Human Molecular Genetics, 2000, Vol. 9, No. 4 589-596
© 2000 Oxford University Press
An imprinted locus associated with transient neonatal diabetes mellitus
Wessex Regional Genetics Laboratory, Salisbury District Hospital, Salisbury, Wiltshire SP2 8BJ, UK, 1The Sanger Centre, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK, 2MTL, Children’s Hospital Research Institute, Room 236, 4060 St Catherine Street West, Westmount, Quebec, Canada H3Z 2Z3, 3Department of Human Genetics, University of Kiel, 24105 Kiel, Germany, 4Institute of Child Health, St Michael’s Hill, Bristol BS2 8BJ, UK and 5Wessex Clinical Genetics Service, The Princess Anne Hospital, Southampton SO16 5YA, UK
Received 22 October 1999; Revised and Accepted 5 January 2000.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Recently, we reported the localization of a gene for transient neonatal diabetes mellitus (TNDM), a rare form of childhood diabetes, to an ~5.4 Mb region of chromosome 6q24. We have also shown that TNDM is associated with both paternal uniparental disomy (UPD) of chromosome 6 and paternal duplications of the critical region. The sequencing of P1-derived artificial chromosome clones from within the region of interest has allowed us to further localize the gene and to investigate the methylation status of the region. The gene is now known to reside in a 300–400 kb region of 6q24 which contains several CpG islands. At one island we have demonstrated differential DNA methylation between patients with paternal UPD of chromosome 6 and normal controls. In addition, two patients with TNDM, in whom neither paternal UPD of chromosome 6 nor duplication of 6q24 have been found, show a DNA methylation pattern identical to that of patients with paternal UPD of chromosome 6. Control individuals show a hemizygous methylation pattern. These results show that TNDM can be associated with a methylation change and identify a novel methylation imprint on chromosome 6 associated with TNDM.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Transient neonatal diabetes mellitus (TNDM) presents in growth retarded neonates with persistent hyperglycaemia within the first 6 weeks of life and has an incidence of ~1 in 400 000 live births. Patients usually require exogenous insulin therapy for a mean duration of 3 months while endogenous insulin levels are either extremely low or undetectable. Recovery is complete by 18 months of age (1), although ~40% of patients relapse and develop type 2 diabetes later in life (2). Clinical investigations have shown that patients with TNDM do not have islet cell antibodies or diabetes-susceptible HLA haplotypes (3). This suggests a form of diabetes with more similarities to type 2 diabetes than to the classic autoimmune-related type 1 diabetes.
We have described previously the association of both paternal uniparental isodisomy of chromosome 6 (UPD 6) and large paternal duplications of 6q24 with TNDM (4–6). These observations have been verified by others (7–10), although two cases of paternal UPD 6 are reported with no mention of TNDM (11,12). One case of maternal UPD 6 with no evidence of TNDM is also reported in the literature (13). These findings lead to the hypothesis that TNDM is caused by the overexpression of an imprinted gene which we have already localized to an ~5.4 Mb region of 6q24 (14).
In order to localize the gene further we have adopted a quantitative PCR approach to identify patients with submicroscopic duplications within the 5.4 Mb region of interest. This, in combination with sequence for the region now being available as part of the Sanger Centre’s chromosome 6 sequencing project, has enabled us to look at a small region of the genome in more detail and identify landmarks such as previously characterized genes, putative genes and CpG islands.
As all previously described imprinted genes have been associated with parent of origin methylation differences, we investigated the methylation status of the CpG islands in our region of interest. The majority of CpG dinucleotides in the genome are methylated whereas those found in CpG islands are generally protected from methylation and are associated with housekeeping genes (15). The majority of imprinted genes have an inactive methylated allele and an unmethylated active allele, although the reverse has also been found, and are mono- allelically expressed (16). Our aim was to examine the methylation status of the CpG islands within the critical region by comparing the methylation of CG sequences within methylation-sensitive restriction enzyme sites in DNA from patients with paternal UPD 6 and normal controls. Once differential methylation was detected we analysed the methylation pattern in the remainder of our TNDM patients.
Using this combination of approaches, we have further defined the critical region and have identified parent of origin specific DNA methylation indicative of imprinting. In addition we have analysed 13 patients in whom no aberration of chromosome 6 had been identified previously, and demonstrated the loss of methylation in two of them, confirming that this locus is almost certainly involved in the aetiology of TNDM.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Refinement of the region
A critical region of ~5.4 Mb had already been identified from patients with large 6q duplications. To refine this region further we adopted a quantitative PCR approach for the detection of submicroscopic duplications. We screened TNDM patients who do not have UPD 6 or a visible duplication by amplifying sequence tagged sites (STSs) and expressed sequence tags (ESTs) within the critical region in duplex with a control primer set from a different chromosome. The dosage quotient was calculated by dividing the ratio of peak height between the chromosome 6 product and the control product by the same ratio from normal control individuals. Several individuals with known duplications were also tested to allow comparison of the dosage quotients between patients and known duplications (Fig. 1 and Table 1). In five families we identified submicroscopic duplications which were overlapping and of varying size (Fig. 2). In all cases where it was possible to determine parental origin, the duplication was paternal. Duplication A was found in the proband, affected brother and affected father of family A, but not in the mother or in several other paternal female relatives. Family B has been described previously in detail (5,14) and the duplication has been paternally inherited by all the affected individuals. Duplication C is found in the proband and father, duplication D in the proband, father and brother (who had type 2 diabetes) and duplication E in the proband only, as the parents were unavailable for testing.
|
|
|
The smallest region of overlap is between the duplications found in families A and B, is between 300 and 400 kb long and is contained within a mapped contig in the 6ace database at the Sanger Centre. An exact size cannot yet be determined as one gap in the sequence tiling path remains to be closed.
Structure of the region
The newly defined critical region is covered by the P1-derived artificial chromosomes (PACs) 468K18, 340H11, 197L1 and 91J24 from which sequence is available (courtesy of the Sanger Centre; accession nos AL049844, AL109755, AL031390 and AL024474, respectively) and 83M4 which is awaiting sequencing (by the Sanger Centre). The annotated sequence of these PACs contains six CpG islands, one complete characterized gene (PLAGL1/ZAC/LOT1) (17–19) and numerous ESTs, of which we have used 11 for PCR dosage studies (stSG24859, stSG1437, stSG8766, stSG9563, stWI-11634, stEST99515, stdJ218N6T7, stSG24869, stSG27894, stSG20934 and stSG11228). These features, as well as the integrated molecular analysis of genomes and their expression (IMAGE) sequence 2073154, accession no. AI540783 (20), are shown in Figure 2.
Methylation analysis
In order to identify candidate genes we looked for features of imprinting. In particular we analysed CpG islands for the presence of methylation differences between maternal and paternal alleles using DNA from TNDM patients with paternal UPD 6 and normal controls.
HpaII and MspI restriction enzymes both cleave at CCGG sites. However, HpaII will not cleave when the internal C is methylated. DNA was digested with these two enzymes independently, followed by amplification by PCR to test for the presence or absence of a PCR product. MspI cuts regardless of methylation status and confirmed the presence of the CCGG site. A product is visible in the HpaII lane only if digestion has not occurred (i.e. the internal C is methylated). In order to make the DNA more accessible for digestion with HpaII and MspI the DNA was also digested with the restriction enzyme MseI which has the recognition site TTAA and does not cleave within the sequence amplified.
The six CpG islands indicated in Figure 2 were analysed using this method. Due to the density of CCGG restriction enzyme recognition sites it was not always possible to analyse each site individually so up to three sites were grouped in any one PCR amplification. For five of the CpG islands there was no difference in the methylation pattern observed between the paternal UPD and control samples (data not shown). However, at one island (lying at nucleotides 52444–53374 of the 340H11 sequence available from the Sanger Centre’s anonymous ftp site; accession no. AL109755) differential methylation was observed. At two sites (H11F and H11D2) within this CpG island in PAC 340H11 (Figs 2 and 3) there was no PCR product following digestion of the paternal UPD 6 DNA with HpaII/MseI whereas a product was observed after amplifying the HpaII/MseI-digested control DNA samples (Fig. 4a). This suggests that the paternal allele is unmethylated whereas the maternal allele is methylated.
|
|
We then analysed all TNDM patients who had neither paternal UPD 6 nor a duplication. This was achieved by using the above strategy but with quantitative PCR in duplex with a control set of primers and comparing the ratios from the HpaII/MseI digest PCR with the MseI-only digest PCR (Fig. 4b). Thirteen patients were tested in this way along with the paternal UPD 6 samples and normal controls using primer sets H11F and H11D2. Each PCR was set up at least twice for each individual. Two of these patients showed a methylation pattern identical to that seen with the paternal UPD 6 samples whereas the remaining 11 showed hemizygous methylation, indicated by a ratio of 0.5 rather than 1 (complete methylation) or 0 (complete unmethylation) (Fig. 4b and Table 2).
We were also able to analyse individuals with paternally and maternally inherited duplications of the region. The observed ratios reflect the presence of two unmethylated alleles and one methylated allele when the duplication is paternally inherited, and two methylated alleles and one unmethylated allele when maternally inherited (Table 2).
In addition, DNA from 50 control individuals without TNDM was digested in the same way and amplified using primer sets H11F and H11D2. The PCR products were visualized on an agarose gel and all showed the presence of the post-HpaII/MseI digestion PCR product (data not shown). This confirms that the altered methylation pattern is associated with TNDM and is not a coincidental finding.
Southern blot analysis was carried out to identify further sites within the island that exhibit hemizygous methylation in control DNA and lack of methylation in DNA from individuals with paternal UPD 6. DNA was digested with PstI alone and with PstI in duplex with the methylation-sensitive enzymes EagI, NotI, SmaI and SacII, respectively (Figs 3 and 5). PstI cleaves either side of the CpG island. Within the PstI fragment lie one EagI site, two NotI sites, two SmaI and three SacII sites. The blot was probed with IMAGE clone 2073154 located within the PstI fragment and the results are shown in Figure 5. Digestion with PstI alone gives a single band of ~3300 bases with both normal and paternal UPD 6 DNA. In control DNA, EagI partially digests the PstI fragment resulting in two bands of approximately the same intensity, one the original PstI band and a second smaller band of ~2600 bases. In contrast EagI completely digests the PstI fragment in paternal UPD 6 DNA, resulting in only a single smaller fragment being visible on the Southern blot. This indicates that the EagI site is unmethylated in paternal UPD 6 DNA and hemimethylated in control DNA, being methylated only on the maternally inherited chromosome 6. The same pattern of bands was seen with NotI digestion, one of the NotI sites overlapping the EagI site and the second NotI site presumably being fully methylated on both chromosomes, therefore not cleaving in either normal or paternal UPD 6 DNA samples. Similarly, at least one of the SmaI and one of the SacII sites exhibited hemimethylation. The sizes of the fragments seen were in all cases consistent with the DNA sequence derived from PAC 340H11 by the Sanger Centre (accession no. AL109755).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
We have shown previously that TNDM can result from paternal uniparental disomy (UPD) and from large paternally inherited duplications of chromosome 6 (4–6). This led us to theorize that TNDM is caused by overexpression of the paternal allele of an imprinted gene and that some non-UPD 6 patients with no obvious duplication may have small, submicroscopic duplications. We have now found five such cases which define a critical region of 300–400 kb in which the TNDM gene must lie. Paternal UPD 6 and paternal duplications account for approximately three-quarters of cases of TNDM (I.K. Temple, R.J. Gardner, D.J.G. Mackay, J.C.K. Mackay, J.C.K. Barber, D.O. Robinson and J.P.H. Shield, submitted for publication) and we have now identified a further two patients with loss of methylation. We have therefore identified a novel imprinted locus on chromosome 6 which is defined by at least five CG sites which differ in their methylation status between the paternally and maternally inherited homologues.
The finding of a differentially methylated CpG island is indicative of an imprinted gene and the occurrence of methylation mutations at this locus in two patients with TNDM and not in 50 control individuals confirms its involvement in TNDM. There are at least two other possible explanations for these findings. An individual with a maternal deletion would have a methylation pattern identical to that of the paternal UPD 6 patients when viewed on an agarose gel. If this were the case the methylation ratio would be altered as the PCR following digestion with MseI alone would only be amplifying one copy (Table 2). This has not been observed and in addition, the quantitative PCR analysis of the critical region has not given any ratios which are indicative of a deletion rather than a duplication. Gene conversion is another possibility. However, both methy- lation mutation patients show heterozygosity of the adjacent polymorphic marker D6S310 (data not shown).
Our observations provide a mechanism for the cause of TNDM in two patients without paternal UPD or a paternal duplication of 6q. This leaves 11 TNDM patients in whom neither an aberration of chromosome 6 nor a methylation mutation could be identified. This is not surprising given the numerous mechanisms causing other disorders associated with imprinting, e.g. Beckwith–Wiedemann syndrome (21). Overexpression could be caused by the up-regulation of a gene due to an enhancer or regulatory sequence mutation. It is also possible that some patients have a very small duplication covering a single gene or regulatory region, though extensive coverage of the critical region by quantitative PCR analysis has not revealed such a duplication.
Although on some chromosomes imprinted genes are known to cluster (e.g. in the Beckwith–Wiedemann region on chromosome 11 and the Prader–Willi/Angelman syndrome region on chromosome 15) (22), we were able to identify differential methylation in only one CpG island in the critical region. It is possible that other genes on chromosome 6 in the critical region are imprinted and may be differentially methylated at sites other than those that we have investigated. Apart from TNDM, patients with paternal UPD 6 have no other clinical features, although macroglossia and umbilical hernia have been reported occasionally (I.K. Temple et al., submitted for publication). The relatively mild nature of the TNDM phenotype suggests that there may be few imprinted genes on chromosome 6. IGF2R, which is located ~44 cR3000 telomeric to the imprinted CpG island in the TNDM critical region, exhibits methylation differences with evidence that it may be subject to polymorphic imprinting (23).
Imprinted genes are reported to have several distinguishing features. It has been suggested that they have few and small introns (24) and are associated with direct repeats, though the repeats themselves are unique to each gene (25). They are differentially methylated, leading to monoallelic expression (16), and potential imprinting centres have been identified in some cases, although there is no consensus as to what defines an imprinting centre (26,27).
As it is duplication or overexpression rather than deletion of a gene that causes TNDM, candidate genes cannot be analysed by the standard mutation detection methods in the hope of identifying frameshift or stop mutations. Therefore, we will look for monoallelic expression of all candidate genes. To do this a transcribed polymorphism must be identified within the gene of interest, and an expressing tissue identified. As TNDM affects neonates who are growth-retarded at birth, it is probable that the gene has a role in development and it may be necessary to determine the stage of development during which the gene is expressed. These factors may make the identification of monoallelic expression of such a gene difficult. An example of this is UBE3A, the gene for Angelman syndrome. Monoallelic expression has only been detected in the brain whereas there is biallelic expression in other tissues (28,29). There is also the possibility that, as has been suggested for IGF2R, the gene for TNDM may be polymorphically imprinted (23). Therefore, despite the finding of a differentially methylated locus for TNDM, it may be some time before a monoallelically expressed gene is identified.
Our minimal duplicated region contains numerous ESTs but our search is confined to genes lying entirely within it and, more specifically, to those lying closer to the imprinted CpG island than to its unimprinted neighbours. One strong candidate is the IMAGE clone 2073154, accession no. AI540783 (20), which partially overlaps the island. Another candidate is PLAGL1, accession no. NM002656 (17), which has also been described as ZAC, accession no. AJ006354 (18), and LOT1, accession no. U72621 (19), and is CpG rich and highly methylated in both control and UPD 6 individuals. It lies 85 kb from the imprinted CpG island, but may nonetheless be subject to imprinted control.
In conclusion, we have further narrowed the TNDM critical region from 5.4 Mb to 300–400 kb and have identified parent of origin specific methylation differences in a CpG island within this region. Furthermore, we have found a loss of methylation in two TNDM patients, demonstrating that methylation at this locus is involved in the aetiopathogenesis of transient neonatal diabetes mellitus.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Patients
All patients included in the study were referred to us with a diagnosis of TNDM and presented with persistent hyper- glycaemia within the first 6 weeks of life (in pregnancies of >35 weeks gestation) and recovered by 18 months. Our control population was selected anonymously from samples already collected and stored within the department. DNA was extracted from whole blood using a salt precipitation method (30). Patients were first tested for UPD 6 followed by duplication analysis if they did not have UPD 6. Methylation analysis was only carried out on patients who did not have UPD 6 or a duplication.
Mapping and sequence information
Mapping information was obtained from the Sanger Centre’s chromosome 6 mapping database via the internet (http://www.sanger.ac.uk/HGP/Chr6/ ). Sequence information was obtained from the Sanger Centre’s anonymous ftp site (ftp://ftp.sanger.ac.uk/pub/human/sequences/Chr_6/ ). All PACs were isolated from a library kindly donated to the Sanger Centre by Pieter de Jonge (http://bacpac.med.buffalo.edu ).
Primer design and manufacture
Primers were either ordered according to the sequences given in the Sanger Centre’s chromosome 6 database or designed in-house from the available sequence. Primers were manufactured by either MWG Biotech (Milton Keynes, UK) or Interactiva Biotechnology (Ulm, Germany).
Duplication detection by quantitative PCR
A 100 ng aliquot of DNA was amplified in duplex by a set of primers from chromosome 6 and a control set of primers for Dp2.54 on chromosome 5 (31). The chromosome 6 primers were: stSG24859, stSG1437, stSG8766, stSG9563, stWI-11634, stEST99515, stdJ218N6T7, stSG24869, stSG27894, stSG20934 and stSG11228. One primer from each pair was labelled with a fluorophore during manufacture. The DNA was amplified using Hotstar Taq (Qiagen, Crawley, UK) as recommended by the manufacturer with additional MgCl2 to a final concentration of 2 mM. The concentrations of the primers were varied in order to optimize the duplex PCR. Amplification was in a Perkin Elmer (Warrington, UK) 9600 programmable heating block using the following conditions: 95°C for 15 min followed by 19 cycles (to keep the amplification in the exponential phase) of 94°C for 45 s; 52–58°C for 45 s (depending on the annealing temperatures of the individual primer sets); 72°C for 1 min followed by 7 min at 72°C and 1 h at 60°C. PCR products were run on an ABI 377 automated sequencer for separation and visualization.
For each PCR and gel a set of controls with and without known duplications of 6q was included. The ratio of the peak height between the chromosome 6 product and the control product was calculated and the dosage quotient determined by dividing the patient ratio by the average ratio obtained from the normal control samples.
PCR amplification of sites showing parent of origin specific methylation differences
The initial analysis to determine whether a site was differentially methylated was carried out on DNA samples from TNDM patients with paternal UPD 6 and normal controls. Three digests were carried out per sample. DNA (2 µg) was digested overnight at 37°C with 3 U of HpaII and MseI, of MspI and MseI and of MseI alone in a total volume of 20 µl. The following morning an additional 3 U of each enzyme was added and incubated for a further hour. They were then diluted to a final concentration of 25 ng/µl. The samples were amplified by PCR using primer sets H11F and H11D2 to analyse the CpG island lying at nucleotides 52444–53374 of the 340H11 sequence (available from the Sanger Centre’s anonymous ftp site; accession no. AL109755). The primer sequences were H11D2, TGTGGGTGCCGCTCAGCTCC and GGATGGCTGCGCCGAGGAGG (nucleotides 53179–53199 and 53030–53050), and H11F, GCGGAGACTTCGGCTAGCAG and GGAGCTGAGCGGCACCCCACA (nucleotides 53299–53316 and 53179–53199). For primer set H11F 10% DMSO and 100 µM 7-deaza dGTP were included in the PCR, while primer set H11D2 required 10% DMSO, 200 µM 7-deaza dGTP. Amplification conditions were: 95°C for 15 min followed by 30 (H11F) or 35 (H11D2) cycles of 94°C for 10 s, 52–58°C (depending on the annealing temperature of the primer pairs) for 30 s and 72°C for 30 s. This was followed by 72°C for 7 min. These samples were subsequently analysed on a 2% agarose gel to test for the presence or absence of a post-digestion PCR product.
DNA from TNDM patients was digested as described above. For dosage PCR, 50 ng digested DNA was amplified using primer sets H11F and H11D2 in duplex with the control set stSG24869, using the same amplification conditions as above except that 20 and 22 rounds of amplification were used for F and D2, respectively. Each individual was analysed at least twice.
The analysis within each lane was also the same as for the quantitative PCR. To calculate the degree of methylation, the ratios of the HpaII/MseI-digested samples were compared with the ratio obtained following amplification of the sample digested with MseI alone. The 50 control samples analysed were digested and amplified in the same way as the initial paternal UPD 6 and control samples and visualized on 2% agarose gels.
Southern blot analysis to show parent of origin specific methylation differences
Southern blot analysis was carried out using standard techniques (32). Aliquots (7 µg) of normal control DNA and DNA from paternal UPD 6 individuals were digested with PstI, PstI + EagI, PstI + NotI, PstI + SmaI and PstI + SacII. The blot was probed with IMAGE clone 2073154 (20) (Fig. 3).
|
ACKNOWLEDGEMENTS |
|---|
We would like to thank the chromosome 6 mapping and sequencing teams at the Sanger Centre for the genome information (http://www.sanger.ac.uk/HGP/Chr6/ ). We are extremely grateful to Drs R. Santer, D. Carson, M. Gonthier, R. Grabs-Palma, A. Fergusson, S. Wilson, V. Datta, G. Valerio, A. Franzese and P. McNally and all of the referring clinicians for sending patient samples to us. We also thank Professor Patricia Jacobs and Mr John Barber for their help and encouragement. R.J.G. and D.J.G.M. are supported by a grant from the British Diabetic Association and work at the Sanger Centre is supported by the Wellcome Trust.
|
|
FOOTNOTES |
|---|
+ These authors contributed equally to this work
§ To whom correspondence should be addressed. Tel: +44 1722 336262 ext. 4080; Fax: +44 1722 338095; Email: drobinso@hgmp.mrc.ac.uk
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Shield, J.P.H., Gardner, R.J., Wadsworth, E.J.K., Whiteford, M.L., James, R.S., Robinson, D.O., Baum, J.D. and Temple, I.K. (1997) Aetiopathology and genetic basis of neonatal diabetes. Arch. Dis. Child., 76, F39–F42.
2 Shield, J.P.H. and Baum, J.D. (1993) Is transient neonatal diabetes a risk factor for diabetes in later life? Lancet, 341, 693.[Web of Science][Medline]
3 Shield, J.P.H., Howell, W.M. and Temple, I.K. (1997) Neonatal diabetes. Diabetes Care, 20, 1045–1046.
4 Temple, I.K., James, R.S., Crolla, J.A., Sitch, F.L., Jacobs, P.A., Howell, W.M., Betts, P., Baum, J.D. and Shield, J.P.H. (1995) An imprinted gene (s) for diabetes? Nature Genet., 9, 110–112.[Web of Science][Medline]
5 Temple, I.K., Gardner, R.J., Robinson, D.O., Kibirige, M.S., Fergusson, A.W., Baum, J.D., Barber, J.C.K., James, R.S. and Shield, J.P.H. (1996) Further evidence for an imprinted gene for neonatal diabetes localised to chromosome 6q22–q23. Hum. Mol. Genet., 5, 1117–1123.
6 Gardner, R.J., Robinson, D.O., Lamont, L., Shield, J.P.H. and Temple, I.K. (1998) Paternal uniparental disomy of chromosome 6 and transient neonatal diabetes mellitus. Clin. Genet., 54, 522–526.[Web of Science][Medline]
7 Whiteford, M.L., Narendra, A., White, M.P., Cooke, A., Wilkinson, A.G., Robertson, K.J. and Tolmie, J.L. (1997) Paternal uniparental disomy for chromosome 6 causes transient neonatal diabetes. J. Med. Genet., 34, 167–168.
8 Hermann, R. and Soltesz, G. (1997) Paternal uniparental isodisomy of chromosome 6 in transient neonatal diabetes mellitus. Eur. J. Pediatr., 156, 740.
9 Arthur, E.I., Zlotogora, J., Lerer, I., Dagan, J., Marks, K. and Abeliovich, D. (1997) Transient neonatal diabetes mellitus in a child with invdup(6) (q22q23) of paternal origin. Eur. J. Hum. Genet., 5, 417–419.[Web of Science][Medline]
10 Christian, S.L., Rich, B.H., Loebl, C., Israel, J., Vasa, R., Kittikamron, K., Spiro, R., Rosenfield, R. and Ledbetter, D.H. (1999) Significance of genetic testing for paternal uniparental disomy of chromosome 6 in neonatal diabetes mellitus. J. Pediat., 134, 42–46.[Web of Science][Medline]
11 Welch, T.R., Beischel, L.S., Choi, E., Balakrishnan, K. and Bishof, N.A. (1990) Uniparental isodisomy 6 associated with deficiency of the fourth component of complement. J. Clin. Invest., 86, 675–678.
12 Bittencourt, M.C., Morris, M.A., Chabod, J., Gos, A., Lamy, B., Fellmann, F., Antonarakis, S.E., Plouvier, E., Herve, P. and Tiberghien, P. (1997) Fortuitous detection of uniparental isodisomy of chromosome 6. J. Med. Genet., 34, 77–79.
13 van den Berg-Loonen, E.M., Savelkoul, P., van Hooff, H., van Eede, P., Riesewijk, A. and Geraedts, J. (1996) Uniparental maternal disomy 6 in a renal transplant patient. Hum. Immunol., 45, 46–51.[Web of Science][Medline]
14 Gardner, R.J., Mungall, A.J., Dunham, I., Barber, J.C.K., Shield, J.P.H., Temple, I.K. and Robinson, D.O. (1999) Localization of a gene for transient neonatal diabetes mellitus to an 18.72 cR (3000) (~5.4 Mb) interval on chromosome 6q. J. Med. Genet., 36, 192–197.
15 Bird, A.P. (1995) Gene number, noise reduction and biological complexity. Trends Genet., 11, 94–100.[Web of Science][Medline]
16 Bartolomei, M.S. (1994) The search for imprinted genes. Nature Genet., 6, 220–221.[Web of Science][Medline]
17 Kas, K., Voz, M.L., Hensen, K., Meyen, E. and van de Ven, W.J.M. (1998) Transcriptional activation capacity of the novel PLAG family of zinc finger proteins. J. Biol. Chem., 36, 23026–23032.
18 Varrault, A., Ciani, E., Apiou, F., Bilanges, B., Hoffmann, A., Pantaloni, C., Bockaert, J., Spengler, D. and Journot, L. (1998) hZAC encodes a zinc finger protein with antiproliferative properties and maps to a chromosomal region frequently lost in cancer. Proc. Natl Acad. Sci. USA, 95, 8835–8840.
19 Abdollahi, A., Roberts, D., Godwin, A.K., Schultz, D.C., Sonoda, G., Testa, J.R. and Hamilton, T.C. (1997) Identification of a zinc-finger gene at 6q25: a chromosomal region implicated in development of many solid tumors. Oncogene, 14, 1973–1979.[Web of Science][Medline]
20 Lennon, G.G., Auffray, C., Polymeropoulos, M. and Soares, M.B. (1996) The I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their expression. Genomics, 33, 151–152.[Web of Science][Medline]
21 Li, M., Squire, J.A. and Weksberg, R. (1998) Molecular genetics of Wiedemann–Beckwith syndrome. Am. J. Med. Genet., 79, 253–260.[Web of Science][Medline]
22 Reik, W. and Maher, E.R. (1997) Imprinting in clusters: lessons from Beckwith–Wiedemann syndrome. Trends Genet., 13, 330–334.[Web of Science][Medline]
23 Xu, Y., Grundy, P. and Polychronakos, C. (1997) Aberrant imprinting of the insulin-like growth factor II receptor gene in Wilm’s tumor. Oncogene, 14, 1041–1046.[Web of Science][Medline]
24 Hurst, L.D., McVean, G. and Moore, T. (1996) Imprinted genes have few and small introns. Nature Genet., 12, 237–241.[Web of Science][Medline]
25 Neumann, B., Kubicka, P. and Barlow, D.P. (1995) Characteristics of imprinted genes. Nature Genet., 9, 12–13.[Web of Science][Medline]
26 Buiting, K., Saitoh, S., Gross, S., Dittrich, B., Schwartz, S., Nicholls, R.D. and Horsthemke, B. (1995) Inherited microdeletions in the Angelman and Prader–Willi syndromes define an imprinting centre on human chromosome 15. Nature Genet., 9, 395–400.[Web of Science][Medline]
27 Reik, W., Brown, K.W., Schneid, H., Lebouc, Y., Bickmore, W. and Maher, E.R. (1995) Imprinting mutations in the Beckwith–Wiedemann syndrome suggested by an altered imprinting pattern in the IGF2-H19 domain. Hum. Mol. Genet., 4, 2379–2387.
28 Rougeulle, C., Glatt, H. and Lalande, M. (1997) The Angelman syndrome candidate gene, UBE3A/E6-Ap, is imprinted in brain. Nature Genet., 17, 14–15.[Web of Science][Medline]
29 Vu, T.H. and Hoffman, A.R. (1997) Imprinting of the Angelman syndrome gene, UBE3A, is restricted to brain. Nature Genet., 17, 12–14.[Web of Science][Medline]
30 Miller, S.A., Dykes, D.D. and Polesky, H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res., 16, 1215.
31 Groden, J., Thliveris, A., Samowitz, W., Carlson, M., Gelbert, L., Albertsen, H., Joslyn, G., Stevens, J., Spirio, L., Robertson, M. et al. (1991) Identification and characterization of the familial adenomatous polyposis coli gene. Cell, 66, 589–600.[Web of Science][Medline]
32 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  G. M. Aceto, L. De Lellis, T. Catalano, S. Veschi, P. Radice, A. Di Iorio, R. Mariani-Costantini, A. Cama, and M. C. Curia Nonfluorescent Denaturing HPLC-Based Primer-Extension Method for Allele-Specific Expression: Application to Analysis of Mismatch Repair Genes Clin. Chem., September 1, 2009; 55(9): 1711 - 1718. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Amor and J. Halliday A review of known imprinting syndromes and their association with assisted reproduction technologies Hum. Reprod., December 1, 2008; 23(12): 2826 - 2834. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Aguilar-Bryan and J. Bryan Neonatal Diabetes Mellitus Endocr. Rev., May 1, 2008; 29(3): 265 - 291. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Polak, A. Dechaume, H. Cave, R. Nimri, H. Crosnier, V. Sulmont, M. de Kerdanet, R. Scharfmann, Y. Lebenthal, P. Froguel, et al. Heterozygous Missense Mutations in the Insulin Gene Are Linked to Permanent Diabetes Appearing in the Neonatal Period or in Early Infancy: A Report From the French ND (Neonatal Diabetes) Study Group Diabetes, April 1, 2008; 57(4): 1115 - 1119. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Flanagan, A.-M. Patch, D. J.G. Mackay, E. L. Edghill, A. L. Gloyn, D. Robinson, J. P.H. Shield, K. Temple, S. Ellard, and A. T. Hattersley Mutations in ATP-Sensitive K+ Channel Genes Cause Transient Neonatal Diabetes and Permanent Diabetes in Childhood or Adulthood Diabetes, July 1, 2007; 56(7): 1930 - 1937. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C Diatloff-Zito, A Nicole, G Marcelin, H Labit, E Marquis, C Bellanne-Chantelot, and J J Robert Genetic and epigenetic defects at the 6q24 imprinted locus in a cohort of 13 patients with transient neonatal diabetes: new hypothesis raised by the finding of a unique case with hemizygotic deletion in the critical region J. Med. Genet., January 1, 2007; 44(1): 31 - 37. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Babenko, M. Polak, H. Cave, K. Busiah, P. Czernichow, R. Scharfmann, J. Bryan, L. Aguilar-Bryan, M. Vaxillaire, and P. Froguel Activating mutations in the ABCC8 gene in neonatal diabetes mellitus. N. Engl. J. Med., August 3, 2006; 355(5): 456 - 466. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Gloyn, D. J.G. Mackay, M. N. Weedon, M. I. McCarthy, M. Walker, G. Hitman, B. A. Knight, K. R. Owen, A. T. Hattersley, and T. M. Frayling Assessment of the Role of Common Genetic Variation in the Transient Neonatal Diabetes Mellitus (TNDM) Region in Type 2 Diabetes: A Comparative Genomic and Tagging Single Nucleotide Polymorphism Approach. Diabetes, August 1, 2006; 55(8): 2272 - 2276. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. T. Hattersley and E. R. Pearson Minireview: Pharmacogenetics and Beyond: The Interaction of Therapeutic Response, {beta}-Cell Physiology, and Genetics in Diabetes Endocrinology, June 1, 2006; 147(6): 2657 - 2663. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Koster, M. A. Permutt, and C. G. Nichols Diabetes and Insulin Secretion: The ATP-Sensitive K+ Channel (KATP) Connection Diabetes, November 1, 2005; 54(11): 3065 - 3072. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Basyuk, V. Coulon, A. Le Digarcher, M. Coisy-Quivy, J.-P. Moles, A. Gandarillas, and L. Journot The Candidate Tumor Suppressor Gene ZAC Is Involved in Keratinocyte Differentiation and Its Expression Is Lost in Basal Cell Carcinomas Mol. Cancer Res., September 1, 2005; 3(9): 483 - 492. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Gloyn, F. Reimann, C. Girard, E. L. Edghill, P. Proks, E. R. Pearson, I. K. Temple, D. J.G. Mackay, J. P.H. Shield, D. Freedenberg, et al. Relapsing diabetes can result from moderately activating mutations in KCNJ11 Hum. Mol. Genet., April 1, 2005; 14(7): 925 - 934. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Valerio, A. Franzese, M. Salerno, G. Muzzi, G. Cecere, K. I. Temple, and J. P. Shield {beta}-Cell Dysfunction in Classic Transient Neonatal Diabetes Is Characterized by Impaired Insulin Response to Glucose but Normal Response to Glucagon Diabetes Care, October 1, 2004; 27(10): 2405 - 2408. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J P H Shield, I K Temple, M Sabin, D Mackay, D O Robinson, P R Betts, D J Carson, H Cave, D Chevenne, and M Polak An assessment of pancreatic endocrine function and insulin sensitivity in patients with transient neonatal diabetes in remission Arch. Dis. Child. Fetal Neonatal Ed., July 1, 2004; 89(4): F341 - F343. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Abdollahi, D. Pisarcik, D. Roberts, J. Weinstein, P. Cairns, and T. C. Hamilton LOT1 (PLAGL1/ZAC1), the Candidate Tumor Suppressor Gene at Chromosome 6q24-25, Is Epigenetically Regulated in Cancer J. Biol. Chem., February 14, 2003; 278(8): 6041 - 6049. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Hoffmann, E. Ciani, J. Boeckardt, F. Holsboer, L. Journot, and D. Spengler Transcriptional Activities of the Zinc Finger Protein Zac Are Differentially Controlled by DNA Binding Mol. Cell. Biol., February 1, 2003; 23(3): 988 - 1003. [Abstract] [Full Text]
|
|
|
|
|
|
I K Temple and J P H Shield Transient neonatal diabetes, a disorder of imprinting J. Med. Genet., December 1, 2002; 39(12): 872 - 875. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L Faivre, V Cormier-Daire, J M Lapierre, L Colleaux, S Jacquemont, D Genevieve, P Saunier, A Munnich, C Turleau, S Romana, et al. Deletion of the SIM1 gene (6q16.2) in a patient with a Prader-Willi-like phenotype J. Med. Genet., August 1, 2002; 39(8): 594 - 596. [Full Text] [PDF]
|
|
|
|
|
|
E Marquis, J J Robert, C Bouvattier, C Bellanne-Chantelot, C Junien, and C Diatloff-Zito Major difference in aetiology and phenotypic abnormalities between transient and permanent neonatal diabetes J. Med. Genet., May 1, 2002; 39(5): 370 - 374. [Full Text] [PDF]
|
|
|
|
|
|
J. Nakae, Y. Kido, and D. Accili Distinct and Overlapping Functions of Insulin and IGF-I Receptors Endocr. Rev., December 1, 2001; 22(6): 818 - 835. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Arima, R. A. Drewell, K. L. Arney, J. Inoue, Y. Makita, A. Hata, M. Oshimura, N. Wake, and M. A. Surani A conserved imprinting control region at the HYMAI/ZAC domain is implicated in transient neonatal diabetes mellitus Hum. Mol. Genet., July 1, 2001; 10(14): 1475 - 1483. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Varrault, B. Bilanges, D. J. G. Mackay, E. Basyuk, B. Ahr, C. Fernandez, D. O. Robinson, J. Bockaert, and L. Journot Characterization of the Methylation-sensitive Promoter of the Imprinted ZAC Gene Supports Its Role in Transient Neonatal Diabetes Mellitus J. Biol. Chem., May 25, 2001; 276(22): 18653 - 18656. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||