Human Molecular Genetics, 2000, Vol. 9, No. 4 561-574
© 2000 Oxford University Press
Developmentally distinct effects on human 
-, 
- and 
-globin levels caused by the absence or altered position of the human ß-globin gene in YAC transgenic mice
Columbia University, Department of Genetics and Development, 701 West 168th Street, New York, NY 10032, USA
Received 14 October 1999; Revised and Accepted 22 December 1999.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The human ß-globin locus has been an important model system in the study of developmentally regulated transcription in multigene chromosomal domains. In this study, primer extension and sensitive real-time RT–PCR assays were used to quantify the effects of ß-globin sequence modifications on
-, 
- and 
-globin levels in transgenic mice. E11.5 primitive erythroid cells showed a surprisingly large increase in -globin in the absence of the ß-globin gene (ß– locus), which is weakly expressed at that stage of development. E17.5 fetal liver and adult erythroid cells, in which ß-globin expression approaches its maximum, showed an unexpectedly small, statistically insig- nificant stimulation of - and -globin levels in the absence of ß-globin sequence. Analysis of erythroid colonies produced by in vitro differentiation of embryonic stem cells indicated that the absence of the human ß-globin gene had no effect on -globin expression. These results suggest that competitive influences need not be linked directly to transcription level or distance from the locus control region (LCR), and that the large increases in -globin levels seen in some human deletional ß-thalassemias and hereditary persistence of fetal hemoglobin conditions are most likely to be due to effects other than loss of ß-globin competition. In transgenic mice with ß-globin sequences inserted between and the LCR in a ß-locus (ßup), the expression of -, - and -globins suggested that stage-specific sensitivity to loss of LCR activity may be a more important parameter than position relative to the LCR. The relationship of these measurements of transgenic globin expression to a possible binary model of globin LCR action and to mimicry from red blood cell loss due to transgenic globin imbalances are discussed. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The ß-globin locus of vertebrates, containing a locus control region (LCR) followed by five homologous genes (
–G–A––ß), has long been an important model for studies of gene regulation in large, multigene complexes. In erythroid cells, this locus is characterized by a generally increased sensitivity to digestion by DNase I, with stage-specific hypersensitive (HS) sites corres- ponding to the promoters and enhancers neighboring the globin genes (1,2). Five additional erythroid-specific DNase I HS sites 6–21 kb 5' of the human -globin gene and an HS site 3' of ß-globin together demarcate a 90 kb erythroid-specific domain (3,4). The DNase I HS sites 5' of -globin, termed the LCR, can mediate erythroid-specific, position-independent, copy number-dependent expression of linked transgenes (5,6). The LCR has been postulated to function, in part, by creating an erythroid-specific open chromatin domain that resists the negative effects of surrounding heterochromatin on gene transcription (7).
Although the LCR has several of the characteristics of an enhancer, it remains a subject of current investigation whether the LCR and its individual HS sites augment the expression of linked genes by acting as classical enhancers (8) or solely by providing an open chromatin domain insensitive to position effects (9). It is also of considerable interest whether the ß-globin LCR is involved fundamentally in the developmental switching of globin gene expression through embryonic (), fetal () and adult (, ß) stages. It has been suggested that increased expression of ß-globin directly causes the decline in genes expressed earlier in development, such as the -globin genes, or, conversely, that silencing of -globins leads to the increased expression of ß-globin during development (10–12). The LCR could be involved in the competitive switch if it acts as a shared enhancer with limited activity. The proposal that the transcriptional state of the ß-globin gene in adults can influence the production of -globin was based on the elevated -globin levels observed in many human thalassemias caused by deletions of ß-globin (reviewed in ref. 13). Loss of competition, however, is only one proposed explanation for the elevated fetal hemoglobin (HbF; 
22) seen in deletional thalassemias and hereditary persistence of fetal hemoglobin (HPFH) in adults. Considerable experimental evidence, for example, has indicated that much of the stimulation of the -globin genes in deletional HPFH is due to the importation of enhancers into the 3' region flanking the -globin genes (14–16).
The idea that the LCR might be involved in controlling ß-globin switching arose from transgenic experiments in chicken tissue culture cells (10) and in transgenic mice (11,12). In the chicken, it appeared that an embryonic and an adult globin gene shared an enhancer whose activity was limiting. In the mouse, when the human - or ß-globin gene was linked individually to LCR elements, it was expressed constitutively throughout development (17,18), whereas appropriate developmental regulation of ß-globin could be restored by placing a -globin gene upstream of it (11,12). These data were interpreted to mean that the - and ß-globin genes needed each other in the presence of the LCR for correct developmental expression. However, it was also found that the - and -globin genes could be expressed appropriately when linked to LCR elements in the absence of other globin genes, i.e. these genes could be regulated autonomously (19,20). In addition, in transgenic mice with a 40 kb segment of the human ß-globin locus spanning the - and ß-globin genes but without an LCR, developmental expression of the human globin genes was appropriate (21), suggesting that the LCR was not essential for globin switching. A recent study in which the mouse LCR was removed from its in situ location has supported these findings (22).
Transgenes containing the entire, unrearranged human ß-globin locus have been studied in an effort to reduce the potential for artifacts due to the tandem integration of multiple small transgenes (23–25). In yeast artificial chromosome (YAC) transgenic studies in which HS sites in the human LCR were removed, large effects on the transcription of some of the globin genes were seen in some cases (26) but not in others (27). The lack of an LCR effect on the timing of human globin switching reported in the latter study, in which HS2 and HS3 were deleted independently, was also observed when the same HS sites were deleted from the endogenous murine ß-globin locus (28,29). The variability seen in the YAC transgenic HS site deletion results has been proposed to be the result of position effects on the globin genes which are observed when the linked LCR is not intact (30).
Several YAC and cosmid studies have left the LCR intact and instead examined the effect of deleting or moving globin genes and regulatory elements. When a human ß–-globin hybrid marker gene was added to linked cosmids spanning the human ß-globin locus, evidence of competitive effects was observed (31). A possible competitive increase in fetal -globin expression was also noted in studies in which mice containing an erythroid Kruppel-like factor (EKLF) knockout were crossed with those bearing an intact human ß-globin locus (32,33). Since EKLF is an erythroid-specific transcription factor which is required for the expression of the adult ß-globin genes in mice and humans (34–36), these experiments were interpreted as being equivalent to removing the ß-globin gene itself; however, EKLF-binding sites exist in the mammalian LCR as well as in the -globin promoters, so the precise cause of the effects seen is not certain. In experiments in which YAC and cosmid ß-globin locus transgenes suffered unintended truncations removing the - and ß-globin genes, thereby creating –ß-thalassemia-like transgenes in mice, no increase or extended expression of -globin was observed, as would have been expected from a gene competition model (23,37). The 3' ß-globin enhancer was also deleted recently from a ß-globin locus YAC (38). In this case, although the ß-globin gene was inactivated, no effect on -globin expression was seen. Therefore, it remains unresolved whether the - and ß-globin genes regulate one another’s expression and whether such an effect is achieved through competition for LCR activity.
Here we present evidence indicating that: (i) competitive effects for LCR activity due to gene position are less important than gene-specific developmental factors; and (ii) competition from the ß-globin gene is probably not a significant factor in most clinically elevated HbF states.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
ß-globin YACs
Sequence from 1.8 kb 5' to 1.7 kb 3' of the human ß-globin gene was chosen for deletion from the ß-globin locus in YAC A85N because prior transgenic studies indicated that these sequences were sufficient to impart tissue-specific, developmentally appropriate expression (39). Furthermore, the human, mouse, rabbit and galago ß-like globin loci have retained conserved sequences extending ~2 kb 5' and 1 kb 3' of each gene (40). The ß-globin sequence deleted from the ß– YAC was reinserted upstream of
-globin (see Materials and Methods) to produce a third YAC, ßup. The three ß-globin YACs, ß+, ß– and ßup (Fig. 1), were transfected into embryonic stem (ES) cells as described (41).
|
Analysis of integrated YAC copy numbers and physical integrity in ES cell transfectants is shown in Figure 2. All of the YAC transgenes employed in this study were intact as judged by CHEF gel and Alu fingerprints, and two-thirds of the YACs were present in one or two copies (41). Two ES cell lines with more than two YAC copies were also examined (Fig. 2C). The ES transfectants used in these experiments contained all PCR markers spanning the ß-globin locus (41) except clone ß–1, which lacked the TRP marker from the left YAC arm; HS4 was retained, indicating that the left arm deletion did not approach the ß-globin locus, which is almost 40 kb 3' of the TRP arm.
|
Measurement of globin levels in chimeric mice
To examine the regulation of the globin genes in mice carrying these YACs, ES cells were injected into blastocysts and the resulting chimeric embryos, fetuses or mice were analyzed at different developmental stages. ES cell-derived glucose phosphate isomerase (GPI)-1C to blastocyst-derived GPI-1A isozyme ratios were used to measure the degree of chimerism (see Materials and Methods). In order to compare the levels of globin expression in different chimeric animals, animals with a similar degree of chimerism were paired. In other cases, globin expression was divided by the GPI-1C:GPI-1A ratio (normalized) to take into account any differences in chimerism. No statistically significant differences in average GPI-1C fraction were observed in the ß– and ßup chimeras relative to ß+. Animals were also matched or normalized for YAC copy number, and globin signals were normalized for the content of murine
- and 
- or ßh1-globins, which were expected to be constant at a given developmental stage. The changes from one developmental time point to another were determined for individual globin genes, but the individual genes were not compared directly with one another due to potential differences in primer efficiency and probe specific activity.
Both end-point RT–PCR and real-time quantitative RT–PCR were used to examine globin expression at several developmental time points. A typical end-point RT–PCR of serially diluted cDNAs from embryonic day (E) 17.5 fetal livers is illustrated in Figure 3A, and plots of the log of the band intensities versus the log of the starting cDNA concentrations are shown in Figure 3B. -globin was expressed at equivalent levels in the ß+ and ß– fetal erythroid cells, as shown by the strong overlap between the human -globin and murine -globin curves for the ß+ and ß– chimeras. The ß+ and ß– E17.5 fetal livers also showed the same -globin expression measured by real-time PCR when adjusted for copy number. Of all the methods that we employed, the most accurate and reproducible results were obtained by real-time RT–PCR, for any cycle within the exponential phase for which the various reaction lines were parallel (Fig. 3C). This conclusion was based both on running duplicate samples (Fig. 3D) and on comparison of replicate runs (SE = ±27%). A standard curve for one of the two -globin primer pairs used is shown in Figure 3D. Real-time PCR products were also visualized after amplification (see Materials and Methods). Figure 3E illustrates that with some primers, a low molecular weight band could form (probably ‘primer-dimer’), the level of which was inversely proportional to the amount of input target cDNA. However, these products never affected the real-time quantitation since water and reverse transcriptase-minus controls showed that these signals arose far later during the PCR than the true products (e.g. note the positive H2O signal in Fig. 3C). Thus, it was not necessary to use melting curve analysis to discriminate true from artifactual products (42) even in the relatively rare cases in which such low molecular weight products were observed. Finally, it was shown that quantitative RT–PCR gave the same results as primer extension analysis (see below). Therefore, our data indicated that real-time PCR was a dependable method of determining globin RNA levels in chimeric mice.
|
E11.5 expression
Using the quantitative methods illustrated in Figure 3, we examined the levels of expression of the globin transgenes at various developmental stages. Placement of the human ß-globin gene 1.3 kb upstream of the
-globin gene (ßup) produced a nearly 30-fold increase in ß-globin expression at E11.5 (Fig. 4A). We observed almost no definitive (enucleated) red cells at E11.5, indicating that there was little or no maternal red blood cell contamination; definitive erythrocytes are not released from the fetal liver until E12 (43). Therefore, the human ß-globin RNA that we observed is most probably derived from primitive erythroid cells; adult globins have been shown to be visible on protein gels from purified primitive murine erythroid cells by E12 (43).
|
-globin levels at E11.5 were also affected by the novel position of the ß-globin gene (Fig. 4B). There was a 5-fold increase in mean -globin levels in the ß– embryos (P = 0.008), and an almost 5-fold decrease in the ßup embryos (P = 0.18). The changes in -globin expression, a 2.5-fold increase in in ß– embryos and a <2-fold decline in ßup embryos (Fig. 4C), were not statistically significant by t-test; similar changes in -globin expression during this period were observed (Fig. 4D). Normalizing human globin expression levels to -globin expression produced nearly identical results to those using ßh1 as a control for cDNA quantity, as both ßh1 and levels were quite constant among the lines (data not shown). Furthermore, the differences in -globin levels among embryos derived from the three classes of YACs were evident without any normalization. Therefore, our data indicate that placing the ß-globin gene near the LCR significantly elevates its expression at E11.5, and that alterations in the ß-globin gene’s presence and position are correlated with changes in the levels of the other ß-like globins, most significantly -globin.
E17.5 expression
In the E17.5 fetal liver, there was minimal, and variable, elevation in human ß-globin expressed from the ßup locus; the differences were not statistically significant (P = 0.20). Nonetheless, the expression of the - and -globin genes from the ßup locus showed a more pronounced effect at this stage than was seen at E11.5 (Fig. 5A and B); the 24- and 6-fold declines in -globin and -globin levels (relative to expression from the ß+ YAC) were significant by t-test at P < 0.01 and P < 0.05, respectively. In contrast, the absence of ß-globin (ß–) caused marginal if any increase in expression of the other human ß-like globins; none of the mean differences in human globin levels between ß+ and ß– animals at E17.5 were statistically significant.
|
Primer extension analysis was used to confirm the E17.5 quantitative RT–PCR results. In general, the level of
-globin in pairs of ß+ and ß– embryos (matched for equivalent GPI chimerism) reflected the differences in copy number of the ß-globin YACs, regardless of whether the human ß-globin sequences were present on the YAC or not. For example, the ratio of -globin levels in ß+:ß– fetal livers from the data illustrated in Figure 6 is 2.2, which is very close to the ratio of the YAC copy number (2:1). Placing the ß-globin gene and its neighboring regulatory sequences just downstream of the LCR (ßup YACs) resulted in a large reduction in total -globin RNA levels (Fig. 6). Therefore, the primer extension results give a visual confirmation of the real-time PCR data, namely the only notable effect on human -globin levels occurs in ßup animals.
|
Adult expression
Examination of human globin expression in 15 ß+ and 14 ß– animals from six lines over a 6 month postnatal period showed a minor elevation of
- and -globin levels in the ß– transgenic animals. The ß– chimeras displayed ~2-fold increases in both - and -globin mRNA levels compared with the ß+ chimeras (Fig. 7A; P = 0.04 by t-test for - and -globins). However, when the individual lines were examined independently (Fig. 7B), it was apparent that most of the elevation in - and - globin levels in the ß– animals could be explained by a low level of -globin in a single ß+ line, As15, a line which had a relatively high YAC copy number of four. Line ß+15 had low raw - and -globin levels relative to the other lines, even without normalization for YAC copy number. When the analysis was restricted to low (one or two) copy YAC transgenic animals, the -globin increase was only 40% and the -globin increase 60% (Fig. 7C). Therefore, the increase in - and -globin expression in the absence of ß-globin was at best quite limited.
|
In vitro differentiation
In order to assess further whether the small elevations of
-globin seen in several ß– chimeric mice were the result of changes in gene expression rather than variable loss of red blood cells due to globin chain imbalance, YAC transgenic ES cells were differentiated in vitro under conditions which promoted the production of definitive erythroid colonies [EryD (44)]. Individual EryD colonies, with a definitive morphology of dispersed, dark red cells, were picked at day 7 from cultures of disaggregated embryoid bodies. Murine ßh1-, -, ßmaj- and -globin levels in EryD colonies were measured by quantitative RT–PCR. Human globin levels were quantitated and normalized for YAC copy number (there was no GPI chimerism as the ES cells are the sole contributors to these erythroid cells). The measurements from groups of seven EryD colonies were averaged (Fig. 8). No evidence for - or -globin elevation in ß– YAC cells was found in this system.
|
Globin expression patterns
Prior measurements of
-globin expression in transgenic mice containing an intact ß-globin locus have differed as to whether any -globin expression occurred in the late fetal liver or adult stages. -globin expression was determined to be extinguished before E16 in some studies (23,31), but detected as late as postnatal day 7 in others (37). We found that -globin levels in ß+ YAC transgenic mice were diminished by <5-fold between E11.5 and E17.5 [although a peak may exist between these points (45)], and were still clearly measurable in the adult period to 6 months of age (Fig. 9). In contrast, human -globin expression followed the pattern of the murine embryonic genes, ßh1 and , with large drops in expression from E11.5 to E17.5 (Fig. 9). -globin showed a modest peak of expression at E17.5, but was similar to human ß-globin in showing a large increase from E11.5 to E17.5 (50-fold each), as would be expected of adult genes (Fig. 9). Therefore, both - and -globin exhibit patterns of expression in the mouse which were somewhat distinct from the typical embryonic (human , mouse ßh1 and ) and adult (human ß and murine ) genes examined here.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
A 5.3 kb region spanning the human ß-globin gene was replaced with a similarly sized yeast LYS2 selectable marker in a 235 kb YAC containing the human ß-globin locus (ß– YAC). In a second construct, the 5.3 kb ß-globin region was inserted into the ß– YAC upstream of
and in an orientation opposite to that of the other globin genes (ßup YAC). The 5.3 kb ß-globin replacement was intended to remove all known ß-globin regulatory sequences (39,40) without importing any sequences 3' of ß-globin closer to the -globin genes (16). These YAC constructs were designed to test the competition model of globin gene regulation (10–13). ES cells transfected with these YACs were used to produce chimeric mice, from which human globin levels were measured relative to those of the mouse adult and embryonic globins (Table 1).
|
Neither transcription level nor distance from the LCR necessarily correlates with the magnitude of gene competition
The original competition model for developmental regulation of transcription in the human ß-globin locus allowed the possibility that any globin gene could influence another competitively, i.e. that competition would be reciprocal. However, in an early experiment placing ß-globin near the LCR in smaller globin constructs, it appeared that the LCR had a preference for the nearest promoter, in particular at the embryonic stage of development (46). It was proposed that the LCR acted as an enhancer that could interact with a single globin promoter at a time through a looping mechanism, as had been proposed for other enhancers. In a model termed non-reciprocal competition, promoters closest to the LCR would receive more LCR contacts than those further away, explaining their ability to compete more effectively (46).
In our ßup YAC transgenic mice, ß-globin expression was highly elevated in primitive erythrocytes, confirming that ß-globin’s transcriptional regulation is dependent on its position in the locus. Furthermore, the competitive influence of ß-globin clearly was enhanced by placing it near the LCR, consistent with non-reciprocal competition. Our results with the ßup YAC agree with a recently published report in which was replaced by a marked ß-globin gene (31). These data also suggest that LCR activity, and total ß-like globin expression, were limited in ßup mice. For example, at E17.5, a relatively small increase in ß-globin expression from the highly expressed ßup gene produced a much greater percentage decline in the less expressed - and -globins, consistent with a fixed total ß-like globin output. Conversely, a large increase in the (usually minimal) expression of ß-globin at E11.5 was associated with relatively small percentage declines in the more highly expressed - and -globins.
Nevertheless, the effects that we observed cannot be explained completely by a non-reciprocal competition model in which competitive strength is based on gene order and correlated with transcriptional levels. Most importantly, there was no significant elevation of - or -globin expression at fetal and adult times in ß– YAC transgenic mice or on in vitro erythroid differentiation of ß– YAC ES cells. This is particularly unexpected if high ß-globin levels at adult stages were indicative of a high frequency of LCR contacts. In this case, the large loss of ß-globin expression in ß– YAC transgenic animals should have produced significant elevations of and levels. Secondarily, it was observed that (and to a lesser extent and ) levels were quite elevated in primitive erythroid cells in ß– YAC transgenic mice. Again, if the frequency of LCR contact were correlated directly to gene expression (46), it would have been predicted that the competitive effect from the absence of ß-globin would have been smallest when ß-globin’s expression was least in the ‘embryonic’ (primitive erythroid) period. Non-reciprocal competition also cannot account for the finding that at E11.5 ßup had a larger suppressive effect on expression than on the more distal globins, even though the proximity of to the LCR should have made it more competitive than the more downstream genes. Therefore, these observations suggest that the distance and effective volume from the LCR are not necessarily the most important determinants of the magnitude of gene competition.
We interpret the ß– data as consistent with a model in which it is not transcription or gene order per se that reveals the competitive strength of globin genes such as ß, but rather the intrinsic stage-specific sensitivity of particular globin genes to LCR loss. The ß– data suggest, first, that the distant and weakly expressed, but highly expressible ß-globin sequences at the 3' end of the locus can influence levels of the other ß-like globins early in development. It may have been the potential of ß-globin to be highly transcribed at E11.5 (as confirmed by the ßup data presented here), perhaps in the form of LCR-accessible promoter and local enhancer sites, that was sufficient to produce a competitive effect on the other globins, even when those genes were far closer to the LCR. Second, the larger than expected increase in - and -globin expression in the absence of the weakly expressed ß-globin at E11.5 suggests that LCR activity had been limiting in primitive erythrocytes. Although not very transcriptionally active, the removal of ß-globin from its native position apparently reduced the number of competitors by one. Even if the amount of LCR contact with ß in its native position were low, as suggested by the low ß levels at E11.5, expression from the embryonic globins apparently was quite sensitive to the increase in LCR availability. Third, our data indicate that the dysregulation (increased expression) of the -globins on removal of the ß-globin competitor was much reduced later in development. This is consistent with the -globins being silenced and thereby becoming less sensitive to increased LCR contacts. Therefore, these data indicate that developmental stage-specific gene responsiveness is a more significant influence than increased LCR availability. Similarly, changes in the organization of the ß-globin locus provided no evidence that silencing can be reversed or its expression extended developmentally by altering the presence or position of ß-globin. These observations are consistent with the dominance of gene silencing over competition as a mechanism of transcriptional regulation in this locus.
Transcriptional influencespropagated 5' to 3' do not explain changes in globin levels
It has been proposed that enhancers, including elements of the ß-globin LCR, effect a binary, on/off switch in transcriptional activity (9). In this view, enhancers might promote the formation of transcriptionally permissible domains (9) and, thereby, the likelihood of transcription, but do not alter the transcription level of genes within a permissive domain (30). In explaining what appear to be competitive effects from ß-globin genes placed near the LCR on downstream genes (11,12,46, and data herein), it has been proposed that transcribed genes may interfere with the expression of genes located 3' to them in the locus through transmission of a topological change downstream of a transcription complex, or by compartmentalization within the nucleus (30). The reversed orientation of our ßup gene, however, clearly argues against any direct interference that is propagated in a 5' to 3' manner. Our data also indicate that silencing is probably not a general effect propagated 5' to 3' through the locus during development (30), since ß-globin remains actively transcribed in its position upstream of at times when expression is nearly extinguished.
Globin imbalance and red blood cell loss may mimic the effects of gene competition
Some observations made during this study suggest that regulatory mechanisms other than transcriptional competition may be at work. Most significant among the findings presented here is that human -globin mRNA levels were not elevated when ß– YAC-bearing ES cells were differentiated in vitro. In addition, highly elevated -globin levels were not obtained from high copy YAC ES lines.
It is known that excess human globin chains can produce red cell destruction in vivo. In the bone marrow of thalassemics, cell death occurs in erythroblasts before they become well hemoglobinized, resulting in an ineffective erythropoiesis that leads to a large expansion of the bone marrow. After E15 of mouse embryogenesis, orthochromic erythroblasts with mature levels of hemoglobin predominate in the liver (although even the earliest BFU-E erythroid progenitors have significant levels of hemoglobin). Loss of hemoglobin-bearing cells could cause changes in globin levels which mimic those expected by a gene competition model. In the case of the reduced -globin levels observed in the ßup YAC E17.5 fetuses, the HbF-like subpopulation of cells (24) expressing - or -globin might have been most selected against in the presence of high levels of human ß-globin expression. Similarly, the E11.5 primitive erythrocytes most susceptible to loss from increased ß-globin levels may have been those with the highest and levels. A gradient of erythroid cell loss would therefore correlate with human globin levels produced by the YACs: ßup > ß+ high copy > ß+ low copy > ß–. It is also possible that the highly variable and relatively low ß-globin levels observed in the ßup fetal livers (Fig. 6) were the result of cell loss, leading to the preferential survival of non-- or non--globin-expressing cells. Although no statistically significant changes in erythroid GPI-1C fraction were observed at any stage, there were mild changes in GPI-1C direction consistent with erythroid loss, i.e. the ß– GPI-1C fraction was higher than that of ß+ which, in turn, was higher than that of ßup at all stages except ßup at E11.5. Therefore, a more detailed monitoring of red cell dynamics in transgenic animals may be required in future studies in order definitively to rule out a red cell loss phenomenon. Finally, if the definitive cells produced in vitro are representative of cells seen in adult animals, then these results suggest that the small elevation of - and -globins observed in adult animals either were the result of in vivo processes (e.g. Heinz body clearance) or were in fact not significant.
In conclusion, our ßup data qualitatively replicate findings previously published (31,46) which show that a ß-globin gene placed near the LCR can depress the level of other globin genes in the locus. However, by reversing the order of the upstream ß-globin sequence and carefully quantitating resulting globin levels, new insights are provided: (i) the position of the genes downstream of ßup may not be as important in predicting the magnitude of the (presumptive) competitive effect on them as other factors such as developmentally changing sensitivity to LCR loss; and (ii) the depression of the downstream globin genes is most probably not a direct consequence of effects propagated in a 5' to 3' manner from the ßup gene. More importantly, the ß– YAC data presented here from chimeric mice and in vitro stem cell differentiation show little or no significant increase in the - and -globin RNA levels at fetal and adult times, contrary to what would have been predicted if gene competition played a significant role in human ß0 thalassemias with elevated fetal -globin levels. Instead, the ß– YAC data suggest that, if gene competition is occurring, then the actual transcription level of the ß-globin gene may not correlate with its stage-specific effects on the other globins. Furthermore, these data illustrate that distance and effective volume from the LCR are not necessarily the most important determinants of the magnitude of gene competition compared with developmental stage-specific transcriptional responsiveness.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
YAC preparation and modification
A 235 kb YAC containing the entire ß-globin locus, A85 (David Burke, Washington University, Washington, DC), was modified by introduction of the bacterial neomycin gene (neo) into the URA3 arm to allow G418 selection in mammalian cells. A fusion of the murine PGK promoter and neo coding sequence was excised from a pPGKneo vector with XhoI and cloned bluntly into the SalI site of pWJ472 (a gift of Michael Neystat, Columbia University), a plasmid containing the HIS5 gene of yeast, to produce pHIS5neo. The head-to-head PGKneo and HIS5 genes were excised as a 3.9 kb fragment from pHIS5neo using MluI, ApaI and BcgI. The URA3 gene of pYAC4 (47) was excised with SalI–XhoI and cloned bluntly into the EcoRV site of BlueScript II SK+. The His5neo fragment was cloned bluntly into the EcoRV site of URA3 in the BlueScript vector to produce pH5NU, with HIS5 in the same orientation as the disrupted ura3 gene. A 9.5 kb SalI–XhoI fragment from pH5NU was used to transfect yeast bearing the A85 ß-globin YAC to HIS5 prototrophy and uracil auxotrophy. The appropriate integration (Fig. 1) was confirmed by Southern blotting using a labeled neomycin probe. The A85Neo-modified YAC (A85N) is also referred to as the ß+ YAC. The positions of the globin sequences within the ß-globin YACs are defined relative to the sequence GAATTCTAATCTCCCTCTCA, with the first nucleotide being position 1, which is found ~19.5 kb upstream of the
-globin start codon.
The ß-globin gene of the ß+ YAC was replaced with a similar sized LYS2 gene of Saccharomyces cerevisiae. The LYS2 gene fragment was obtained from pCGS990 as an ~5.3 kb EcoRI–MluI fragment and cloned bluntly into the EcoRV site of a BlueScript II SK+ vector. A 0.7 kb HindIII–AatII fragment from a region 1.8 kb 5' of the human ß-globin gene transcription initiation site [positions 59 607–60 321 (Fig. 1)] was cloned bluntly into the SalI site of the pLYS2 BlueScript, and a 1.9 kb XbaI–HindIII pHb9 fragment from a region 1.7 kb 3' of the human ß-globin poly(A) site and 0.9 kb 3' of the 3' enhancer (positions 65 439–67 397) was cloned bluntly into the PstI site of the same vector. A clone was chosen with the flanking ß-globin sequences in the opposite orientation from the LYS2 gene. The ß-LYS-ß vector was linearized with NotI and transfected into yeast bearing the ß+ YAC. LYS+ transfectants were screened by Southern blot for the introduction of novel ClaI and XhoI sites using a labeled -globin probe from a 2.3 kb BglII fragment of pBSV. The resulting ß– YACs had the LYS2 gene in the opposite orientation to that of the replaced ß-globin gene. The ß– YACs were negative for ß-globin sequences by PCR, RT–PCR and primer extension after transfection into ES cells and production of chimeric mice. It was not surprising to find that the LYS2 gene from the single celled budding yeast S.cerevisiae was not transcribed in the mouse, as determined by RT–PCR (data not shown). Given that the ßup gene was able to depress the RNA levels of downstream globin genes, as had been observed by others using different transgenic constructs (see Results), it is unlikely that the LYS2 sequences had any specific effect on gene regulation within the locus.
The ß-globin sequences which had been removed from the ß– YAC were reinserted upstream of the -globin gene of the same YAC to form the ßup YAC. The 5.1 kb AatII–XbaI ß-globin gene fragment (position 60 321–65 439) was cloned bluntly into the Tth111I site (locus position 18 179) found within an AluI repeat ~5 kb 3' of HSI and 1.3 kb upstream of the -globin gene present in a BlueScript II vector as an 8.1 kb HindIII fragment (locus position 13 785–21 909). A 2.6 kb EcoRV URA3 fragment was cloned bluntly into the SalI site of the same vector. The resulting construct had the ß-globin gene surrounded by sequences of 4.7 and 1.3 kb found at the Tth111I site upstream of , with ß in the opposite transcriptional orientation from that of (Fig. 1). The entire plasmid was used to transfect yeast containing the ß– YAC. Transformants were selected for single crossover integration of the plasmid on media lacking uracil (Fig. 1). The resulting yeast were selected for loss of the URA3 gene by plating on medium containing 5-fluoro-orotic acid (5-FOA) (Fig. 1). Southern blots (using BclI and PmlI digests and a ß-globin probe) and yeast subcloning indicated that URA+ ß– YAC sectors were able to survive the FOA selection, so FOAr colonies were subcloned sequentially on LYS- and HIS-requiring media and then checked for uracil auxotrophy on uracil omission media before being used to produce YAC DNA for transfection into ES cells.
Integrity and copy number of transfected YACs
CCE ES cells derived from murine strain 129/Sv (gift of Liz Robertson, Harvard Univeristy, Boston, MA) were transfected with YACs spanning the ß-globin locus as described (41). SfiI-digested chromosomal DNA in agarose plugs from equivalent numbers of YAC-transfected ES cells grown in medium containing G418 were separated by CHEF pulsed-field gel electrophoresis, blotted and hybridized to a 32P-labeled DNA probe from 5' of the gene (Fig. 2A). The blots were stripped and re-hybridized to a murine Ret probe or simultaneously probed with a murine erythropoietin receptor (EPO-R) sequence in order to account for variations in actual amount of DNA that entered the lanes. Blots were also probed independently with sequences from human HS4, ß-globin and -globin, or yeast LYS2. To assess copy number and intactness of the integrated YACs further, genomic DNA was also digested with HindIII, Southern blotted and probed with 32P-labeled, , RET and, on separate blots, Blur8 Alu probes (Fig. 2D). Each ES YAC transfectant was analyzed on two to three CHEF blots and two to three ordinary Southern blots for copy number by quantitation of relative to RET (or EPO-R) using a Molecular Dynamics (Sunnyvale, CA) PhosphorImager. The consensus relative copy numbers were compared with standards, such as a single rearranged fragment of a similar YAC [e.g. ß+17 (Fig. 2A)] and from human DNA. The highest YAC copy number obtained in an ES transfectant was 7 [ES ß– YAC line 13 (Fig. 2A)]. In some cases, a band migrated slightly differently on two CHEF gels, in which case it was run on a third (e.g. see YAC ß–1 in Fig. 1). Alu fingerprints appeared to have retained all bands with the same intensity, including at least one case in which a rearranged fragment was known to be present by CHEF blot (see also ref. 41).
cDNA preparation
Blood was collected from E11.5 mouse embryos after removal from the yolk sac and rinsing in phosphate-buffered saline (PBS) by allowing the embryo to bleed onto a dish from the umbilical vessels at room temperature. When the embryonic heart stopped beating, the blood was collected in PBS at 4°C and examined for definitive erythroid cells under a microscope. The cells were spun out and RNA isolated with a single step guanidinium–acid phenol method (48). The E11.5 embryos, and sometimes also an aliquot of E11.5 blood (12 µl of 50 µl in PBS), were used for a GPI-1 enzyme assay (see below). E17.5 fetal livers were used for both RNA and GPI assay. Adult blood was collected from the mouse tail into 70 µl heparinized capillaries, and spun to separate the white and red cells; the latter were used to produce RNA. Human newborn cord blood was collected immediately after birth from the placenta using an ABG syringe. Human adult peripheral blood was collected into a heparinized capillary after finger stick, and processed as for the adult mouse samples. All RNA preparations were treated with DNase I for 15 min at room temperature immediately before conversion to cDNA using reagents from Life Technologies (Rockville, MD) (Superscript II kit; the DNase I buffer was supplemented to convert it to reverse transcriptase buffer).
GPI-1C chimerism
Chimerism of the blood and fetal liver was determined by enzymatic assay in cellulose acetate gels as described previously (49). As red and white cells are derived from the same hematopoietic stem cells, it is to be expected that red and white cells in the same animal will have similar degrees of chimerism. Both red cell and white cell GPI-1 enzyme levels were measured simultaneously in blood from adult animals. The red cell GPI-1C fractions paralleled those in white cells, but were always lower. This is due to the fact that the GPI-1C isozyme is less stable than GPI-1A (50), combined with the longer life time of adult red cells (121 days) compared with white cells (of which 50–70% are neutrophils which have a half-life of 6 h). As our data confirmed, the GPI-1C:C+A ratio in red cells was always reduced compared with that obtained in white cells. In addition, the reduced GPI-1C signal from red cells was sometimes near or below the limits of our detection on cellulose acetate gels, which made it necessary to use white cells. In order to confirm that the white blood cell GPI-1C fraction was representative of that of erythroid cells, a sequence polymorphism between GPI-1c/c (inbred mouse strain 129/Sv ES cells) and GPI-1a/a (outbred host MF1 blastocysts) alleles was identified (GenBank accession no. AF108354). Primers specific for each allele were used for quantitative real-time RT–PCR of erythroid cDNA (Table 2). Although very specific, the sensitivity of the cspec PCR performed was such that not all of the adult GPI-1C fractions could be assessed using this method.
|
Primer selection and specificity
Primers were chosen using the Oligo 4.06 program (Wojciech Rychlik, Molecular Biology Insights, Cascade, CO) and a combination of the human and murine ß-globin loci as well as murine
- and (zeta)-globins (GenBank accession nos U01317, X14061, V00714 and X62302). The oligonucleotide search parameters were varied within the following limits: to maintain unique 3' ends from seven to nine nucleotides, check duplexes starting from nucleotides 9–11, and set terminal stability threshold to –9.0 to –11.0 kcal/mol. The actual annealing temperature was often raised from the predicted temperature in order to ensure lack of background binding (Tables 2 and 3). Primer specificity was confirmed by PCR against cloned -, -, - and human ß-globin, against murine ßh1, and against murine and human red blood cell cDNA and genomic DNA. The -globin PCR product was also sequenced. PCRs were performed with a single primer pair since, in our experience, combinations of primers sometimes led to substantial interference (variably reduced signals).
|
Quantitative RT–PCR
End-point quantitative RT–PCRs were performed manually using serial dilutions of cDNA as previously described (51,52) using 50 µl reactions with 1 µM primers, and 0.1 µCi of 3000 Ci/mmol [32P]dCTP. The typical PCR amplification profile had 30 cycles of 30 s at 94°C, 1 min at the annealing temperature, and a 2 min extension at 72°C on a Perkin Elmer (Foster City, CA) 9600 thermal cycler. PCR products were run on 4% non-denaturing polyacrylamide gels, fixed in 10% glacial acetic acid/12% methanol for 1 h, dried down under a vacuum at 80°C and exposed to a phosphorimager screen for 30 min and then overnight. Signals were quantitated with a Molecular Dynamics PhosphorImager and backgrounds subtracted using the Molecular Dynamics ImageQuant software.
Real-time quantitative RT–PCR (53) was performed on a Perkin Elmer/Applied BioSystems Prism 7700 spectrofluor- ometric thermal cycler. The 50 µl reactions contained a 1:120 000 fresh dilution of SYBR Green I (42) (Molecular Probes, Midland, TX) in water, 1 µM each primer, 200 µM each dNTP, 1.25 U of AmpliTaq Gold Taq polymerase (Perkin Elmer), 1x AmpliTaq Gold buffer without magnesium, 4 µM MgCl2 and diethylpyrocarbonate (DEPC)-treated water. SYBR Green I was used to monitor the production of double-stranded PCR products because of its strong preference for binding to double-stranded DNA. The SYBR Green signals were analyzed using a fluorescein spectrum. The fluorescence level at which reaction cycles were compared (known as ‘thresholds’ on the Prism 7700) were chosen such that the exponential phase of amplification was within a wide linear range on log plot for most or all samples. The choice of baseline on this machine was significant since this could influence the shape of the curve in the linear range (the baseline is an extrapolated trend line) and because baselines could not be set for individual curves. In general, the range of cycles used as baseline was chosen to maintain linearity of standard and sample curves on log plots. A single standard curve derived from titration of a ß+ fetal liver sample was used to quantitate all fluorescence values in terms of estimated nanograms of cDNA in the standard (Fig. 3). End-points of the real-time PCRs were run on acrylamide or agarose gels and visualized on a Molecular Dynamics fluorimager (for SYBR Green I) or by standard UV photography with added ethidium bromide stain.
The ratios of : expression as measured by end-point PCR remained the same for ß+ and ß– samples even though the ratio itself increased as the murine signals declined more rapidly than did the signals (Fig. 3B), an effect most probably indicating that amplification had exited the exponential phase of amplification (linear range on a log plot). Thus, from our experience, it appeared that serial dilution, end-point RT–PCR allowed meaningful comparisons of cDNA ratios beyond the exponential range of amplification, a point confirmed by real-time RT–PCR and primer extension results. One explanation for this finding might be that the cDNA isolation and PCR techniques employed here were devoid of inhibitors and very reproducible.
Primer extension
Primer extension was performed based on the protocol of David O’Neill (personal communication) with some modifications as follows. 2.5 pmol of oligonucleotides (Table 3) were phos- phorylated with 30 µCi (>500 Ci/mmol) of [-32P]ATP and T4 kinase. Calf intestinal phosphatase-dephosphorylated pBR322 MspI-digested fragments were treated similarly for use as size markers. Free label was removed on G25 columns (Boehringer Mannheim, Mannheim, Germany); 20 µg of tRNA was added to the primers and these were ethanol precipitated. Labeled DNAs were resuspended in RNase-free water at 1–5 x 105 d.p.m./µl. Total RNA was prepared by a guanidine thiocyanate method (48) from E17.5 post-coitum fetal livers or from human newborn placental cord blood. DNase I treatments were found to have no effect on primer extension background bands or nucleic acid optical density measurements.
Two different primers were employed, with each giving the same results except that the B primers were found to be more sensitive (12). Primer extensions were performed with varying concentrations of RNA (from 0.25 to 50 µg) since it was found that the various primers employed were saturated with different levels of RNA. For this reason, and because background bands from one primer sometimes overlapped with the signal from a second primer, most reactions were conducted with a single primer. Total RNA was hybridized to 1–3 x 105 d.p.m. of [32P]primer in 1.0 M NaCl, 0.2% SDS, 1 mM Tris 7.5, 1 mM EDTA, 20 µg of tRNA and DEPC-treated water. A 50 µl reaction was used for up to 20 µg of RNA, and then scaled up as necessary. Samples were heated at 80°C for 5 min and then hybridized at 50°C for 2–16 h in a Perkin-Elmer 9600 thermal cycler. The samples were then pipeted into 2.5 vol of ice-cold ethanol and transferred immediately to a dry ice bath. The chilled solutions were spun for up to 1 h to ensure that no counts were left in solution (as monitored by Geiger counter). Samples were washed with 80% ethanol, dried and resuspended in 19 µl of 1x reverse transcriptase buffer and 50 mM dithiothreitol (DTT), 0.5 mM dNTPs, 0.5 µl of RNasin (Promega, Madison, WI) and 4.5 µg of actinomycin D, which was found to be useful in preventing hairpin extension products of twice the expected length from the -globin RNAs. The samples were incubated with 200 U of reverse transcriptase (SuperScript II; LifeTechnologies) at 42°C for 30 min, then stopped with 20 mM EDTA. With wide (8 x 1 mm) wells used for polyacrylamide gel electrophoresis, RNase treatment was not necessary to prevent altered nucleic acid mobility for at least 50 µg of starting RNA. Reactions were brought to 200 µl with 0.3 M sodium acetate pH 7.0, then extracted with a 1:1 mixture of phenol and chloroform, followed by precipitation with 2.5 vol of ethanol. Dried pellets were resuspended in 8 µl of TE followed by 12 µl of formamide dye (80% formamide, 10 mM EDTA, and 250 µg of BPB and XC dyes). The samples were boiled for 5 min, placed on ice and loaded onto 16 cm 6% acrylamide gels containing 7 M urea. When the bromophenol blue tracking dye came near the bottom of the gel, the gel was fixed in 10% glacial acetic acid/12% methanol for 1 h, then dried on a vacuum drier. Bands were visualized and quantitated on a PhosphorImager (Molecular Dynamics).
In vitro differentiation
Two-step erythroid differentiation of ES cells was performed as described (44,54), with the following modifications. Embryoid bodies (EBs) were disaggregated for 30 min in collagenase (Type IA; Sigma, St Louis, MO) followed by one or two gentle passes though a 20 gauge needle with microscopic monitoring for cell damage, which appeared to select against EryD precursors. Kit ligand (KL, also known as stem cell factor) was obtained from Amgen (Thousand Oaks, CA), diluted in 1 mg/ml bovine serum albumin/PBS to 800 ng/6 µl (an aliquot sufficient for one 3.2 ml culture) and stored at –70°C. EBs grown in the absence of KL for 7–11 days produced many small, tightly packed colonies of orange-red +/– nucleated erythroid cells (EryP) when re-plated in erythropoeitin (EPO) + KL but almost no definitive red cell colonies (EryD). Therefore, EBs were cultured in the presence of KL and harvested after 7 days, disaggregated and plated in media containing EPO + KL; nonetheless, the presence of KL in the secondary cultures was not inhibitory to the production of EryP. Consequently, individual colonies were analyzed for globin RNA expression by RT–PCR. RNA expression confirmed what morphology suggested, namely that adding EPO + KL to secondary EB cultures does not score for EryD.
Statistical analysis
Globin levels were normalized for YAC copy number, GPI-1C chimerism and murine - or ßh1-globin levels. The average normalized globin level among different animals of a given YAC type at each developmental stage was calculated. The range of the normalized globin values was ~2-fold, consistent with the absence of position effects (as has been demonstrated previously for constructs containing an intact LCR). Comparisons without normalization were also tested to assess the influence of normalization (see Results); the data clustered by YAC type, regardless of normalization. The statistical significance of differences in average globin levels among YAC types was determined by t-tests. The threshold for significance was set at P values of <0.05 (5% chance that the results were not different) and <0.01 (1% chance that the results were not different). t-tests were performed with and without pooled variances for homogeneity of variance (F) values >0.05 and <0.05, respectively.
|
ACKNOWLEDGEMENTS |
|---|
We would like to thank Xiaolin Liang for assistance with the blastocyst injections, David O’Neill for the original primer extension protocol, Chyuan-Sheng Lin for advice on the in vitro differentiations, and Sanjay Tyagi and Salvatore Marras for use of the spectrofluorometric thermal cycler. This work was supported by a fellowship from the American Cancer Society to R.B. and NIH grant HD-17704 to F.C.
|
FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +1 212 305 6814; Fax: +1 212 923 2090; Email: fdc3@columbia.edu
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Groudine, M., Kohwi-Shigematsu, T., Gelinas, R., Stamatoyannopoulos, G. and Papayannopoulou, T. (1983) Human fetal to adult hemoglobin switching: changes in chromatin structure of the ß-globin gene locus. Proc. Natl Acad. Sci. USA, 80, 7551–7555.
2 Stalder, J., Larsen, A., Engel, J.D., Dolan, M., Groudine, M. and Weintraub, H. (1980) Tissue-specific DNA cleavages in the globin chromatin domain introduced by DNase I. Cell, 20, 451–460.[Web of Science][Medline]
3 Tuan, D., Solomon, W., Li, Q. and London, I.M. (1985) The ‘beta-like-globin’ gene domain in human erythroid cells. Proc. Natl Acad. Sci. USA, 82, 6384–6388.
4 Forrester, W.C., Thompson, C., Elder, J.T. and Groudine, M. (1986) A developmentally stable chromatin structure in the human ß-globin gene cluster. Proc. Natl Acad. Sci. USA, 83, 1359–1363.
5 Grosveld, F., van Assendelft, G.B., Greaves, D.R. and Kollias, G. (1987) Position-independent, high-level expression of the human ß-globin gene in transgenic mice. Cell, 51, 975–985.[Web of Science][Medline]
6 Blom van Assendelft, G., Hanscombe, O., Grosveld, F. and Greaves, D.R. (1989) The ß-globin dominant control region activates homologous and heterologous promoters in a tissue-specific manner. Cell, 56, 969–977.[Web of Science][Medline]
7 Forrester, W.C., Epner, E., Driscoll, M.C., Enver, T., Brice, M., Papayannopoulou, T. and Groudine, M. (1990) A deletion of the human ß-globin locus activation region causes a major alteration in chromatin structure and replication across the entire ß-globin locus. Genes Dev., 4, 1637–1649.
8 Muller, H.P. and Schaffner, W. (1990) Transcriptional enhancers can act in trans. Trends Genet., 6, 300–304.[Web of Science][Medline]
9 Walters, M.C., Fiering, S., Eidemiller, J., Magis, W., Groudine, M. and Martin, D.I. (1995) Enhancers increase the probability but not the level of gene expression. Proc. Natl Acad. Sci. USA, 92, 7125–7129.
10 Choi, O.R. and Engel, J.D. (1988) Developmental regulation of ß-globin gene switching. Cell, 55, 17–26.[Web of Science][Medline]
11 Enver, T., Raich, N., Ebens, A.J., Papayannopoulou, T., Costantini, F. and Stamatoyannopoulos, G. (1990) Developmental regulation of human fetal-to-adult globin gene switching in transgenic mice. Nature, 344, 309–313.[Medline]
12 Behringer, R.R., Ryan, T.M., Palmiter, R.D., Brinster, R.L. and Townes, T.M. (1990) Human - to ß-globin gene switching in transgenic mice. Genes Dev., 4, 380–389.
13 Townes, T.M. and Behringer, R.R. (1990) Human globin locus activation region (LAR): role in temporal control. Trends Genet., 6, 219–223.[Web of Science][Medline]
14 Anagnou, N.P., Perez-Stable, C., Gelinas, R., Costantini, F., Liapaki, K., Constantopoulou, M., Kosteas, T., Moschonas, N.K. and Stamatoyannopoulos, G. (1995) Sequences located 3' to the breakpoint of the hereditary persistence of fetal hemoglobin-3 deletion exhibit enhancer activity and can modify the developmental expression of the human fetal A -globin gene in transgenic mice. J. Biol. Chem., 270, 10256–10263.
15 Arcasoy, M.O., Romana, M., Fabry, M.E., Skarpidi, E., Nagel, R.L. and Forget, B.G. (1997) High levels of human -globin gene expression in adult mice carrying a transgene of deletion-type hereditary persistence of fetal hemoglobin. Mol. Cell. Biol., 17, 2076–2089.[Abstract]
16 Feingold, E.A. and Forget, B.G. (1989) The breakpoint of a large deletion causing hereditary persistence of fetal hemoglobin occurs within an erythroid DNA domain remote from the ß-globin gene cluster. Blood, 74, 2178–2186.
17 Townes, T.M., Lingrel, J.B., Chen, H.Y., Brinster, R.L. and Palmiter, R.D. (1985) Erythroid-specific expression of human ß-globin genes in transgenic mice. EMBO J., 4, 1715–1723.[Web of Science][Medline]
18 Enver, T., Ebens, A.J., Forrester, W.C. and Stamatoyannopoulos, G. (1989) The human ß-globin locus activation region alters the developmental fate of a human fetal globin gene in transgenic mice. Proc. Natl Acad. Sci. USA, 86, 7033–7037.
19 Raich, N., Enver, T., Nakamoto, B., Josephson, B., Papayannopoulou, T. and Stamatoyannopoulos, G. (1990) Autonomous developmental control of human embryonic globin gene switching in transgenic mice. Science, 250, 1147–1149.
20 Dillon, N. and Grosveld, F. (1991) Human -globin genes silenced independently of other genes in the ß-globin locus. Nature, 350, 252–254.[Medline]
21 Starck, J., Sarkar, R., Romana, M., Bhargava, A., Scarpa, A.L., Tanaka, M., Chamberlain, J.W., Weissman, S.M. and Forget, B.G. (1994) Developmental regulation of human - and ß-globin genes in the absence of the locus control region. Blood, 84, 1656–1665.
22 Epner, E., Reik, A., Cimbora, D., Telling, A., Bender, M.A., Fiering, S., Enver, T., Martin, D.I., Kennedy, M., Keller, G. and Groudine, M. (1998) The ß-globin LCR is not necessary for an open chromatin structure or developmentally regulated transcription of the native mouse ß-globin locus. Mol. Cell, 2, 447–455.[Web of Science][Medline]
23 Strouboulis, J., Dillon, N. and Grosveld, F. (1992) Developmental regulation of a complete 70-kb human ß-globin locus in transgenic mice. Genes Dev., 6, 1857–1864.
24 Peterson, K.R., Clegg, C.H., Huxley, C., Josephson, B.M., Haugen, H.S., Furukawa, T. and Stamatoyannopoulos, G. (1993) Transgenic mice containing a 248-kb yeast artificial chromosome carrying the human ß-globin locus display proper developmental control of human globin genes. Proc. Natl Acad. Sci. USA, 90, 7593–7597.
25 Gaensler, K.M., Kitamura, M. and Kan, Y.W. (1993) Germ-line transmission and developmental regulation of a 150-kb yeast artificial chromosome containing the human ß-globin locus in transgenic mice. Proc. Natl Acad. Sci. USA, 90, 11381–11385.
26 Bungert, J., Dave, U., Lim, K.C., Lieuw, K.H., Shavit, J.A., Liu, Q. and Engel, J.D. (1995) Synergistic regulation of human ß-globin gene switching by locus control region elements HS3 and HS4. Genes Dev., 9, 3083–3096.
27 Peterson, K.R., Clegg, C.H., Navas, P.A., Norton, E.J., Kimbrough, T.G. and Stamatoyannopoulos, G. (1996) Effect of deletion of 5'HS3 or 5'HS2 of the human ß-globin locus control region on the developmental regulation of globin gene expression in ß-globin locus yeast artificial chromosome transgenic mice. Proc. Natl Acad. Sci. USA, 93, 6605–6609.
28 Fiering, S., Epner, E., Robinson, K., Zhuang, Y., Telling, A., Hu, M., Martin, D.I., Enver, T., Ley, T.J. and Groudine, M. (1995) Targeted deletion of 5'HS2 of the murine ß-globin LCR reveals that it is not essential for proper regulation of the ß-globin locus. Genes Dev., 9, 2203–2213.
29 Hug, B.A., Wesselschmidt, R.L., Fiering, S., Bender, M.A., Epner, E., Groudine, M. and Ley, T.J. (1996) Analysis of mice containing a targeted deletion of ß-globin locus control region 5' hypersensitive site 3. Mol. Cell. Biol., 16, 2906–2912.[Abstract]
30 Martin, D.I., Fiering, S. and Groudine, M. (1996) Regulation of ß-globin gene expression: straightening out the locus. Curr. Opin. Genet. Dev., 6, 488–495.[Web of Science][Medline]
31 Dillon, N., Trimborn, T., Strouboulis, J., Fraser, P. and Grosveld, F. (1997) The effect of distance on long-range chromatin interactions. Mol. Cell, 1, 131–139.[Web of Science][Medline]
32 Wijgerde, M., Gribnau, J., Trimborn, T., Nuez, B., Philipsen, S., Grosveld, F. and Fraser, P. (1996) The role of EKLF in human ß-globin gene competition. Genes Dev., 10, 2894–2902.
33 Perkins, A.C., Gaensler, K.M. and Orkin, S.H. (1996) Silencing of human fetal globin expression is impaired in the absence of the adult ß-globin gene activator protein EKLF. Proc. Natl Acad. Sci. USA, 93, 12267–12271.
34 Perkins, A.C., Sharpe, A.H. and Orkin, S.H. (1995) Lethal ß-thalassaemia in mice lacking the erythroid CACCC-transcription factor EKLF. Nature, 375, 318–322.[Medline]
35 Nuez, B., Michalovich, D., Bygrave, A., Ploemacher, R. and Grosveld, F. (1995) Defective haematopoiesis in fetal liver resulting from inactivation of the EKLF gene. Nature, 375, 316–318.[Medline]
36 Feng, W.C., Southwood, C.M. and Bieker, J.J. (1994) Analyses of ß-thalassemia mutant DNA interactions with erythroid Kruppel-like factor (EKLF), an erythroid cell-specific transcription factor. J. Biol. Chem., 269, 1493–1500.
37 Peterson, K.R., Li, Q.L., Clegg, C.H., Furukawa, T., Navas, P.A., Norton, E.J., Kimbrough, T.G. and Stamatoyannopoulos, G. (1995) Use of yeast artificial chromosomes (YACs) in studies of mammalian development: production of ß-globin locus YAC mice carrying human globin developmental mutants. Proc. Natl Acad. Sci. USA, 92, 5655–5659.
38 Liu, Q., Bungert, J. and Engel, J.D. (1997) Mutation of gene-proximal regulatory elements disrupts human -, -, and ß-globin expression in yeast artificial chromosome transgenic mice. Proc. Natl Acad. Sci. USA, 94, 169–174.
39 Magram, J., Chada, K. and Costantini, F. (1985) Developmental regulation of a cloned adult ß-globin gene in transgenic mice. Nature, 315, 338–340.[Medline]
40 Hardison, R. and Miller, W. (1993) Use of long sequence alignments to study the evolution and regulation of mammalian globin gene clusters. Mol. Biol. Evol., 10, 73–102.[Abstract]
41 Bauchwitz, R. and Costantini, F. (1998) YAC transgenesis: a study of conditions to protect YAC DNA from breakage and a protocol for transfection. Biochim. Biophys. Acta, 1401, 21–37.[Medline]
42 Morrison, T.B., Weis, J.J. and Wittwer, C.T. (1998) Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification. Biotechniques, 24, 954–958, 960, 962.[Web of Science][Medline]
43 Brotherton, T.W., Chui, D.H., Gauldie, J. and Patterson, M. (1979) Hemoglobin ontogeny during normal mouse fetal development. Proc. Natl Acad. Sci. USA, 76, 2853–2857.
44 Keller, G., Kennedy, M., Papayannopoulou, T. and Wiles, M.V. (1993) Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol. Cell. Biol., 13, 473–486.
45 TomHon, C., Zhu, W., Millinoff, D., Hayasaka, K., Slightom, J.L., Goodman, M. and Gumucio, D.L. (1997) Evolution of a fetal expression pattern via cis changes near the globin gene. J. Biol. Chem., 272, 14062–14066.
46 Hanscombe, O., Whyatt, D., Fraser, P., Yannoutsos, N., Greaves, D., Dillon, N. and Grosveld, F. (1991) Importance of globin gene order for correct developmental expression. Genes Dev., 5, 1387–1394.
47 Burke, D.T., Carle, G.F. and Olson, M.V. (1987) Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science, 236, 806–812.
48 Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem., 162, 156–159.[Web of Science][Medline]
49 McLaren, A. and Buehr, M. (1981) GPI expression in female germ cells of the mouse. Genet. Res., 37, 303–309.[Web of Science][Medline]
50 West, J.D. (1977) Red blood cell selection in chimeric mice. Exp. Hematol., 5, 1–7.[Web of Science][Medline]
51 Murphy, L.D., Herzog, C.E., Rudick, J.B., Fojo, A.T. and Bates, S.E. (1990) Use of the polymerase chain reaction in the quantitation of mdr-1 gene expression. Biochemistry, 29, 10351–10356.[Medline]
52 Wang, A.M., Doyle, M.V. and Mark, D.F. (1989) Quantitation of mRNA by the polymerase chain reaction. Proc. Natl Acad. Sci. USA, 86, 9717–9721.
53 Heid, C.A., Stevens, J., Livak, K.J. and Williams, P.M. (1996) Real time quantitative PCR. Genome Res., 6, 986–994.
54 Wiles, M.V. and Keller, G. (1991) Multiple hematopoietic lineages develop from embryonic stem (ES) cells in culture. Development, 111, 259–267.[Abstract]
55 Wallace, R.B., Shaffer, J., Murphy, R.F., Bonner, J., Hirose, T. and Itakura, K. (1979) Hybridization of synthetic oligodeoxyribonucleotides to 
X174 DNA: the effect of single base pair mismatch. Nucleic Acids Res., 6, 3543–3557.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Beauchemin and M. Trudel Evidence for a Bigenic Chromatin Subdomain in Regulation of the Fetal-to-Adult Hemoglobin Switch Mol. Cell. Biol., March 15, 2009; 29(6): 1635 - 1648. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Xu, M. M. Scott, and E. S. Deneris Shared Long-Range Regulatory Elements Coordinate Expression of a Gene Cluster Encoding Nicotinic Receptor Heteromeric Subtypes Mol. Cell. Biol., August 1, 2006; 26(15): 5636 - 5649. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Vadolas, H. Wardan, M. Orford, L. Voullaire, F. Zaibak, R. Williamson, and P. A. Ioannou Development of sensitive fluorescent assays for embryonic and fetal hemoglobin inducers using the human beta -globin locus in erythropoietic cells Blood, December 1, 2002; 100(12): 4209 - 4216. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||