Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (72)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kamiya, M.
Right arrow Articles by Hayashizaki, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kamiya, M.
Right arrow Articles by Hayashizaki, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2000, Vol. 9, No. 3 453-460
© 2000 Oxford University Press

The cell cycle control gene ZAC/PLAGL1 is imprinted—a strong candidate gene for transient neonatal diabetes

Mamoru Kamiya1,2, Hannah Judson3, Yasushi Okazaki1, Moriaki Kusakabe1, Masami Muramatsu1, Shuji Takada1,4, Nobuo Takagi4, Takahiro Arima1,5, Norio Wake5, Katsunori Kamimura6, Kenichi Satomura7, Robert Hermann8, David T. Bonthron3 and Yoshihide Hayashizaki1,2,+

1CREST, Japan Science and Technology Corporation (JST), Genome Exploration Research Group, Genomic Sciences Center (GSC), Genome Science Laboratory and Biogenetic Research Center, Riken Tsukuba Life Science Center, the Institute of Physical and Chemical Research (RIKEN), Ibaraki 305-0074, Japan, 2Institute of Basic Medical Sciences, University of Tsukuba, Ibaraki 305-0006, Japan, 3Molecular Medicine Unit, University of Leeds, Leeds LS9 7TF, UK, 4Graduate School of Environmental Earth Science, Hokkaido University, Hokkaido 060-0808, Japan, 5Department of Reproductive Physiology and Endocrinology, Medical Institute of Bioregulation, Kyushu University, Oita 874-0838, Japan, 6Department of Pediatrics, Kobe City General Hospital, Kobe 650-0046, Japan, 7Department of Pediatrics, Osaka Medical Center and Research Institute for Maternal and Child Health, Osaka 594-1101, Japan, 8Department of Pediatrics, University Medical School of Pécs, Pécs 7623, Hungary

Received 15 November 1999; Revised and Accepted 7 December 1999.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We describe a screen for new imprinted human genes, and the identification in this way of ZAC (zinc finger protein which regulates apoptosis and cell cycle arrest)/PLAGL1 (pleomorphic adenoma of the salivary gland gene like 1) as a strong candidate gene for transient neonatal diabetes mellitus (TNDM). To screen for imprinted genes, we compared parthenogenetic DNA from the chimeric patient FD and androgenetic DNA from hydatidiform mole, using restriction landmark genome scanning for methylation. This resulted in identification of two novel imprinted loci, one of which (NV149) we mapped to the TNDM region of 6q24. From analysis of the corresponding genomic region, it was determined that NV149 lies ~60 kb upstream of the ZAC/PLAGL1 gene. RT–PCR analysis was used to confirm that this ZAC/PLAGL1 is expressed only from the paternal allele in a variety of tissues. TNDM is known to result from upregulation of a paternally expressed gene on chromosome 6q24. The paternal expression, map position and known biological properties of ZAC/PLAGL1 make it highly likely that it is the TNDM gene. In particular, ZAC/PLAGL1 is a transcriptional regulator of the type 1 receptor for pituitary adenylate cyclase-activating polypeptide, which is the most potent known insulin secretagog and an important mediator of autocrine control of insulin secretion in the pancreatic islet.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Genomic imprinting refers to differential contributions from the two parental genomes, especially in the development and/or differentiation of the mammalian embryo. Its existence was originally demonstrated by nuclear transplantation experiments (1,2). The non-equivalence of the parental genomes has been explained by the differential expression of genes from one or other allele (1,3). Approximately 35 mouse (4) and 40 human genes regulated by imprinting have been reported, many of which, however, have not been fully characterized (5). It has become clear that imprinting is involved in a number of human genetic disorders, such as Beckwith–Wiedemann syndrome, Wilms’ tumor, Prader–Willi syndrome and Angelman syndrome (5). One approach to identifying the genes involved in imprinted diseases is to screen systematically for and map imprinted loci. Strong candidate genes may be more readily identified through this approach than through traditional positional cloning, because such candidate genes will by definition satisfy both criteria of correct chromosomal location and imprinted expression pattern.

In order to achieve this goal, systematic screening for human imprinted genes is required. Several methods for systematically searching for imprinted genes within the mouse genome have been reported (6). The methylation-based screening method, restriction landmark genomic scanning with methylation-sensitive restriction endonuclease (RLGS-M), was developed by our group (7). The mouse strategy relies on comparing the polymorphic RLGS-M patterns derived from reciprocal crosses between inbred parental strains. Another approach is to rely on differential mRNA expression; differential display or subtraction cloning using mRNA from parthenogenetic and androgenetic embryos is therefore also a successful method for identifying imprinted genes (6).

In contrast, screening for human imprinted genes has several technical and ethical limitations in terms of the availability of the samples. RLGS-M relies on polymorphic differences between inbred strains. The required reciprocal crosses are not available in humans. As far as expression cloning is concerned, both the differential display and subtractive cDNA cloning approaches require uniparental RNA samples prepared by embryo manipulation, and therefore again are not applicable to human material. Furthermore, those human genes which are orthologs of mouse imprinted genes are not always imprinted (8). Thus, a new method for the screening for human imprinted genes is required, which relies neither on inheritance of DNA polymorphisms nor on the study of the human orthologs of mouse imprinted genes.

One reagent which has proven valuable in systematic screening for human imprinted genes is DNA from the parthenogenetic chimera FD. This was the first reported patient with chimerism between normal (biparental) and parthenogenetic cells (9). The leukocytes, in particular, were found to be 100% parthenogenetic. For comparison with the FD sample, complete hydatidiform mole is also useful; this tumor is derived from androgenetic extra­embryonic tissue (10). An mRNA-based comparison between these two tissues is not appropriate, since: (i) the amount of the available material from the patient is limited; and (ii) only a limited number of genes are expressed in these specific tissues. On the other hand, DNA methylation appears to be an invariable accompaniment to genomic imprinting, and a screening system based on methylation is therefore attractive, and not restricted to the subset of genes expressed in any one tissue. We have therefore analyzed DNAs from the above-mentioned human uniparental sources by RLGS-M. This method employs 32P-end-labeling of rare-cutting restriction sites in genomic DNA, followed by high resolution two-dimensional electrophoresis separation of the fragments (11). It permits analysis of >2500 loci on one autoradiograph. It also preferentially targets transcription units because of its dependence on cleavage at rare CpG-containing sites. In addition, RLGS-M is dosage-sensitive, and can distinguish haploid and diploid intensity of single-copy genes. This important property confers the ability to screen for imprinted genes by comparing spot intensity in parthenogenetic and androgenetic DNA, without having to rely on polymorphisms to distinguish the parental alleles.

Transient neonatal diabetes mellitus (TNDM) is one genetic disease that shows an imprinting effect; it appears to result from upregulation of a paternally expressed gene in 6q24, since this phenotype can result from paternal uniparental disomy of chromosome 6 and from duplications of this chromosomal region (1214). TNDM patients have insulin-dependent diabetes lasting for the first few months of life. In many cases, the diabetes subsequently returns permanently in mid-childhood. In this paper, we report the results of a methylation-based RLGS screen for human imprinted genes, using parthenogenetic and androgenetic DNAs, and the principle that differential methylation ‘tags’ an imprinted locus (7,15). In this screen, we identified two imprinted genes: GNAS1, located on human chromosome 20q13.2 (16), and, as reported here, ZAC (zinc finger protein which regulates apoptosis and cell cycle arrest). ZAC is known to be capable of inducing G1 cell-cycle arrest and apoptosis, and to be a transcriptional regulator of the type 1 receptor for the pituitary adenylate cyclase activating peptide (PACAP1-R) (17,18). PACAP is an important intra-islet regulator of insulin secretion (19,20), and this, together with the finding that the imprinted ZAC gene maps to the TNDM region of 6q24, makes ZAC a compelling TNDM candidate gene.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
RLGS-M screening for imprinted genes using FD and hydatidiform mole DNA
RLGS is a multiplex genome scanning system allowing visualization of >2500 spots/loci, based on the principle that restriction enzyme sites can be used as landmarks. The technology employs direct labeling of genomic DNA and high resolution two-dimensional DNA electrophoresis (11,21). The use of methylation-sensitive enzymes enables detection of the methylation status of the restriction landmark (22). A methylated landmark is not cleaved by the landmark enzyme and yields no spot signals whereas, if the landmark is unmethylated, the cleaved end of the restriction fragment is labeled to produce spot signals. Haploid and diploid copy number of the unmethylated restriction landmark give half and full intensity of the autoradiographic spots, respectively (23).

In higher organisms, the 5' position of cytosine residues is the only site for DNA methylation, the bulk of which occurs at the dinucleotide CpG. The total number of ‘CpG islands’, often located upstream of genes, is estimated to be ~30 000 (24). Methylation of cytosines within a CpG island often reflects transcriptional silencing of the gene (22). Rare cutting restriction enzymes with GC-rich recognition sites cleave preferentially within CpG islands. For example, 90% of total NotI sites (GCGGCCGC) are located in CpG islands, which in turn implies that 90% of RLGS spots produced using NotI have the potential to reflect the transcriptional status of a CpG island-associated gene (7,11).

Leukocytes from the patient FD are 100% parthenogenetic and isodisomic (9). Conversely, complete hydatidiform mole is derived from androgenetic extraembryonic tissue (25). Although in previous applications of RLGS (7,15,26), the segregation of polymorphic spots was used to provide information about linkage or imprinting, a comparison between parthenogenetic and androgenetic materials allows the use of all non-polymorphic spots, providing a very powerful screening tool.

The enzyme combinations of NotI–PvuII–PstI, NotI–PstI–PvuII and AscI–EcoRV–MboI were used for the screening. Because of the uniform isodisomy of all 23 chromosome pairs, the spot intensities on RLGS-M of FD blood DNA are very uniform (Fig. 1a). The spot intensities of androgenetic tissue from hydatidiform mole were not as uniform, due to the additional methylation changes occurring during tumorigenesis (data not shown). A schematic figure of the strategy used to identify imprinted spots/loci is shown in Figure 1b. In this figure, loci A and C are maternally and paternally methylated, respectively, whereas B is a non-imprinted locus, unmethylated on both alleles. Since FD leucocytes have two maternally inherited alleles, maternally methylated locus A is not cleaved with NotI, resulting in the disappearance of the corresponding spot (Fig. 1b, FD). On the other hand, this spot shows diploid intensity in the complete mole (Fig. 1b, mole), corresponding to the presence only of unmethylated paternal alleles. In the normal biparental DNA, such a spot shows half intensity (Fig. 1b, normal). Conversely, the spot representing a paternally methylated locus C shows diploid, haploid and null intensity in RLGS-M profiles of FD, normal and mole, respectively.



View larger version (72K):
[in this window]
[in a new window]
 
Figure 1. The two-dimensional profile of restriction landmark genomic scanning using methylation-sensitive restriction endonuclease (RLGS-M). (a) RLGS-M profile of FD blood DNA produced by the enzyme combination of NotI–PstI–PvuII. The arrow indicates the imprinted spot, NV149. (b) The principle of screening for imprinted spots. Spots A and C represent maternally and paternally methylated imprinted loci, respectively. Spot B is from a normal unmethylated locus. The imprinted spots show half intensity (haploid; open circle) and the non-imprinted unmethylated spot shows full intensity (diploid; closed circle). The maternally methylated spot (A) disappears in the parthenogenetic sample, FD, but this spot shows diploid intensity in androgenetic hydatidiform mole. Conversely, a spot which is paternally methylated appears in parthenogenetic DNA, and is absent from androgenetic DNA. (c) Close-up of RLGS-M profiles of NV149 and A20. The A20 RLGS-M profiles were produced by enzyme combination AscI–EcoRV–MboI. Since these two spots were both maternally methylated, their intensities were zero, half and full in FD, normal and mole, respectively.

 
Using these criteria, two spots named NV149 and A20 were identified as candidate imprinted loci. These are shown in Figure 1c. NV149 was detected using the enzyme combination of NotI–PstI–PvuII and A20 using AscI–EcoRV–MboI (Table 1). These two spots were excised from the gel and cloned. The results of subsequent analysis of A20, which is located upstream of the imprinted GNAS1 locus, have been previously reported (16). In this paper, we focus on the further analysis of the NV149 clone.


View this table:
[in this window]
[in a new window]
 
Table 1. RLGS-M spots and related diseases
 
Maternal allele-specific methylation of the NV149 locus
The methylation status of NV149 locus was analyzed using Southern blotting and sequencing (Fig. 2). The methylation status of the NotI, BssHII and SmaI sites, located within the DNA fragment of the NV149 spot clone (Fig. 3a), was analyzed by Southern blotting (Fig. 2a). Genomic DNA digested by PvuII yields a 1.18 kb band (Fig. 2a, lane 1). About half of the molecules of this fragment were cleaved by each of the three methylation-sensitive restriction enzymes, confirming the likelihood of monoallelic methylation. To confirm the parental specificity of this mono­allelic methylation (i.e. imprinted methylation), PCR direct sequencing was performed using DNA from a normal individual and his parent. In this assay (Fig. 2b), a DNA fragment spanning both the NotI site and a nearby single-nucleotide polymorphism was amplified, using primers NV149um1 and NV149l1 (Fig. 3a). The NV149u1 primer was used for sequencing (Fig. 3a). The paternal (A) and maternal (G) alleles at nucleotide 167 can be identified from the genotypes of the homozygous parents. Their progeny showed a heterozygous pattern of A/G (Fig. 3c). However, NotI digestion of the genomic DNA prior to PCR amplification eliminated the sequence signal from the paternal A allele. These data indicate that only the maternal allele is methylated, and that the methylation pattern of the genomic DNA at NV149 is imprinted in the manner predicted from the RLGS screen.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 2. Imprinted methylation of genomic DNA in the NV149 locus. (a) Southern hybridization using NV149 clone as a probe. NotI, BssHII and SmaI were used to test the monoallelic methylation in this region. Normal placental DNA was digested with PvuII (lane 1), PvuII and NotI (lane 2), PvuII and BssHII (lane 3) or PvuII and SmaI (lane 4). Note that half of the PvuII fragments were cleaved by each methylation sensitive enzyme, indicating the monoallelic methylation of these sites. (b) PCR direct sequencing analysis of methylation imprinting. The genomic DNAs were amplified with primers, NV149um1 and NV149l1, after treatment with (+) or without (–) NotI. PCR products were sequenced with the primer, NV149u1. The arrow indicates the polymorphic (G/A) site. Only the maternally derived G allele was amplified after NotI digestion.

 


View larger version (34K):
[in this window]
[in a new window]
 
Figure 3. Restriction enzyme and contig map around NV149. (a) Restriction enzyme map for NotI, BssHII, SmaI and PvuII. The open box indicates the region covered by the spot clone. This clone was used for the Southern hybridization analysis in Figure 2. Numerals in parentheses refer to position relative to the NV149 NotI site. (b) PAC contig map. This is derived from the results of the chromosome 6 sequencing project (http://www.sanger.ac.uk/HGP/Chr6 ). (c) ZAC/PLAGL1 gene structure. Three alternative forms of this gene, ZAC, PLAGL1 and LOT1, were reported. ZAC consists of 3 exons (hatched area), named Exon1(ZAC), Exon2(ZAC) and Exon3(ZAC). The PLAGL1 transcript also consists of 3 exons (gray area), Exon1(PLAGL1), Exon2(PLAGL1) and Exon3(ZAC). Exon2(PLAGL1) lies within the 3' part of Exon1(ZAC), sharing the same intron donor site. The acceptor site of Exon2(PLAGL1) is thus located inside Exon1(ZAC). LOT1 is a chimeric clone (see text). (d) Exon structure and primers used in this study. Nucleotide positions refer to the ZAC cDNA sequence, AJ006354. Polymorphisms used for analysis of imprinted expression are indicated by arrowheads. Horizontal arrows represent primers. The size of fragments generated by AvaII digestion for analysis of the nucleotide 1029 polymorphism are indicated.

 
NV149 maps to chromosome 6q24
As the next step, the spot clone NV149 was mapped using a radiation hybrid panel and a gridded CEPH megaYAC library to human chromosome 6q24 (data not shown). Further analysis and library screening showed that NV149 lies within PAC contig Chr_6ctg224 (http://webace.sanger.ac.uk/HGP/Chr6 ), as shown in Figure 3. In particular, PAC clone dJ340H11 (GenBank accession no. AL109755) contains the NV149 spot clone sequence. PAC dJ340H11 also contains the whole of the gene encoding the C2H2-type zinc finger protein, ZAC. ZAC was originally reported as a human gene orthologous to mouse ZacI, which is a regulator of the type 1 receptor for PACAP and also an inducer of apoptosis and cell cycle arrest (17). PACAP is also known as an islet neuropeptide involved in the autocrine stimulation of insulin secretion (19,20).

ZAC/PLAGL1 expression profile
Three variants of the human ZAC/PLAGL1 transcripts have been reported, named ZAC (27), PLAGL1 (28) and LOT1 (lost on transformation 1) (29). The genomic structure of the ZAC/PLAGL1 region is shown in Figure 3c. From further analysis, we concluded that two alternative promoters, of ZAC and PLAGL1, are located in this region, but that LOT1 is a chimerism artifact. The 5'-untranslated region (5'-UTR) of LOT1 is not present in PAC contig Chr_6ctg224, and on radiation hybrid (RH) mapping analysis was found to be on chromosome 3. This LOT1 5'-UTR sequence also completely matches part of the sequence of clone RPCI4-736H12 (GenBank accession no. AC006060) which again has been mapped to chromosome 3. We therefore conclude that the LOT1 gene is a chimeric clone, carrying sequences derived from chromosome 3 and from the ZAC coding region on chromosome 6. We therefore excluded LOT1 from further analysis. PLAGL1 was identified by sequence similarity to PLAG (pleomorphic adenoma of the salivary gland gene) which is transcriptionally activated in these salivary gland tumors as a result of promoter swapping caused by the chromosome translocation, t(3;8)(p21;q12) (30). As shown in Figure 3c, PLAGL1 and ZAC have different 5' ends, but utilize common downstream exons.

To test the imprinted expression of ZAC, we identified polymorphisms within the ZAC exons. The first is a G/T substitution located at nucleotide 219 (ZAC exon 1). Direct sequencing across this site was performed on genomic PCR products and RT–PCR products derived from placental mRNA. The results are shown in Figure 4a. Maternal DNA has G at this position, whereas the father is a G/T heterozygote. Their daughter is also heterozygous. Her placental RT–PCR product was derived exclusively from the paternal T allele, showing that the expression of ZAC is monoallelic and paternal. Using a further G/T polymorphism at nucleotide 875, expression was subsequently examined in other tissues. Only 4 of 53 human fetuses were heterozygous at nucleotide 875. Monoallelic expression was seen in fetal heart, kidney, muscle, cord, adrenal gland and lung. However, ZAC is unfortunately biallelically expressed in white blood cells, precluding the analysis of TNDM patients’ blood for evidence of relaxation of imprinting.



View larger version (60K):
[in this window]
[in a new window]
 
Figure 4. Imprinted expression of ZAC/PLAGL1. (a) RT–PCR and genomic PCR products were sequenced with primer, PLAGL1ex1bf2. Amplification was carried out with primer pairs PLAGL1ex1bf2 + PLAGL1ex2r2 for RT–PCR or PLAGL1ex1bf2 + PLAGL1ex1br1 for genomic PCR. Arrows indicate the polymorphic base. Only the paternally inherited allele (T) could be detected in the RT–PCR product. (b) Using the nucleotide 1029 polymorphism, monoallelic expression of mixed PLAGL1- and ZAC-type transcripts was examined in placentae (lanes 1g, 1r, 2g and 2r). Amplification was carried out with primer pairs, PLAGL1ex1b+2f1 and PLAGL1ex2r2 for RT-PCR, or PLAGL1ex2f1 and PLAGL1ex2r2 for genomic PCR. g and r represent genomic and cDNA-derived products, respectively. When the polymorphic base was G, it created an AvaII site which fragmented the 148 bp band to 103 and 45 bp. Two individuals show a clear monoallelic expression pattern.

 
Both of the above polymorphisms lie within the ZAC-specific portion of ZAC exon 1, and are not found within the PLAGL1 splice form. In order to examine PLAGL1 expression, another polymorphism (C/G) in exon 2 (at nucleotide 1029 of ZAC) was employed. This polymorphism is detectable by restriction digestion with AvaII, which cuts the G allele (GGWCC), but not the C allele (GCWCC). RT–PCR primers PLAGL1ex1b+2f and PLAG1ex2r2 were designed to flank this polymorphism and be cDNA specific. They generate a 304 bp cDNA-specific product from both ZAC1 and PLAGL1 mRNA species. AvaII digestion products are 148, 130 and 26 bp for a nucleotide 1029 C allele, the G allele splitting the 148 bp fragment into 103 and 45 bp. For PCR on genomic DNA, the alternative upstream primer PLAGL1ex2f1 was used, yielding a 90 bp band in place of the 26 bp cDNA-specific band. The result, using placental mRNA and DNA from two individuals, is shown in Figure 4b. Both individuals’ DNA is heterozygous at nucleotide 1029 (103 + 45 bp from the C allele and 148 bp from the G allele). Individual 1 is Cmat/Gpat and individual 2 Gmat/Cpat (data not shown). The RT–PCR product was derived exclusively from the paternal allele in both individuals (Fig. 4b, lanes 1r and 2r). Since this product represents a mixture of PLAGL1 and ZAC transcripts, it suggests that, at least in placenta, both the ZAC and PLAG1 promoters are active only on a paternal allele.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ZAC/PLAGL1 is a strong candidate gene for TNDM
As described above, ZAC/PLAGL1 is located at 6q24, in the same chromosomal region as the imprinted TNDM locus (Fig. 5) (14). TNDM was mapped to an 18.72 cR region between D6S1699 and D6S1010. The distal flanking marker, D6S1010, was defined by the extent of the region trisomic in an insertional translocation case [46XX, der(2) ins(2;6)(2pter-2p22.2::6q?22.32–?6q?23.1::2p22.2–2qter)]. The proximal flanking marker, D6S1699, was defined by linkage analysis in a family with inherited TNDM. The TNDM candidate interval between D6S1699 and D6S1010 is 18.72 cR, equivalent to <5.4 Mb. ZAC/PLAGL1, in comparison, maps 12.05 cR distal to D6S1699 and 5.17 cR proximal to D6S1010, clearly within the TNDM critical region.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. Radiation hybrid map around the ZAC/PLAGL1 region. The Sanger Centre map constructed from the GeneBridge4 radiation hybrid panel is cited in this Figure (http://webace.sanger.ac.uk, SANGER_chrom6_rhmap_03_11_98 ).

 
Physiological role of ZAC/PLAGL1
A number of functional properties of ZAC/PLAGL1 have been demonstrated recently (17,18,2729,31). ZAC, PLAGL1 and LOT1 share coding sequences with a zinc finger motif (2729) but have different 5' ends (see above). Using differential display, LOT1 was originally identified as a gene whose expression is lost on transformation in ovarian cancer, suggesting a tumor suppressor function. Such a function is supported by the fact that ZAC has similar activities to p53 in inducing cell cycle arrest and apoptosis, in LLC-PK1 kidney epithelial and SaOs-2 osteosarcoma cells (17).

However, ZAC was originally identified through its ability to induce expression of the gene for the type 1 receptor for PACAP (17,18). Initially, ZacI, the mouse ortholog of ZAC, was isolated in an expression cloning experiment that also identified the PACAP1-R itself and p53 (17). Importantly, it has been recognized for some time that PACAP is produced by pancreatic neural cells and is an extraordinarily potent autocrine regulator of glucose-stimulated insulin release (19,20). This immediately suggests that ZAC may be involved in the pathogenesis of TNDM, as a result of its effects on PACAP1-R expression in the islet, and quite possibly also as a mediator of ß-cell apoptosis (recalling that most TNDM patients eventually develop permanent diabetes).

More recently, Maebayashi et al. found that ZAC/PLAGL1 is expressed at a very high level in the suprachiasmatic nucleus (SCN) during the early postnatal days (32). In mammals, the SCN is a central circadian pacemaker that regulates numerous behavioral and physiological rhythms. The similarity between the time course of the ZAC/PLAGL1 expression and that of TNDM provide further support for the hypothesis that ZAC/PLAGL1 is responsible for TNDM.

Genetic analysis of TNDM and its causative mechanism
In TNDM patients, several genetic abnormalities have been described: paternal uniparental disomy (UPD) of 6q24, segmental trisomy of 6q24, dominant inheritance with a normal karyotype, as well as cases with no known genetic abnormality (14). The UPD6 cases suggest either a loss of function from a maternally expressed gene or increased expression of a paternally expressed one. The former possibility is excluded by the existence of patients with TNDM due to paternal duplication (partial trisomy) of 6q24. The cause of TNDM is therefore likely to be over-expression of a paternally expressed imprinted gene.

For TNDM cases with normal karyotypes, therefore, the following are possible pathogenetic mechanisms: (i) upregulation of the causative gene, possibly due to biallelic expression in place of monoallelic (‘imprinting mutation’); (ii) a coding region mutation which activates protein function; (iii) sub­microscopic reduplication of paternal 6q24 resulting in two expressed copies of the gene.

We examined the eight TNDM patients including two patients with uniparental paternal disomy (one Hungarian and the other Japanese) and six patients with a normal biparental chromosome complement. We first sequenced ZAC/PLAGL1 in all patients. No mutation in coding region nor in the 5'-UTR and putative promoter region was found. Because the methylation status of the NV149 region was expected to indicate the expression status of ZAC/PLAGL1, blood DNA from the patients were investigated using sodium bisulfite deamination (Fig. 6). This converts unmethylated C to U, but leaves 5-methylC unconverted. After PCR amplification of bisulphite-treated DNA, an original CC*GA sequence (C* is methylated C) at nucleotide 133 is altered to TCGA (TaqI site), whereas CCGA (unmethylated) is converted to TTGA. A 152 bp fragment was PCR-amplified from bisulphite-treated patient DNA and assayed with TaqI. In Figure 6, lanes 3 and J3, patients 3 (33) and J3 who are the Hungarian and Japanese paternal UPD6 cases, respectively, show, as expected, an unmethylated pattern of both alleles.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. Methylation status of TNDM patients. (a) Schematic representation of sodium bisulfite conversion of methylated and unmethylated sequences. PCR amplification with primers NV149BSSu2 and NV149BSSl2 generates a 152 bp product. A new TaqI site is generated at nucleotide –133 (Fig. 3) only if the original template was methylated. (b) The DNA identification numbers follow the report by Hermann et al. (33). J1, J2 and J3 indicate Japanese patients. Patients 3 and J3, who are the cases with paternal uniparental disomy of chromosome 6 (UPD6), show only an unmethylated pattern, whereas the other patients exhibit normal methylation profiles. Both paternal alleles in UPD6 retain their imprinted demethylated status, whereas the differential methylation of maternal and paternal NV149 alleles is also retained in the TNDM patients with biparental origin of chromosome 6.

 
The methylation profiles of the TNDM patients with normal biparental DNA (Fig. 6, lanes 2, 4, 5, 6, J1 and J2) showed monoallelic methylation patterns. This indicates that maternal imprinting is not erased in these patients, and consequently lends no additional support to implicate ZAC in TNDM. Unfortunately, the expression of ZAC/PLAGL1 in white blood cells is at very low level, and upregulation could not be reliably demonstrated. Definitive proof that ZAC is the TNDM gene may have to await the availability of other pathological material from TNDM patients, so that experiments can be performed to search for a switch from monoallelic to biallelic expression. None the less, the collective data strongly suggest ZAC/PLAGL1 as a candidate gene for TNDM.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Human parthenogenetic chimera and androgenetic mole samples
Blood samples were obtained from patient FD and age-matched, normal Scottish females. The complete hydatidiform mole and normal placental villi was prepared as described by Arima et al. (34). DNA was extracted according to an established method (35).

RLGS-M
RLGS was originally reported by our group (21). The protocol for RLGS in this experiment was described elsewhere (11). RLGS-M was performed as described by Kawai et al. (22). In brief, genomic DNA was blocked by nucleotide analogs (dGTP{alpha}S, dCTP{alpha}S, ddATP and ddTTP) with DNA polymerase I to reduce background. The DNA was digested with a methylation-sensitive restriction enzyme and then 5'-protuding ends were labeled in a fill-in reaction. The second digestion was carried out with a 6 bp recognizing restriction enzyme. The labeled and size-reduced DNA samples were electrophoresed through a 0.8% agarose tube gel (first-dimension separation). These samples were treated with a third restriction enzyme. In-gel samples were subjected to second- dimension 5% polyacrylamide gel electrophoresis. The gel was dried and autoradiographed. In this study, the restriction enzyme combinations AscI–EcoRV–MboI and NotI–PstI–PvuII were used. The genomic DNA fragment corresponding to an RLGS-M spot was cloned according to a previously described protocol (11).

RH mapping
The GeneBridge 4 Radiation Hybrid Mapping Panel was purchased from Research Genetics (Huntsville, AL). Amplification was carried out with primers, NV149v2u1 (GCGAGGAGGGTGTGCCTTTG) and NV149v2l1 (GGCCCGTTGGCGAGGTTAGAG), under the following conditions: denaturation at 94°C for 2 min and 30 cycles of 96°C for 30 s, 60°C for 30 s and 72°C for 1 min. PCR products were electrophoresed in 3% agarose gel. The Sanger Centre 1998 GENE MAP SERVER for the GB4 panel (http://www.sanger.ac.uk/RHserver/RHserver.shtml ) was used for calculation of the map position.

Methylation analysis of the NV149 NotI site
Genomic DNAs (10 µg) from placentae and peripheral blood lymphocytes were separated into two aliquots which were subsequently treated with or without methylation-sensitive enzymes NotI, BssHII or SmaI. Both aliquots were then amplified with primers NV149v2um1 (ACGGCATCTGCCATTTGTCA) and NV149v2l1. PCR conditions were the same as for RH mapping. PCR products were sequenced using primer NV149v2u1. Big-Dye terminator reaction chemistry with an ABI 377 DNA sequencer was used. For Southern blotting, 5 µg of digested DNAs were treated with PvuII and electrophoresed in a 1% agarose gel. According to standard protocols, DNAs were transferred to nylon membrane and were hybridized with a probe of NV149 spot clone, labeled by random priming.

Imprinted or monoallelic expression of ZAC/PLAGL1
Monoallelic expression of ZAC/PLAGL1, was investigated in three ways. First, RT–PCR direct sequencing was carried out in a Japanese family, heterozygous at nucleotide 219 (nucleotide positions refer to the published ZAC cDNA sequence, AJ006354). RNA (3 µg) from placenta was reverse transcribed using oligo-d(T)18 and SuperScriptII (Stratagene, La Jolla, CA) according to the manufacturer’s protocol. As a PCR reaction template 1/50 of the reaction mixture was used with primers, PLAGL1ex1bf2 (AACGTTAATAAATCACTTAGGCGAGA) and PLAGL1ex2r2 (CTGA- CCAAATGCTGTGCCAT). As a reference, genomic DNAs were amplified with primers PLAGL1ex1bf2 and PLAGL1ex1br1 (ACCTCCAGCATGTTCTTGCC). RT–PCR and genomic PCR products were sequenced with primer PLAGL1ex1bf2.

Second, using three independent first-trimester fetuses (AC, HM and JC) heterozygous at nucleotide 875, six tissues (heart, kidney, muscle, cord, adrenal and lung) were analyzed. Using mismatched primer, ZAC-RT5' (GGAATGTTTTCCTAGCTTCATTCCCGTAC) and downstream primer, ZAC-RT3'(2) (GGACCTCTCAGCTGTCACTAGCT), PCR on the RT product generated a 205 bp product. Digestion with BsiWI produced bands of 205 bp if the polymorphic base was T (uncut), or 176 bp if the polymorphic base was G.

Third, PCR–RFLP was carried out using a polymorphism at nucleotide 1029. cDNAs from whole blood cells and placentae were subjected to PCR amplification with primers, PLAGL1ex1bf1 (TCAACCTTCTTGCACTGCAAA) and PLAGL1ex2+3r1 (AT- GGGTAGCCATATGCCTCA). PCR conditions were 2 min at 94°C, followed by 25 cycles (96°C, 60°C and 72°C for 30 s, 30 s and 1 min, respectively). PCR products (1/20) were further amplified using nested primers, PLAGL1ex1b+2f1 (CCTGTCACTCAGTAGCCAA) and PLAGL1ex2r2, by 20 cycles under the same conditions. Reference genomic DNAs were amplified with primers, PLAGL1ex2f1 (TGATTCTGAAGCGGTCAGGG) and PLAGL1ex2r2. These PCR products were digested with AvaII and electrophoresed through 6% polyacrylamide gels. Digestion with AvaII gave bands of size 148 bp if the polymorphic base was C, and 103 and 45 bp if it was G.

Methylation status of NV149 in TNDM patients
Unmethylated cytosine was converted to uracil by sodium bisulfite using a standard protocol (36). Briefly, 0.5 µg of PvuII-treated DNA was incubated at 37°C for 10 min in 56 µl of 0.2 M NaOH. Thirty microliters of 10 mM hydroquinone and 520 µl of 3.6 M sodium bisulfite (final concentration 3.1 M) were added. These samples were incubated at 55°C for 16 h, followed by desalting with Geneclean (Bio101, Carlsbad, CA) and dissolved in 50 µl distilled water. After addition of 5.5 µl of 3 M NaOH and incubation at room temperature for 5 min, samples were ethanol precipitated and dissolved in 10 µl of TE (10 mM Tris–HCl, 0.1 mM EDTA pH 8). One microliter was used as PCR template for amplification with primers, NV149BSSu2 (GGGGTAGTYGTGTTTATAGTTTAGTA) and NV149BSSl2 (CRAACACCCAAACACCTACCCTA), under the following conditions: denaturation at 94°C for 2 min and 35 cycles of 96°C for 20 s, 60°C for 30 s and 72°C for 1 min. PCR products were digested with TaqI and electrophoresed on a 6% polyacrylamide gel. The original sequence CCGA 133 bp upstream from the NotI site was converted to UCGA, if the C in the CpG dinucleotide was methylated, or UUGA, if it was unmethylated. The 152 bp PCR product is digested by TaqI to 91 and 61 bp products if derived from a methylated allele.


    ACKNOWLEDGEMENTS
 
We thank Verne M. Chapman (since deceased) and Gary Chapman for their technical assistance and advice. This study has been supported by Special Coordination Funds and a Research Grant for the RIKEN Genome Exploration Research Project and CREST (Core Research for Evolutional Science and Technology) of Japan Science and Technology Corp. (JST), both of which are funded by the Science Technology Agency in Japanese Government (Y.H.). This work was also supported by a Grant-in-Aid for Scientific Research on Priority Areas and Human Genome Program, from the Ministry of Education, Science and Culture, and by a Grant-in-Aid for a Second Term Comprehensive 10-Year Strategy for Cancer Control from the Ministry of Health and Welfare (Y.H.). H.J. is an MRC PhD student.


    FOOTNOTES
 
+ To whom correspondence should be addressed. Tel: +81 298 36 9145; Fax: +81 298 36 9098; Email: yosihide@rtc.riken.go.jp Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Surani, M.A., Barton, S.C. and Norris, M.L. (1984) Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis. Nature, 308, 548–550.[Medline]

2 McGrath, J. and Solter, D. (1984) Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell, 37, 179–183.[Web of Science][Medline]

3 Cattanach, B.M. and Kirk, M. (1985) Differential activity of maternally and paternally derived chromosome regions in mice. Nature, 315, 496–498.[Medline]

4 Beechey, C.V., Cattanach, B.M. and Selley, R.L. (1999) Mouse imprinting data and references. MRC Mammalian Genetics Unit, Harwell, Oxfordshire, UK, World Wide Web Site (http://www.mgu.har.mrc.ac.uk/imprinting/implink.html ).

5 Morison, I.M. and Reeve, A.E. (1998) A catalogue of imprinted genes and parent-of-origin effects in humans and animals. Hum. Mol. Genet., 7, 1599–1609.[Abstract/Free Full Text]

6 Kelsey, G. and Reik, W. (1998) Analysis and identification of imprinted genes. Methods, 14, 211–234.[Web of Science][Medline]

7 Hayashizaki, Y., Shibata, H., Hirotsune, S., Sugino, H., Okazaki, Y., Sasaki, N., Hirose, K., Imoto, H., Okuizumi, H., Muramatsu, M. et al. (1994) Identification of an imprinted U2af binding protein related sequence on mouse chromosome 11 using the RLGS method. Nature Genet., 6, 33–40.[Web of Science][Medline]

8 Pearsall, R.S., Shibata, H., Brozowska, A., Yoshino, K., Okuda, K., deJong, P.J., Plass, C., Chapman, V.M., Hayashizaki, Y. and Held, W.A. (1996) Absence of imprinting in U2AFBPL, a human homologue of the imprinted mouse gene U2afbp-rs. Biochem. Biophys. Res. Commun., 222, 171–177.[Web of Science][Medline]

9 Strain, L., Warner, J.P., Johnston, T. and Bonthron, D.T. (1995) A human parthenogenetic chimaera. Nature Genet., 11, 164–169.[Web of Science][Medline]

10 Kajii, T. and Ohama, K. (1977) Androgenetic origin of hydatidiform mole. Nature, 268, 633–634.[Medline]

11 Hayashizaki, Y. and Watanabe, S. (eds) (1997) Restriction Landmark Genomic Scanning (RLGS). Springer-Verlag, Tokyo, Japan.

12 Temple, I.K., Gardner, R.J., Robinson, D.O., Kibirige, M.S., Ferguson, A.W., Baum, J.D., Barber, J.C., James, R.S. and Shield, J.P (1996) Further evidence for an imprinted gene for neonatal diabetes localised to chromosome 6q22–q23. Hum. Mol. Genet., 5, 1117–1121.[Abstract/Free Full Text]

13 Abramowicz, M.J., Andrien, M., Dupont, E., Dorchy, H., Parma, J., Duprez, L., Ledley, F.D., Courtens, W. and Vamos, E. (1994) Isodisomy of chromosome 6 in a newborn with methylmalonic acidemia and agenesis of pancreatic beta cells causing diabetes mellitus. J. Clin. Invest., 94, 418–421.

14 Gardner, R.J., Mungall, A.J., Dunham, I., Barber, J.C., Shield, J.P., Temple, I.K. and Robinson, D.O. (1999) Localisation of a gene for transient neonatal diabetes mellitus to an 18.72 cR3000 (approximately 5.4 Mb) interval on chromosome 6q. J. Med. Genet., 36, 192–196.[Abstract/Free Full Text]

15 Plass, C., Shibata, H., Kalcheva, I., Mullins, L., Kotelevtseva, N., Mullins, J., Kato, R., Sasaki, H., Hirotsune, S., Okazaki, Y. et al. (1996) Identification of Grf1 on mouse chromosome 9 as an imprinted gene by RLGS-M. Nature Genet., 14, 106–109.[Web of Science][Medline]

16 Hayward, B.E., Kamiya, M., Strain, L., Moran, V., Campbell, R., Hayashizaki, Y. and Bonthron, D.T. (1998) The human GNAS1 gene is imprinted and encodes distinct paternally and biallelically expressed G proteins. Proc. Natl Acad. Sci. USA, 95, 10038–10043.[Abstract/Free Full Text]

17 Spengler, D., Villalba, M., Hoffmann, A., Pantaloni, C., Houssami, S., Bockaert, J. and Journot, L. (1997) Regulation of apoptosis and cell cycle arrest by Zac1, a novel zinc finger protein expressed in the pituitary gland and the brain. EMBO J., 16, 2814–2825.[Web of Science][Medline]

18 Ciani, E., Hoffmann, A., Schmidt, P., Journot, L. and Spengler, D. (1999) Induction of the PAC1-R (PACAP-type I receptor) gene by p53 and Zac. Brain. Res. Mol. Brain. Res., 69, 290–294.[Medline]

19 Yada, T., Sakurada, M., Nakata, M., Shioda, S., Yaekura, K. and Kikuchi, M. (1998) Autocrine action of PACAP in islets augments glucose-induced insulin secretion. Ann. N. Y. Acad. Sci., 865, 451–457.[Web of Science][Medline]

20 Filipsson, K., Sundler, F. and Ahren, B. (1999) PACAP is an islet neuropeptide which contributes to glucose-stimulated insulin secretion. Biochem. Biophys. Res. Commun., 256, 664–667.[Web of Science][Medline]

21 Hatada, I., Hayashizaki, Y., Hirotsune, S., Komatsubara, H. and Mukai, T. (1991) A genomic scanning method for higher organisms using restriction sites as landmarks. Proc. Natl Acad. Sci. USA, 88, 9523–9527.[Abstract/Free Full Text]

22 Kawai, J., Hirotsune, S., Hirose, K., Fushiki, S., Watanabe, S. and Hayashizaki, Y. (1993) Methylation profiles of genomic DNA of mouse developmental brain detected by restriction landmark genomic scanning (RLGS) method. Nucleic Acids Res., 21, 5604–5608.[Abstract/Free Full Text]

23 Hayashizaki, Y., Hirotsune, S., Okazaki, Y., Shibata, H., Akasako, A., Muramatsu, M., Kawai, J., Hirasawa, T., Watanabe, S. et al. (1994) A genetic linkage map of the mouse using restriction landmark genomic scanning (RLGS). Genetics, 138, 1207–1238.[Abstract]

24 Bird, A.P. (1986) CpG-rich islands and the function of DNA methylation. Nature, 321, 209–213.[Medline]

25 Wake, N., Takagi, N. and Sasaki, M. (1978) Androgenesis as a cause of hydatidiform mole. J. Natl Cancer Inst., 60, 51–57.

26 Shibata H., Hirotsune, S., Okazaki, Y., Komatsubara, H., Muramatsu, M., Takagi, N., Ueda, T., Shiroishi, T., Moriwaki, K., Katsuki, M. et al. (1994) Genetic mapping and systematic screening of mouse endogenously imprinted loci detected with restriction landmark genome scanning method (RLGS). Mamm. Genome, 5, 797–800.[Web of Science][Medline]

27 Varrault, A., Ciani, E., Apiou, F., Bilanges, B., Hoffmann, A., Pantaloni, C., Bockaert, J., Spengler, D. and Journot, L. (1998) hZAC encodes a zinc finger protein with antiproliferative properties and maps to a chromosomal region frequently lost in cancer. Proc. Natl Acad. Sci. USA, 95, 8835–8840.[Abstract/Free Full Text]

28 Kas, K., Voz, M.L., Hensen, K., Meyen, E. and Van de Ven, W.J. (1998) Transcriptional activation capacity of the novel PLAG family of zinc finger proteins. J. Biol. Chem., 273, 23026–2332.[Abstract/Free Full Text]

29 Abdollahi, A., Roberts, D., Godwin, A.K., Schultz, D.C., Sonoda, G., Testa, J.R. and Hamilton, T.C. (1997) Identification of a zinc-finger gene at 6q25: a chromosomal region implicated in development of many solid tumors. Oncogene, 14, 1973–1979.[Web of Science][Medline]

30 Kas, K., Voz, M.L., Roijer, E., Astrom, A.K., Meyen, E., Stenman, G. and Van de Ven, W.J. (1997) Promoter swapping between the genes for a novel zinc finger protein and beta-catenin in pleiomorphic adenomas with t(3;8)(p21;q12) translocations. Nature Genet., 15, 170–174.[Web of Science][Medline]

31 Pagotto, U., Arzberger, T., Ciani, E., Lezoualc’h, F., Pilon, C., Journot, L., Spengler, D. and Stalla, G.K. (1999) Inhibition of Zac1, a new gene differentially expressed in the anterior pituitary, increases cell proliferation. Endocrinology, 140, 987–996.[Abstract/Free Full Text]

32 Maebayashi, Y., Shigeyoshi, Y., Takumi, T. and Okamura, H. (1999) A putative transcription factor with seven zinc-finger motifs identified in the developing suprachiasmatic nucleus by the differential display PCR method. J. Neurosci., 19, 10176–10183.[Abstract/Free Full Text]

33 Hermann, R., Laine, A.P., Johansson, C., Niederland, T., Tokarska, L., Dziatkowiak, H., Ilonen, J. and Soltész, G. (2000) Transient but not permanent neonatal diabetes mellitus is associated with paternal uniparental isodisomy of chromosome 6. Pediatrics, in press.

34 Arima, T., Matsuda, T., Takagi, N. and Wake, N. (1997) Association of IGF2 and H19 imprinting with choriocarcinoma development. Cancer Genet. Cytogenet., 93, 39–47.[Web of Science][Medline]

35 Sambrook, J., Fritsch, E. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

36 Clark, S.J., Harrison, J., Paul, C.L. and Frommer, M. (1994) High sensitivity mapping of methylated cytosines. Nucleic Acids Res., 22, 2990–2997.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
Y. S. Lee, K. E. Latham, and C. A. VandeVoort
Effects of in vitro maturation on gene expression in rhesus monkey oocytes
Physiol Genomics, October 8, 2008; 35(2): 145 - 158.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
P.-Y. Liu, J. Y.-H. Chan, H.-C. Lin, S.-L. Wang, S.-T. Liu, C.-L. Ho, L.-C. Chang, and S.-M. Huang
Modulation of the Cyclin-Dependent Kinase Inhibitor p21WAF1/Cip1 Gene by Zac1 through the Antagonistic Regulators p53 and Histone Deacetylase 1 in HeLa Cells
Mol. Cancer Res., July 1, 2008; 6(7): 1204 - 1214.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Tessema, R. Willink, K. Do, Y. Y. Yu, W. Yu, E. O. Machida, M. Brock, L. Van Neste, C. A. Stidley, S. B. Baylin, et al.
Promoter Methylation of Genes in and around the Candidate Lung Cancer Susceptibility Locus 6q23-25
Cancer Res., March 15, 2008; 68(6): 1707 - 1714.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Suzuki, Y. Makita, T. Mukai, K. Matsuo, O. Ueda, and K. Fujieda
Molecular Basis of Neonatal Diabetes in Japanese Patients
J. Clin. Endocrinol. Metab., October 1, 2007; 92(10): 3979 - 3985.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
I. M. Carr, E. M. A. Valleley, S. F. Cordery, A. F. Markham, and D. T. Bonthron
Sequence analysis and editing for bisulphite genomic sequencing projects
Nucleic Acids Res., May 21, 2007; (2007) gkm330v1.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. M. Valleley, S. F. Cordery, and D. T. Bonthron
Tissue-specific imprinting of the ZAC/PLAGL1 tumour suppressor gene results from variable utilization of monoallelic and biallelic promoters
Hum. Mol. Genet., April 15, 2007; 16(8): 972 - 981.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A. Sato, E. Otsu, H. Negishi, T. Utsunomiya, and T. Arima
Aberrant DNA methylation of imprinted loci in superovulated oocytes
Hum. Reprod., January 1, 2007; 22(1): 26 - 35.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
C Diatloff-Zito, A Nicole, G Marcelin, H Labit, E Marquis, C Bellanne-Chantelot, and J J Robert
Genetic and epigenetic defects at the 6q24 imprinted locus in a cohort of 13 patients with transient neonatal diabetes: new hypothesis raised by the finding of a unique case with hemizygotic deletion in the critical region
J. Med. Genet., January 1, 2007; 44(1): 31 - 37.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. L. Gloyn, D. J.G. Mackay, M. N. Weedon, M. I. McCarthy, M. Walker, G. Hitman, B. A. Knight, K. R. Owen, A. T. Hattersley, and T. M. Frayling
Assessment of the Role of Common Genetic Variation in the Transient Neonatal Diabetes Mellitus (TNDM) Region in Type 2 Diabetes: A Comparative Genomic and Tagging Single Nucleotide Polymorphism Approach.
Diabetes, August 1, 2006; 55(8): 2272 - 2276.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J R Porter and T G Barrett
Monogenic syndromes of abnormal glucose homeostasis: clinical review and relevance to the understanding of the pathology of insulin resistance and {beta} cell failure
J. Med. Genet., December 1, 2005; 42(12): 893 - 902.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
E. Basyuk, V. Coulon, A. Le Digarcher, M. Coisy-Quivy, J.-P. Moles, A. Gandarillas, and L. Journot
The Candidate Tumor Suppressor Gene ZAC Is Involved in Keratinocyte Differentiation and Its Expression Is Lost in Basal Cell Carcinomas
Mol. Cancer Res., September 1, 2005; 3(9): 483 - 492.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. L. Gloyn, F. Reimann, C. Girard, E. L. Edghill, P. Proks, E. R. Pearson, I. K. Temple, D. J.G. Mackay, J. P.H. Shield, D. Freedenberg, et al.
Relapsing diabetes can result from moderately activating mutations in KCNJ11
Hum. Mol. Genet., April 1, 2005; 14(7): 925 - 934.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. Tomimoto, H. Hashimoto, N. Shintani, K. Yamamoto, Y. Kawabata, K.-I. Hamagami, K. Yamagata, J.-I. Miyagawa, and A. Baba
Overexpression of Pituitary Adenylate Cyclase-Activating Polypeptide in Islets Inhibits Hyperinsulinemia and Islet Hyperplasia in Agouti Yellow Mice
J. Pharmacol. Exp. Ther., May 1, 2004; 309(2): 796 - 803.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Allen, S. Horvath, F. Tong, P. Kraft, E. Spiteri, A. D. Riggs, and Y. Marahrens
High concentrations of long interspersed nuclear element sequence distinguish monoallelically expressed genes
PNAS, August 19, 2003; 100(17): 9940 - 9945.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
I. Nikaido, C. Saito, Y. Mizuno, M. Meguro, H. Bono, M. Kadomura, T. Kono, G. A. Morris, P. A. Lyons, M. Oshimura, et al.
Discovery of Imprinted Transcripts in the Mouse Transcriptome Using Large-Scale Expression Profiling
Genome Res., June 1, 2003; 13(6): 1402 - 1409.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
R. J. Smith, W. Dean, G. Konfortova, and G. Kelsey
Identification of Novel Imprinted Genes in a Genome-Wide Screen for Maternal Methylation
Genome Res., April 1, 2003; 13(4): 558 - 569.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Abdollahi, D. Pisarcik, D. Roberts, J. Weinstein, P. Cairns, and T. C. Hamilton
LOT1 (PLAGL1/ZAC1), the Candidate Tumor Suppressor Gene at Chromosome 6q24-25, Is Epigenetically Regulated in Cancer
J. Biol. Chem., February 14, 2003; 278(8): 6041 - 6049.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Hoffmann, E. Ciani, J. Boeckardt, F. Holsboer, L. Journot, and D. Spengler
Transcriptional Activities of the Zinc Finger Protein Zac Are Differentially Controlled by DNA Binding
Mol. Cell. Biol., February 1, 2003; 23(3): 988 - 1003.
[Abstract] [Full Text]


Home page
Hum Mol GenetHome page
R. A. Fisher, M. D. Hodges, H. C. Rees, N. J. Sebire, M. J. Seckl, E. S. Newlands, D. R. Genest, and D. H. Castrillon
The maternally transcribed gene p57KIP2 (CDNK1C) is abnormally expressed in both androgenetic and biparental complete hydatidiform moles
Hum. Mol. Genet., December 15, 2002; 11(26): 3267 - 3272.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
I K Temple and J P H Shield
Transient neonatal diabetes, a disorder of imprinting
J. Med. Genet., December 1, 2002; 39(12): 872 - 875.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
E Marquis, J J Robert, C Bouvattier, C Bellanne-Chantelot, C Junien, and C Diatloff-Zito
Major difference in aetiology and phenotypic abnormalities between transient and permanent neonatal diabetes
J. Med. Genet., May 1, 2002; 39(5): 370 - 374.
[Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. M. Hawes, Y. Gie Chung, and K. E. Latham
Genetic and Epigenetic Factors Affecting Blastomere Fragmentation in Two-Cell Stage Mouse Embryos
Biol Reprod, October 1, 2001; 65(4): 1050 - 1056.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. Arima, R. A. Drewell, K. L. Arney, J. Inoue, Y. Makita, A. Hata, M. Oshimura, N. Wake, and M. A. Surani
A conserved imprinting control region at the HYMAI/ZAC domain is implicated in transient neonatal diabetes mellitus
Hum. Mol. Genet., July 1, 2001; 10(14): 1475 - 1483.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. Barghorn, E. J. M. Speel, B. Farspour, P. Saremaslani, S. Schmid, A. Perren, J. Roth, P. U. Heitz, and P. Komminoth
Putative Tumor Suppressor Loci at 6q22 and 6q23-q24 Are Involved in the Malignant Progression of Sporadic Endocrine Pancreatic Tumors
Am. J. Pathol., June 1, 2001; 158(6): 1903 - 1911.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
U. Pagotto, T. Arzberger, M. Theodoropoulou, Y. Grübler, C. Pantaloni, W. Saeger, M. Losa, L. Journot, G. K. Stalla, and D. Spengler
The Expression of the Antiproliferative Gene ZAC Is Lost or Highly Reduced in Nonfunctioning Pituitary Adenomas
Cancer Res., December 1, 2000; 60(24): 6794 - 6799.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. Varrault, B. Bilanges, D. J. G. Mackay, E. Basyuk, B. Ahr, C. Fernandez, D. O. Robinson, J. Bockaert, and L. Journot
Characterization of the Methylation-sensitive Promoter of the Imprinted ZAC Gene Supports Its Role in Transient Neonatal Diabetes Mellitus
J. Biol. Chem., May 25, 2001; 276(22): 18653 - 18656.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (72)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kamiya, M.
Right arrow Articles by Hayashizaki, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kamiya, M.
Right arrow Articles by Hayashizaki, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?