). Direct evidence that huntingtin is expressed in hematopoietic cells was provided by western blot analysis comparing the expression of huntingtin in thymus, spleen, lymph node and ES cell-derived hematopoietic cells (Fig. 1B). Moreover, huntingtin was found to be expressed in all myeloid and lymphoid progenitor cell lines of mouse and human origin that were analyzed (Fig. 1C). Only mouse DA-ER and B6Sut cells demonstrated a low level of huntingtin expression. Smaller size fragments, which are shown in Figure 1B and C, are likely proteolytic degradation products of the full-length protein. The presence of huntingtin in both immature and mature hematopoietic cells of fetal and adult origin suggests that huntingtin could play a role in normal hematopoiesis throughout ontogeny.
|
Differentiation of ES cells into hematopoietic progenitors
To examine this possibility we studied whether ES cells can differentiate into hematopoietic progenitors in the absence of huntingtin. The ability of R1 wild-type, HD+/– 4.4 and HD–/– 4.4.2 cells (18) to generate embryoid bodies (EBs) in the primary differentiation cultures was unchanged with 69 ± 11, 62 ± 18 and 76 ± 17 EBs generated from 1500 cells for +/+, +/– and –/– respectively (mean ± SEM, n = 4). Also, cellularity of the EBs did not differ significantly amongst the three genotypes at any stage of the primary differentiation culture [between days 8 and 16 (data not shown)].
The content of hematopoietic progenitors in EBs was evaluated by dissociation and plating in secondary methylcellulose containing a cocktail of hematopoietic growth factors. The results of this analysis are shown in Figure 2. The total number of hematopoietic progenitors was reduced in HD+/– and to a greater extent in all three HD–/– EB cultures compared with wild-type (data not shown). There were striking reductions in the number of granulocyte-macrophage progenitors [colony forming unit-granulocyte-macrophage (CFU-GM)] observed at all time points. For example, the number of CFU-GM per 105 cells isolated from EBs of HD+/– line 4.4 and HD–/– line 4.4.2 was reduced by 43 and 73%, respectively, when compared with R1 wild-type cultures at day 8. This observation was confirmed through the analysis of ES cell lines A, B and M (36); here, the number of CFU-GM was reduced in both HD–/– ES cell lines by 94% at day 7 when compared with M wild-type cells. Even more pronounced reductions were evident for mixed myeloid-erythroid progenitors [CFU-granulocyte-macrophage-erythroid-megakaryocyte (CFU-Mix)]. These progenitors were less frequent in HD+/– cultures and detected rarely in all three HD–/– cell lines. CFU-erythroid (CFU-E) were reduced by ~54% in both HD+/– and HD–/– cultures at day 8 (114 ± 44 for R1 wild-type, 53 ± 20 for HD+/– 4.4 and 54 ± 25 for HD–/– 4.4.2 cells, P < 0.05 compared with wild-type cells) and as much as 62 and 84% in HD+/– and HD–/– cells, respectively, at day 14 (69 ± 17 for R1 wild-type, 27 ± 2 for HD+/– 4.4 and 11 ± 5 for HD–/– 4.4.2 cells, P = 0.003 compared with wild-type; n = 4). This reduction in the number of erythroid progenitors was less evident in both HD–/– cell lines A and B with 33 and 36%, respectively, at day 13 when compared with wild-type cell line M. This variation may reflect differences in genetic background between these lines and the R1, 4.4 and 4.4.2 cell lines, respectively. Interestingly, a similar discrepancy in erythropoiesis has been observed between the respective gene-targeted null embryos (16,17). Together, these data provide direct evidence that expression of huntingtin is required for normal hematopoiesis. Moreover, a greater number of progenitors developed in cultures of HD+/– line 4.4 in comparison with HD–/– 4.4.2 cells indicating a gene dosage-dependent effect on hematopoiesis in the absence of huntingtin.
|
In vitro expansion of ES cell-derived hematopoietic progenitors
Secondary methylcellulose cultures of EB-derived cells provide information regarding progenitor numbers and types but do not fully assess the proliferation capacity or survival which can be more readily measured in a liquid suspension culture type assay. For example, in the absence of huntingtin, progenitors may proliferate sufficiently to be counted as a colony in the methylcellulose assay (scored as
20 cells), but the colonies may be smaller and the cells within the colonies may not survive for the same length of time. Therefore, a suspension culture system was developed in which early EB cells are cultured in the presence of hematopoietic cytokines to assess cell expansion. In this culture system many non-hematopoietic cells die or adhere to the dish during the initial 3 days in culture resulting in an enrichment for hematopoietic progenitors in the non-adherent population. Subsequently, the differentiation of these progenitors into mature cell types occurs, and macrophages, neutrophils and erythroid cells can be detected by cytological examination in day 6 cultures. At later times of culture mast cells become the predominant cell type. In this system the total cell count provides a measure of cell expansion which reflects both the proliferation and survival of these different cell populations. In order to compare cell expansion between wild-type, HD+/– and HD–/– cells the recovery of viable cells in the presence of hematopoietic growth factors was determined at various stages of the suspension culture. During the initial 3 days in culture the number of cells derived from day 9 EBs in wild-type R1, HD+/– 4.4 and HD–/– 4.4.2 cultures remained relatively constant. Throughout the remainder of the culture period, the number of viable cells in the wild-type and heterozygous cultures increased ~7- and ~3-fold over input, respectively, whereas no increase in cell number was observed in cultures of HD–/– 4.4.2 cells (Fig. 3A; P < 0.005 compared with wild-type; n = 4). Further experiments conducted with EB-derived CD34+ cells, which are enriched for hematopoietic progenitors (37), yielded similar results (Fig. 3A) suggesting that the primary defect in the HD–/– 4.4.2 cells is intrinsic to the hematopoietic cells. Moreover, these studies provide additional evidence that the effect on hematopoiesis in the absence of huntingtin is gene dosage dependent.
|
One possible explanation for the decreased cell numbers in the suspension cultures of HD–/– cells is that the generation of cells with the potential to survive and expand is delayed in the absence of huntingtin. To examine this possibility, cells isolated from day 11 EBs were cultured in suspension and the number of viable cells was determined at different time points. A representative result of three independently performed experiments is shown in Figure 3B confirming that even at later stages of differentiation the absence of huntingtin impairs the survival and/or proliferation of ES cell-derived hematopoietic cells. Interestingly, the HD–/– 4.4.2 day 11 EB-derived cells do show a limited potential to expand, most likely reflecting the outgrowth of surviving mast cell clones. Taken together these data confirm that expression of huntingtin is required for normal hematopoiesis. Moreover, these results suggest that assessment of the number of progenitor cells in methylcellulose cultures (Fig. 2) underestimates the dramatic effect that absence of huntingtin has on proliferation and survival of ES cell-derived hematopoietic cells.
Expression of hematopoietic genes
In order to further characterize the hematopoietic defect in HD–/– cells, R1 and 4.4.2 EBs were isolated at days 9 and 12 of the primary differentiation for molecular analysis. At each time point there was a significant reduction in the number of hematopoietic clonogenic progenitors detected on replating. Equivalent numbers of cells derived from each culture were lyzed and RNA was isolated for RT and cDNA amplification as described previously (38,39). Southern blots of amplified cDNA were probed to examine the expression of embryonic globin (ßH-1) and adult ß-globin as a measure of primitive and definitive erythropoiesis, respectively. In addition, expression of the hematopoietic marker GATA-1 was analyzed. Results of one representative experiment are presented in Figure 4. Expression of all markers was detected in each population confirming the colony data, which indicates that absence of huntingtin does not lead to an absolute block in the generation of primitive or definitive hematopoietic progenitors.
|
Expression of huntingtin-interacting proteins
Decreased hematopoiesis in the absence of huntingtin may result from altered expression of proteins that have been identified recently as interacting with huntingtin (23–28,40). To assess this possibility the expression of several huntingtin-interacting proteins was analyzed in hematopoietic cells by RT–PCR. Moreover, expression of the HIP1 homolog HIP1a was also assessed (41, unpublished data). Since many genes are expressed in the early stem cell stage, RNA was isolated from undifferentiated ES cells and used as positive control to test gene-specific amplification. Interestingly, all genes that were analyzed are transcribed in ES cell-derived hematopoietic cells indicating that altered function resulting from the lack of interaction with huntingtin could mediate the defect in hematopoiesis in HD–/– cells (Fig. 5).
|
Generation of chimeric mice
To assess whether the defect in hematopoiesis in HD–/– ES cells occurs in vivo, wild-type and HD–/– ES cells were microinjected into C57Bl/6J blastocysts to generate chimeric mice. No chimeric mice arose from three microinjection experiments using HD–/– 4.4.2 ES cells. In contrast, five chimeric mice were generated following injection of R1 wild-type cells. These mice were 80–100% chimeric indicating that contribution of HD–/– cells to the developing embryo is highly detrimental and reproduces the phenotype observed in gene-targeted HD–/– mouse embryos.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
In this study, we have demonstrated that expression of huntingtin is required for normal hematopoietic progenitor cell development using the ES cell in vitro differentiation model. This is indicated by a decreased recovery of progenitors from EBs and impaired cell expansion in suspension cultures in the presence of hematopoietic cytokines seen in HD+/– and multiple HD–/– cell lines. Surprisingly, the defect is gene dosage dependent since in vitro hematopoiesis in HD+/– cultures is affected, albeit less severely than in HD–/– cultures. Molecular analysis of selected gene expression patterns within day 9 and 11 EBs revealed that both ßH1-globin and ß-globin are readily detected in the absence of huntingtin, indicating that neither primitive nor definitive hematopoiesis is blocked. However, pronounced quantitative defects in all progenitor compartments were detected when cells from disrupted EBs were plated in secondary methylcellulose cultures. The largest reductions were observed in the numbers of multipotential and granulocyte/macrophage progenitor cells in HD+/– and in all three HD–/– cell lines. The relative number of erythroid progenitors compared with wild-type cells was also decreased in HD+/– and in all three HD–/– ES cell lines although most severe in the HD–/– 4.4.2 cell line. This variation may reflect differences in genetic background between cell lines that were used in this study.
Suspension cultures of day 9 or 11 EB cells revealed an even more pronounced defect in hematopoietic development in the absence of huntingtin. All three HD–/– cell lines exhibited a dramatic impairment in their ability to expand in suspension culture in response to cytokines. Preliminary studies suggested that during the first 3 days in suspension culture the frequency of CFU-GM detectable in methylcellulose assays increased with both the wild-type R1 and HD–/– 4.4.2 cells (data not shown). At later time points the number of viable cells declined in HD–/– cultures which most likely reflects both the decreased number of progenitors present at the onset (<2-fold difference) and an impaired ability of HD–/– cells to expand in these cultures. Taken together, these observations indicate that lack of huntingtin reduces the ability of hematopoietic cells to expand in cell culture.
On the molecular level, impaired hematopoiesis in the absence of huntingtin could result from a variety of defects such as defects in signal transduction, cell-cycle control or the ability of hematopoietic progenitors to execute the proliferative response necessary for their self-renewal, differentiation and survival. Recent observations suggest that huntingtin may govern processes in the secretory and endocytic pathway. Firstly, immuno- localization studies have shown that huntingtin associates with clathrin-coated and non-coated vesicles and is also found on microtubules (22). Secondly, huntingtin interacts with several proteins that have been implicated in retro- and anterograde transport of vesicles and organelles. These are: HAP1 which interacts with dynactin p150Glued, a component of the motor complex allowing retrograde, microtubule-dependent transport (42,43); HIP1 whose yeast homolog Sla2 is involved in the secretory and endocytic pathway (44,45); HIP3 whose yeast homolog Akr1 is involved in endocytosis (46, unpublished data); and 
-adaptin-C, a component of the adaptor protein-2 complex (AP-2) of endocytic pits and coated vesicles (27,47). Considering that HAP1, HIP1 and HIP3 are expressed in hematopoietic progenitor cells, the lack of interaction between these proteins and huntingtin could alter their normal function. Whether the absence of huntingtin impairs intracellular transport in hematopoietic cells and whether such alterations are responsible for the defect in hematopoiesis in HD–/– cells requires further investigation.
Other interacting proteins, such as SH3GL3 and HYPA which contain SH3 and WW domains, respectively, may function in signal transduction through binding to the proline-rich region of huntingtin (48). Both genes are transcribed in hematopoietic cells and may couple huntingtin to signal transduction pathways which regulate the fate of hematopoietic cells. Therefore, it is conceivable that the defect in hematopoiesis in the absence of huntingtin is a direct consequence of impaired signal transduction resulting from lack of interaction between huntingtin and these potential signal-transducing molecules.
The results presented in this study demonstrate for the first time that huntingtin plays a role in normal hematopoiesis. Moreover, the in vitro ES cell differentiation system provides a model in which to examine in greater detail the role of huntingtin in cell proliferation and survival.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Cell lines
The following hematopoietic cell lines were used to determine expression of huntingtin in hematopoietic cells: a mouse immature leukemia cell line (DA-ER), two mouse mast cell lines (MC-9 and P815), a mouse erythroleukemia (MEL), a mouse IL-3-dependent progenitor cell line (B6SutA), a human erythroleukemia (K562), a human megakaryocytic cell line (Mo7E), a human T cell precursor cell line (Jurkat) and a human lymphoblastoid cell line (L57).
The results presented in this study are mostly derived from analyses of HD–/– ES cell line 4.4.2 which was generated by gene conversion as described previously and analyzed in comparison with the parental heterozygous cell line 4.4 and the R1 wild-type cell line (18). To confirm our initial observations, two other HD–/– ES cell lines, A and B, were used and compared with wild-type ES cell line M. Importantly, these three cell lines have been established from blastocyst-stage mouse embryos after breeding of HD+/– mice (36). Therefore, the effect of huntingtin was assessed in the context of different genetic backgrounds in the R1, 4.4 and 4.4.2 and the A, B and M ES cell lines, respectively.
Cell culture and quantitation of hematopoietic progenitor cells in developing EBs
The methods utilized for the differentiation of ES cells and the quantitation of progenitor cells within the EBs were essentially as described previously (38). Forty-eight hours prior to differentiation, cells were passaged at low density (1–3 x 105 cells per 25 cm2 flask) in Iscove’s modified essential medium (IMDM) supplemented with 15% fetal bovine serum (FBS; Sigma, St Louis, MO), 4 mM glutamine, 1x non-essential amino acids, 150 µM monothioglycerol (MTG; Sigma) and 1000 U/ml leukemia inhibitory factor (supernatant from Cos cells transfected with a leukemia inhibitory factor expression vector prepared at the Terry Fox Laboratory, Vancouver, British Columbia, Canada). Cells were harvested with 0.25% Trypsin– 1 mM EDTA (Gibco BRL, Burlington, Ontario, Canada) and washed with IMDM containing 5% FBS. Unless otherwise stated, all reagents were obtained from StemCell Technologies (STI, Vancouver, British Columbia, Canada).
ES cells were plated at 1–2 x 103 cells per petri dish (STI) in 0.9% Iscove’s methylcellulose supplemented with 15% selected FBS, 450 µM MTG (Sigma) and 40 ng/ml steel factor (SF) supplied as a Cos cell-derived supernatant in IMDM. Cultures were fed at day 8 of the primary differentiation by layering 0.5 ml of 0.45% methylcellulose containing recombinant human erythropoietin (Epo; 3 U/ml; STI), 160 ng/ml SF, 30 ng/ml interleukin (IL)-3 and 30 ng/ml IL-6 (all three supplied as Cos supernatant prepared at the Terry Fox Laboratory) onto each dish. The primary plating efficiency was determined by calculating the percentage of ES cells that formed EBs.
At various stages of the primary differentiation, EBs were harvested for replating in secondary methylcellulose cultures to detect hematopoietic progenitors. EBs were harvested and disrupted by incubation in Trypsin–EDTA or a solution of 0.25% collagenase with 20% FBS in phosphate-buffered saline (PBS; STI). The number of cells per EB was determined by dividing the total cell yield by the number of EBs harvested. Cells were plated in 0.9% Iscove’s methylcellulose (STI M4100ES) supplemented with 3 U/ml Epo, 160 ng/ml SF, 30 ng/ml IL-3 and 30 ng/ml IL-6. Hematopoietic colonies were scored microscopically after 10–14 days using standard criteria (49).
Suspension culture of ES cell-derived hematopoietic progenitors
Cells derived from day 9 or 11 EBs were resuspended in IMDM containing 15% FBS, 2 mM glutamine, 450 µM MTG, 3 U/ml Epo, 40 ng/ml SF, 30 ng/ml IL-3 and 30 ng/ml IL-6 at a density of 1–4 x 105 cells/ml and cultured for a total of 10 days. On day 3, all non- and loosely adherent cells were transferred to a fresh tissue culture dish with additional medium for continued maintenance. At the indicated time points the non- and loosely adherent cells were harvested and the number of viable cells determined by dye exclusion.
RT–PCR and Southern blot analysis
RNA was isolated and 1 µg of RNA was used for the first strand cDNA synthesis according to the SuperScript RT II protocol (Gibco BRL). The following mouse-specific primers were used for subsequent gene-specific amplification.
Huntingtin: 5'-CTAACAAACCCCCCTTCTCTAAGTC and TGGCGTGAGTGGCTTTCAGGACAT (50);
HIP1: 5'-CAGCTGGGGGATCTGAATGA and
GTCCATGTCCATGAGGTCATC;
HIP1a: 5'-AGCCTAAGAGCCTGGATGTACG and
GATGAGTTCCTCGTATTTGCCC (unpublished data);
HIP3: 5'-CATTCCTTGCCAATAGTGTTGC and
TGCACCTACACAGTTACCCACC (unpublished data);
HAP1: 5'-GATGATGATGAGGAAGACGAGG and
AGAGAACTGCTCCACACATT-CC;
HYPA: 5'-CATATGTCTCAGGCTTCCATGC and
CCATGGTGCTCATAGTGGTAGG (Cheryl Helgason, personal communication);
SH3GL3: 5'-CGTTGGTAGATGTTGGTGAGGC and
ACTCATGTTCACAGGCTTTGGC (26).
A semiquantitative RT–PCR technique to amplify cDNA from small numbers of starting cells was carried out to further examine expression of huntingtin (39). Sca-1+, Sca-1–, Sca-1+Lin– and Sca-1+Lin+ populations were derived from E14.5 fetal liver and adult bone marrow of C57BL/6J mice by fluorescence-activated cell sorting. RNA isolation, cDNA amplification and Southern blotting of the amplified cDNA were carried out as described previously (38). The resulting Southern blots were probed with a cDNA fragment isolated from the mouse cDNA clone MHD84, which corresponds to the 3' end of the huntingtin mRNA (50).
RNA isolation from day 9 and 12 EBs, RT and cDNA amplification were carried out as described above. Amplified DNA was electrophoresed through 1% agarose gels and blotted onto Zetaprobe (Bio-Rad) nylon membranes using standard protocols. Membranes were probed with 32P-labeled probes for ßH-1 globin, ß-globin, GATA-1 and actin as previously described (39). Autoradiography was carried out by exposing membranes to Kodak X-OMAT film at room temperature. In addition, quan- titative analysis was carried out using a STORM860 Phospho- Imager and ImageQuant software (Molecular Dynamics, Sunnyvale, CA). Relative levels of expression were determined by dividing the intensity of the indicated band by the intensity of the corresponding actin band.
Western blot analysis
Hematopoietic cells were washed twice in PBS, sonicated and analyzed by western blot as previously described (18). Mouse tissues were homogenized in 20 mM Tris–HCl pH 7.5, 11% sucrose, 1 mM MgCl2, 0.5 mM EDTA, 10 µg/ml leupeptin, 10 µg/ml soybean trypsin inhibitor and 1 mM PMSF. Subsequently, the homogenate was sonicated and centrifuged at 3000 g for 5 min. The supernatant was diluted in 5x loading buffer (250 mM Tris–HCl pH 6.8, 10% SDS, 25% glycerol, 0.7 M ß-mercaptoethanol and 0.02% bromophenol blue), and 100 µg of protein was separated by SDS–PAGE. Western blot analysis was carried out as previously described (18) using the monoclonal anti-huntingtin antibody 2166 (Chemicon, Temecula, CA) and a polyclonal anti-actin antibody (Sigma).
Generation of chimeric mice
Wild-type or HD–/– ES cells were microinjected into C57Bl/6J blastocysts isolated from 3.5 day post-coitum pregnant mice and implanted into the uteri of pseudopregnant ICR mice. Chimeric mice were identified by the presence of agouti coat color patches.
|
ACKNOWLEDGEMENTS |
|---|
This work is supported by the Canadian Networks of Centres of Excellence (NCE-Genetics) and MRC (Canada) operating grants to M.R.H. and the Huntington’s Disease Society to M.M. Further support was provided by the MRC (Canada) and the National Cancer Institute of Canada with funds from the Canadian Cancer Society and Terry Fox Run to R.K.H.
|
FOOTNOTES |
|---|
+ These authors contributed equally to this work
§ To whom correspondence should be addressed. Tel: +1 604 875 3535; Fax: +1 604 875 3819; Email: mrh@cmmt.ubc.ca
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Hayden, M.R. (1981) Huntington’s Chorea. Springer-Verlag, London, Berlin, Heidelberg.
2 Harper, P.S. (1991) Huntington’s Disease. W.B. Saunders, London, Philadelphia, PA.
3 Vonsattel, J.P., Myers, R.H., Stevens, T.J., Ferrante, R.J., Bird, E.D. and Richardson Jr, E.P. (1985) Neuropathological classification of Huntington’s disease. J. Neuropathol. Exp. Neurol., 44, 559–577.[Web of Science][Medline]
4 Portera-Cailliau, C., Hedreen, J.C., Price, D.L. and Koliatsos, V.E. (1995) Evidence for apoptotic cell death in Huntington disease and excitotoxic animal models. J. Neurosci., 15, 3775–3787.[Abstract]
5 Thomas, L.B., Gates, D.J., Richfield, E.K., O’Brien, T.F., Schweitzer, J.B. and Steindler, D.A. (1995) DNA end labeling (TUNEL) in Huntington’s disease and other neuropathological conditions. Exp. Neurol., 133, 265–272.[Web of Science][Medline]
6 Brandt, J., Bylsma, F.W., Gross, R., Stine, O.C., Ranen, N.G. and Ross, C.A. (1996) Trinucleotide repeat length and clinical progression in Huntington’s disease. Neurology, 46, 527–531.
7 Nance, M.A. (1997) Clinical aspects of CAG repeat diseases. Brain Pathol., 7, 881–900.[Web of Science][Medline]
8 Ross, C.A. (1995) When more is less: pathogenesis of glutamine repeat neurodegenerative diseases. Neuron, 15, 493–496.[Web of Science][Medline]
9 Goldberg, Y.P., Nicholson, D.W., Rasper, D.M., Kalchman, M.A., Koide, H.B., Graham, R.K., Bromm, M., Kazemi-Esfarjani, P., Thornberry, N.A., Vaillancourt, J.P. et al. (1996) Cleavage of huntingtin by apopain, a proapoptotic cysteine protease, is modulated by the polyglutamine tract. Nature Genet., 13, 442–449.[Web of Science][Medline]
10 Wellington, C.L., Ellerby, L.M., Hackam, A.S., Margolis, R.L., Trifiro, M.A., Singaraja, R., McCutcheon, K., Salvesen, G.S., Propp, S.S., Bromm, M. et al. (1998) Caspase cleavage of gene products associated with triplet expansion disorders generates truncated fragments containing the polyglutamine tract. J. Biol. Chem., 273, 9158–9167.
11 DiFiglia, M., Sapp, E., Chase, K.O., Davies, S.W., Bates, G.P., Vonsattel, J.P. and Aronin, N. (1997) Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neurites in brain. Science, 277, 1990–1993.
12 Hackam, A.S., Singaraja, R., Wellington, C.L., Metzler, M., McCutcheon, K., Zhang, T., Kalchman, M. and Hayden, M.R. (1998) The influence of huntingtin protein size on nuclear localization and cellular toxicity. J. Cell Biol., 141, 1097–1105.
13 Hodgson, J.G., Agopyan, N., Gutekunst, C.-A., Leavitt, B.R., LePaine, F., Singaraja, R., Smith, D.J., Bissada, N., McCutcheon, K., Nasir, J. et al. (1999) A YAC mouse model for Huntington’s Disease with full-length mutant huntingtin, cytoplasmic toxicity, and selective striatal neurodegeneration. Neuron, 23, 181–192.[Web of Science][Medline]
14 Sanchez, I., Xu, C.-J., Juo, P., Kakizuka, A., Blenis, J. and Yuan, J. (1999) Caspase-8 is required for cell death induced by expanded polyglutamine repeats. Neuron, 22, 623–633.[Web of Science][Medline]
15 Duyao, M.P., Auerbach, A.B., Ryan, A., Persichetti, F., Barnes, G.T., McNeil, S.M., Ge, P., Vonsattel, J.-P., Gusella, J.F., Joyner, A.L. et al. (1995) Inactivation of the mouse Huntington’s disease gene homolog Hdh. Science, 269, 407–410.
16 Nasir, J., Floresco, S.B., O’Kusky, J.R., Diewert, V.M., Richman, J.M., Zeisler, J., Borowski, A., Marth, J.D., Phillips, A.G. and Hayden, M.R. (1995) Targeted disruption of the Huntington’s disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes. Cell, 81, 811–823.[Web of Science][Medline]
17 Zeitlin, S., Liu, J.-P., Chapman, D.L., Papaioannou, V.E. and Efstratiadis, A. (1995) Increased apoptosis and early embryonic lethality in mice nullizygous for the Huntington’s disease gene homologue. Nature Genet., 11, 155–162.[Web of Science][Medline]
18 Metzler, M., Chen, N., Helgason, C.D., Graham, R.K., Nichol, K., McCutcheon, K., Nasir, J., Humphries, R.K., Raymond, L.A. and Hayden, M.R. (1999) Life without huntingtin: normal differentiation into functional neurons. J. Neurochem., 72, 1009–1018.[Web of Science][Medline]
19 White, J.K., Augood, S.J., Duyao, M.P., Vonsattel, J.-P., Gusella, J.F., Joyner, A.L. and MacDonald, M.E. (1997) Huntingtin is required for neurogenesis and is not impaired by the Huntington’s disease CAG expansion. Nature Genet., 17, 404–410.[Web of Science][Medline]
20 Kuida, K., Zheng, T.S., Na, S., Kuan, C., Yang, D., Karasuyama, H., Rakic, P. and Flavell, R.A. (1996) Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature, 384, 368–372.[Medline]
21 DiFiglia, M., Sapp, E., Chase, K., Schwarz, C., Meloni, A., Young, C., Martin, E., Vonsattel, J.P., Carraway, R., Reeves, S.A. et al. (1995) Huntingtin is a cytoplasmic protein associated with vesicles in human and rat brain neurons. Neuron, 14, 1075–1081.[Web of Science][Medline]
22 Velier, J., Kim, M., Schwarz, C., Kim, T.-W., Sapp, E., Chase, K., Aronin, N. and DiFiglia, M. (1998) Wild-type and mutant huntingtins function in vesicle trafficking in the secretory and endocytic pathways. Exp. Neurol., 152, 34–40.[Web of Science][Medline]
23 Li, X.J., Li, S.H., Sharp, A.H., Nucifora Jr, F.C., Schilling, G., Lanahan, A., Worley, P., Snyder, S.H. and Ross, C.A. (1995) A huntingtin-associated protein enriched in brain with implications for pathology. Nature, 378, 398–402.[Medline]
24 Kalchman, M.A., Koide, H.B., McCutcheon, K., Graham, R.K., Nichol, K., Nishiyama, K., Lynn, F.C., Kazemi-Esfarjani, P., Wellington, C.L., Metzler, M. et al. (1997) HIP1, a human homolog of S. cerevisiae Sla2p, interacts with membrane-associated huntingtin in the brain. Nature Genet., 16, 44–53.[Web of Science][Medline]
25 Wanker, E.E., Rovira, C., Scherzinger, E., Hasenbank, R., Walter, S., Tait, D., Colicelli, J. and Lehrach, H. (1997) HIP1: a huntingtin interacting protein isolated by the yeast two-hybrid system. Hum. Mol. Genet., 6, 487–495.
26 Sittler, A., Walter, S., Wedemeyer, N., Hasenbank, R., Scherzinger, E., Eickhoff, H., Bates, G.P., Lehrach, H. and Wanker, E.E. (1998) SH3GL3 associates with the huntingtin exon 1 protein and promotes the formation of polygln-containing protein aggregates. Mol. Cell, 2, 427–436.[Web of Science][Medline]
27 Faber, P.W., Barnes, G.T., Srinidhi, J., Chen, J., Gusella, J.F. and MacDonald, M.E. (1998) Huntingtin interacts with a family of WW domain proteins. Hum. Mol. Genet., 7, 1463–1474.
28 Boutell, J.M., Thomas, P., Neal, J.W., Weston, V.J., Duce, J., Harper, P.S. and Jones, A.L. (1999) Aberrant interactions of transcriptional repressor proteins with the Huntington’s disease gene product, huntingtin. Hum. Mol. Genet., 8, 1647–1655.
29 Ross, T.S., Bernard, O.A., Berger, R. and Gilliland, D.G. (1998) Fusion of huntingtin interacting protein 1 to Platelet-derived growth factor ß receptor (PDGFßR) in chronic myelomonocytic leukemia with t(5;7)(q33;q11.2). Blood, 91, 4419–4426.
30 Sharp, A.H., Loev, S.J., Schilling, G., Li, S.-H., Li, X.-J., Bao, J., Wagster, M.V., Kotzuk, J.A., Steiner, J.P., Lo, A. et al. (1995) Widespread expression of Huntington’s disease gene (IT15) protein product. Neuron, 14, 1065–1074.[Web of Science][Medline]
31 Gutekunst, C.-A., Levey, A.I., Heilman, C.J., Whaley, W.L., Yi, H., Nash, N.R., Rees, H.D., Madden, J.J. and Hersch, S.M. (1995) Identification and localization of huntigtin in brain and human lymphoblastoid cell lines with anti-fusion protein antibodies. Proc. Natl Acad. Sci. USA, 92, 8710–8714.
32 Weiss, M.J., Keller, G. and Orkin, S.H. (1994) Novel insights into erythroid development revealed through in vitro differentiation of GATA-1-embryonic stem cells. Genes Dev., 8, 1184–1196.
33 Porcher, C., Swat, W., Rockwell, K., Fujiwara, Y., Alt, F.W. and Orkin, S.H. (1996) The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell, 86, 47–57.[Web of Science][Medline]
34 Wiles, M.V. (1993) Methods in Enzymology. Academic Press, San Diego, CA.
35 Keller, G., Lacaud, G. and Robertson, S. (1999) Development of the hematopoietic system in the mouse. Exp. Hematol., 27, 777–787.[Web of Science][Medline]
36 Dragatsis, I., Efstratiadis, A. and Zeitlin, S. (1998) Mouse mutant embryos lacking huntingtin are rescued from lethality by wild-type extraembryonic tissues. Development, 125, 1529–1539.[Abstract]
37 Young, P.E., Baumhueter, S. and Lasky, L.A. (1996) The Sialomucin CD34 is expressed on hematopoietic cells and blood vessels during murine development. Blood, 85, 96–105.
38 Helgason, C.D., Sauvageau, G., Lawrence, H.J., Largman, C. and Humphries, R.K. (1996) Overexpression of HOXB4 enhances the hematopoietic potential of embryonic stem cells differentiated in vitro. Blood, 87, 2740–2749.
39 Sauvageau, G., Landsdorp, P.M., Eaves, C.J., Hogge, D.E., Dragowska, W.H., Reid, D.S., Largman, C., Lawrence, H.J. and Humphries, R.K. (1994) Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells. Proc. Natl Acad. Sci. USA, 91, 12223–12227.
40 Kalchman, M.A., Graham, R.K., Xia, G., Koide, H.B., Hodgson, J.G., Graham, K.C., Goldberg, Y.P., Gietz, R.D., Pickart, C.M. and Hayden, M.R. (1996) Huntingtin is ubiquitinated and interacts with a specific ubiquitin conjugating enzyme. J. Biol. Chem., 271, 19385–19394.
41 Seki, N., Muramatsu, M., Sugano, S., Suzuki, S., Nakagawara, A., Ohhira, M., Hayashi, A., Hori, T. and Saito, T. (1998) Cloning, expression analysis, and chromosomal localization of HIP1R, an isolog of huntingtin interacting protein (HIP1). J. Hum. Genet., 6, 2205–2212.
42 Engelender, S., Sharp, A.H., Colomer, V., Tokito, M.K., Lanahan, A., Worley, P., Holzbaur, E.L.F. and Ross, C.A. (1997) Huntingtin-associated protein 1 (HAP1) interacts with the p150Glued subunit of dynactin. Hum. Mol. Genet., 6, 2205–2212.
43 Li, S.-H., Gutekunst, C.-A., Hersch, S.M. and Li, X.-J. (1998) Interaction of huntingtin-associated protein with dynactin P15Glued. J. Neurosci., 18, 1261–1269.
44 Raths, S., Rohrer, J., Crausaz, F. and Riezman, H. (1993) end3 and end4: two mutants defective in receptor-mediated and fluid-phase endocytosis in Saccharomyces cerevisiae. J. Cell Biol., 120, 55–65.
45 Mulholland, J., Wesp, A., Riezman, H. and Botstein, D. (1997) Yeast actin cytoskeleton mutants accumulate a new class of golgi-derived secretory vesicle. Mol. Biol. Cell, 8, 1481–1499.[Abstract]
46 Givan, S.A. and Sprague Jr, G.F. (1997) The ankyrin repeat-containing protein Akr1p is required for the endocytosis of yeast pheromone receptors. Mol. Biol. Cell, 8, 1317–1327.[Abstract]
47 Hirst, J. and Robinson, M.S. (1998) Clathrin and adaptors. Biochim. Biophys. Acta, 1404, 173–193.[Medline]
48 Nguyen, J.T., Turck, C.W., Cohen, F.E., Zuckermann, R.N. and Lim, W.A. (1998) Exploiting the basis of proline recognition by SH3 and WW domains: design of N-substituted inhibitors. Science, 282, 2088–2092.
49 Humphries, R.K., Eaves, A.C. and Eaves, C.J. (1981) Self-renewal of hemato-poietic stem cells during mixed colony formation in vitro. Proc. Natl Acad. Sci. USA, 78, 3629–3633.
50 Lin, B., Nasir, J., MacDonald, H., Hutchinson, G.B., Graham, R.K., Rommens, J.M. and Hayden, M.R. (1994) Sequence of the murine Huntington disease gene: evidence for conservation, alternate splicing and polymorphism in a triplet (CCG) repeat. Hum. Mol. Genet., 3, 85–92.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  A. Goytain, R. M. Hines, and G. A. Quamme Huntingtin-interacting Proteins, HIP14 and HIP14L, Mediate Dual Functions, Palmitoyl Acyltransferase and Mg2+ Transport J. Biol. Chem., November 28, 2008; 283(48): 33365 - 33374. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Lumsden, T. L. Henshall, S. Dayan, M. T. Lardelli, and R. I. Richards Huntingtin-deficient zebrafish exhibit defects in iron utilization and development Hum. Mol. Genet., August 15, 2007; 16(16): 1905 - 1920. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Metzler, L. Gan, T. Pan Wong, L. Liu, J. Helm, L. Liu, J. Georgiou, Y. Wang, N. Bissada, K. Cheng, et al. NMDA Receptor Function and NMDA Receptor-Dependent Phosphorylation of Huntingtin Is Altered by the Endocytic Protein HIP1 J. Neurosci., February 28, 2007; 27(9): 2298 - 2308. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Van Raamsdonk, W. T. Gibson, J. Pearson, Z. Murphy, G. Lu, B. R. Leavitt, and M. R. Hayden Body weight is modulated by levels of full-length Huntingtin Hum. Mol. Genet., May 1, 2006; 15(9): 1513 - 1523. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. S. Rao, J. C. Chang, P. D. Kumar, I. Mizukami, G. M. Smithson, S. V. Bradley, A. F. Parlow, and T. S. Ross Huntingtin Interacting Protein 1 Is a Clathrin Coat Binding Protein Required for Differentiation of late Spermatogenic Progenitors Mol. Cell. Biol., November 15, 2001; 21(22): 7796 - 7806. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Hilditch-Maguire, F. Trettel, L. A. Passani, A. Auerbach, F. Persichetti, and M. E. MacDonald Huntingtin: an iron-regulated protein essential for normal nuclear and perinuclear organelles Hum. Mol. Genet., November 1, 2000; 9(19): 2789 - 2797. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||