Human Molecular Genetics, 2000, Vol. 9, No. 5 675-684
© 2000 Oxford University Press
Characterization of the Schizosaccharomyces pombe orthologue of the human survival motor neuron (SMN) protein
Departments of Human Anatomy and Genetics and 1Biochemistry, University of Oxford, South Parks Road, Oxford OX1 3QX, UK
Received 15 October 1999; Revised and Accepted 7 February 2000.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Childhood onset spinal muscular atrophy (SMA) is a common autosomal recessive disorder primarily characterized by the loss of lower
motor neurons. The underlying chromosomal defects causing SMA have been found in the survival motor neuron (SMN) gene. SMN has been shown previously to play a role in both snRNP biogenesis and mRNA processing, although direct evidence for the relationship between SMN and disease pathology has not been elucidated. SMN orthologues have been isolated in many species including Caenorhabditis elegans and Danio rerio. To study the function of SMN, we have identified and characterized the Schizosaccharomyces pombe orthologue of human SMN, smn1+. We have demonstrated that smn1+ is essential for viability in S.pombe and yeast expressing missense mutations in Smn1p, which mimic mutations in patients with Type I SMA, show significant mislocalization of the protein and a decrease in cell viability. Wild-type Smn1p is localized predominantly in the nucleus whereas yeast expressing Smn1p with missense mutations or deletions of specific domains of the protein accumulate cytoplasmic aggregates. Overexpression of Smn1p results in an increase in the growth rate of cells. Furthermore, mutations within two highly conserved protein interaction domains have a dominant-negative effect on growth, indicating that each domain is of functional significance in S.pombe. These dominant phenotypes can be suppressed by overexpression of murine Smn in the same cell. Given the structural and functional similarities between the protein in fission yeast and higher eukaryotes, S.pombe will be an ideal organism to study the role of SMN in RNA processing. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Childhood onset proximal spinal muscular atrophy (SMA) is an autosomal recessive genetic disorder that is characterized by the loss of lower
motor neurons and proximal muscle wasting. SMA has an estimated incidence of 1 in 10 000 live births and a carrier frequency of 1 in 50 (1). Severity of SMA varies across a broad spectrum of phenotypes (2). The most severe form, Type I SMA (Werdnig–Hoffmann disease; OMIM 253300) has an onset either in utero or shortly after birth, resulting in death before 2 years through respiratory failure. Type II SMA (OMIM 253550), the intermediate form, has onset before the age of 18 months and patients are unable to walk. Survival is dependent on the amount of respiratory involvement. The milder form, Type III SMA (Kugelberg–Welander disease; OMIM 253400) has an onset after 18 months with patients able to move unaided. The causative defects of SMA in all three forms have been mapped to chromosome 5q13 (3–5). Patients demonstrate either deletions or mutations within the survival motor neuron (SMN) gene mapped to this critical region (6–9). Two almost identical copies of SMN exist within a duplicated 500 kb fragment: SMN1, the most telomeric copy, and SMN2, the centromeric copy. Two exonic nucleotide differences distinguish SMN1 from SMN2 although no amino acid differences result (10). SMN1 produces predominantly full-length transcript as well as alternatively spliced message lacking exon 5; whereas the SMN2 gene mainly produces transcripts lacking exon 5, 7 or both (6,11,12). SMN2 also produces a reduced amount of full-length message. Deletions, mutations and gene conversion events in SMN1 have been reported in 95% of SMA patients (6,8,13–16). Deletion of SMN2 occurs in 5% of normal individuals and is not associated with the disease (6). A correlation between SMA phenotype and copy number of SMN2 exists, indicating that SMN2 is able to partially compensate for the loss of SMN1 protein (16–18). There is also a direct correlation between the amount of protein present and SMA phenotype (19,20).
SMN is ubiquitously expressed and has recently been shown to play a role in RNA splicing and snRNP biogenesis (21–23). The protein is localized in the nucleus in structures termed gemini of coiled bodies (gems), which colocalize with coiled bodies (24). The SMN protein has a number of functionally conserved domains. RNA-binding abilities of SMN have been reported for exon 2a (25), whereas exon 6 is required for self-oligomerization (26). Exon 3 of SMN shows some homology to the repetitive tudor domain of Drosophila melanogaster Tudor protein (27). Exon 6 of SMN has a YG box motif that has been implicated in RNA binding and processing proteins (28).
How a defect in a basal function such as snRNP biogenesis results in such a tissue specific phenotype is not well understood. Recently a dominant-negative effect was reported with a deletion mutation of the first 27 amino acids of SMN (SMN
N27), which causes reorganization of snRNPs in the nucleus (23). The over-expression of exon 7 deleted SMN results in a dominant-negative effect on the localization of endogenous SMN protein in gems (29). To better understand the human SMN protein, a number of model systems have been studied. The SMN protein is highly conserved throughout evolution and a number of orthologous proteins have been analysed. Murine Smn, when deleted, results in a pre-implantation embryonic lethal phenotype although the heterozygous mouse is phenotypically normal (30). SMN is also conserved in the zebrafish, Danio rerio, and the nematode, Caenorhabditis elegans, both of which show RNA-binding abilities associated with exon 2a (31). We have used bioinformatics to identify a putative SMN orthologue in Schizosaccharomyces pombe (fission yeast) (28). However, no such orthologue was identified in Saccharomyces cerevisiae. These ascomycetes are not closely related in evolutionary terms and protein sequence comparisons have shown that Schizosaccharomyces pombe is as distant from Saccharomyces cerevisiae as it is from mammals (32). Approximately 40% of fission yeast genes contain introns, nearly half with more than one, unlike S.cerevisiae genes, which rarely have introns (33,34). The Schizosaccharomyces pombe gene structure is more similar to that of vertebrate genes than to that of Saccharomyces cerevisiae. In addition, the splicing signals are conserved between fission yeast and mammals but not between S.cerevisiae and mammals (35,36). A number of fission yeast genes show a high degree of homology with genes of other species and conservation of function has been demonstrated by the functional complementation of an increasing number of Schizosaccharomyces pombe mutants with mammalian genes (37). The study of yeast has been valuable in the functional analysis of human disease genes like ATM, the gene responsible for ataxia telangiectasia, which shows strong homology to yeast MEC1 and TEL1 (38). Schizosaccharo- myces pombe is increasingly being used as a model for functional analysis of eukaryotic genes (for a review see ref. 39).
We have therefore initiated studies of the S.pombe smn1+ orthologue to analyse the function of SMN and to determine how mutations in highly conserved regions, as well as specific missense mutations that mimic those found in SMA patients, affect cellular phenotypes. The protein product of smn1+, Smn1p, shows a significant level of homology to the human SMN protein, in particular in domains with conserved function. We show that Smn1p is an essential protein in S.pombe. We have analysed the effects of overexpression of Smn1p and performed a mutational analysis of the S.pombe gene.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Characterization of S.pombe SMN orthologue sequence
We have previously reported the identification through bioinformatic methods of a putative orthologue of the survival motor neuron (SMN) protein in S.pombe (28). Using the human SMN (GenBank accession no. Q16637) amino acid sequence for BLASTP analysis (40) on the Sanger Centre Sequencing Project database server, an open reading frame (ORF) was identified as a putative S.pombe SMN orthologue. Cosmid c2G11 contains the predicted ORF C2G11.08C (GenBank accession no. Q09808) that we have named as smn1+ in this manuscript. The 515 nucleotide ORF consists of two exons and encodes a 152 amino acid protein with predicted size of 17.4 kDa. A single transcript of ~500 bp was identified in total RNA from growing haploid cells (data not shown). The protein has no known function and shows a high degree of amino acid conservation with human SMN and its other reported orthologues. Overall identity between S.pombe Smn1p and human SMN is ~25% at the amino acid level. The putative peptide sequence contains stretches of amino acids that are highly homologous to two distinct regions of the SMN protein: the N-terminal region is known in human SMN to bind SIP1 (21,22) and to be important for RNA processing and snRNP biogenesis; the C-terminal region in human SMN binds a number of proteins including fibrillarin and the Sm core proteins (22,24) (Fig. 1A). It is important to note that the putative YG box is highly conserved (28). It is also noteworthy that although the overall length of each orthologue seen in Figure 1A differs, the size of the conserved regions remains similar. Evolutionary distances of the nucleotide sequence for each orthologue is diagrammatically represented in Figure 1B.
|
smn1+ is an essential gene
In order to determine the effect of the loss of Smn1p function, the chromosomal smn1+ gene was disrupted with the S.pombe ura4+ gene using a one-step replacement via homologous recombination (41). A construct was made (psmn::ura4) in which the complete smn1+ ORF was replaced by a 1.8 kb marker fragment containing the ura4+ gene (42). A linear 3.8 kb NotI–NcoI fragment of this plasmid containing the deleted region was then used to transform a wild-type diploid strain (sp101) and transformants able to grow on media lacking uracil were selected. Stable ura4+ colonies were isolated and Southern blot analysis was used to confirm that a single copy of the ura4+ gene had integrated at the smn1+ locus (Fig. 2A). An h90 derivative (a revertant of h+, which produces 90% of cells able to sporulate) was isolated and sporulated to give asci containing four haploid spores each. The spores were dissected out from a number of asci on complete YES media using a micromanipulator (Singer MSM Series 200 system) and were allowed to germinate. Only two of four spores in each ascus were viable (Fig. 2B) and all these viable spores were ura– (Fig. 2C), indicating that the smn1+ gene is essential for cell viability.
|
Overexpression analysis of smn1+ and mutant derivatives
One way to analyse the putative function of a protein when that protein is essential to cell viability is to introduce mutations or deletions to create dominant-negative phenotypes. A dominant-negative phenotype arises when the presence of a mutated version of a protein is sufficient to interfere with the function of the wild-type form of the protein. Overexpression of the full-length and mutated versions of Smn1p was carried out using the pREP3X expression system under the control of the nmt1 thiamine-repressible promoter in a wild-type strain (43–45). In order to analyse the phenotypic effect of the loss of specific domains, we designed constructs with either the 5' or 3' conserved regions deleted (pREP3X-5'
smn1 and pREP3X-3'smn1). Additionally two missense mutations were generated to analyse the effect of SMA-causing mutations on the endogenous protein. The amino acids investigated show absolute conservation between human and fission yeast and have been reported in patients as causing SMA: Y136C (patient mutation Y272C) and G143V (patient mutation G279V).
Haploid wild-type yeast (sp557) overexpressing Smn1p showed an increase in growth rate compared with sp557 containing the vector alone suggesting, surprisingly, that in a wild-type cell Smn1p concentration is limiting growth (Fig. 3). No effects of overexpression of Smn1p on cell viability or morphology were evident (data not shown). Overexpression of Smn1pN or Smn1pC from the nmt promoter resulted in a decrease in growth rate as compared with control cells containing vector alone. The growth rate was determined by following the culture density over time (Fig. 3B). Both N- and C-terminal deletions resulted in a severe growth phenotype. Similarly, overexpression of proteins containing the Y136C and G143V missense mutations, both located in the region spanning the carboxy deletion, in a wild-type strain led to a decrease in viability and growth rate (Fig. 3). Finally, the wild-type smn1+ gene on pREP4X was transformed into the strains containing the mutant constructs with expression of both the wild-type and mutant proteins induced by thiamine starvation. Overexpression of the wild-type fission yeast smn1+ over- comes the dominant interference of the mutant Smn1p protein (Fig. 4A). Thus, all four mutated versions of Smn1p, when overexpressed in a wild-type strain of S.pombe, exerted a dominant-negative effect on cell viability. This is in contrast to the wild-type Smn1p protein, where overexpression is bene- ficial to the cell.
|
|
Mutations in Smn1p disrupt nuclear localization of the protein
SMN and SIP1 are part of complexes localized to both the cytoplasm and the nucleus. In the cytoplasm, SMN interacts with spliceosomal Sm proteins and participates in the assembly of the Sm core domain, participating in U snRNP assembly (21,22). In the nucleus, SMN functionally interacts with SIP1 and plays a role in RNA splicing. In order to begin to relate the function of fission yeast Smn1p to that of the mammalian SMN protein, we sought to determine the subcellular localization of Smn1p in yeast using a green fluorescent protein (GFP) translational fusion at the C-terminus of Smn1p. In all cells with a detectable signal, Smn1p–GFP was localized to the nucleus (Fig. 5C and C'). In cells expressing high levels of Smn1p–GFP a diffuse cytoplasmic signal was also evident which probably reflects differences in the copy number of the fusion construct in different cells. In marked contrast, the Smn1p
N–GFP fusion protein showed no nuclear signal. The entire signal was cytoplasmic and present in the formation of distinct aggregates (Fig. 5D and D'). The distribution of the GFP signal in cells expressing the Smn1pC–GFP fusion protein was similar, with no nuclear signal and many cytoplasmic aggregates (Fig. 5E and E'). Cells expressing the Smn1pN–GFP and Smn1pC–GFP fusion proteins showed the same phenotype of low viability and reduced growth rate as cells expressing the untagged versions of the proteins (Fig. 3, and data not shown). Consistent with this, a number of the cells in these populations had a weak or undetectable fluorescent signal (Fig. 5D, D', E and E'). This result suggests that both the N- and C-terminal domains are required for nuclear localization but large deletions may cause the proteins to misfold or otherwise occlude a nuclear localization signal. Therefore, we examined GFP fusions of the Smn1p proteins containing missense mutations in the C-terminus. Cells expressing Y136CSmn1p–GFP or G143VSmn1p–GFP showed no nuclear signal and an extensive cytoplasmic signal (Fig. 5F, F', G and G'). It was notable that the degree of cytoplasmic aggregation of the signal was not as pronounced in the fusion proteins containing point mutations as observed with the deletions. We conclude that the dominant-negative phenotypes resulting from the overexpression of mutated and deleted derivatives of Smn1p in fission yeast may be related to a defect in the cellular sublocalization of the proteins.
|
The relationship between murine Smn and fission yeast smn1+
The homology between fission yeast Smn1p and the mammalian SMN proteins is restricted to the N- and C-terminal regions whereas the central regions are divergent. This central sequence comprises the tudor domain in SMN which is implicated in direct binding to spliceosomal Sm proteins (46) and for the cytoplasmic function of SMN in U snRNP assembly (21). Although we have shown that mutations associated with Type I SMA in humans also produce dominant-negative phenotypes and mislocalization of the protein in fission yeast, it is not clear whether Smn1p is functionally related to or functionally homologous to the mammalian family of SMN proteins. To explore the relationship between the mammalian SMN proteins and the fission yeast Smn1p protein, we cloned the murine cDNA encoding Smn and expressed it from the nmt1 promoter on pREP4X. To explore the relationship between the murine Smn protein and the mutated and deleted derivatives of the fission yeast protein, we expressed murine Smn in a wild-type strain and in the wild-type strain expressing Smn1p
N, Smn1pC and the point mutations Y136CSmn1p and G143VSmn1p, and the same mutations fused to GFP. Overexpression of the GFP fusion proteins produces the same dominant-negative effect as seen with the untagged version of the yeast protein. As in this experiment we were overexpressing both the murine and yeast proteins, it is important to demonstrate that both proteins were present in the population. We did this by inducing expression by thiamine starvation and detecting the yeast and murine proteins in whole-cell extracts. Expression of murine Smn was detected by western analysis using antibody SMN1-3 raised against exons 1–3 of human SMN that readily detects the mouse protein. Expression of yeast proteins was detected by the presence of GFP fluorescence. When co-expressed, both proteins were present in the population at similar levels to those observed in the strain expressing only one of the two proteins (data not shown). We overexpressed the murine Smn protein in a wild-type yeast strain co-transformed with the empty pREP3X vector. We observed no significant effect on viability, growth rate or morphology of the strain compared with the wild-type strain transformed with pREP3X and pREP4X (Figs 3A and 4B). Significantly, the overall viability and growth rate of the cells overexpressing both the murine Smn and the yeast mutant proteins was similar to a wild-type strain containing just the vector sequence or overexpressing the murine Smn protein alone (Fig. 4B). This indicates that overexpression of the murine Smn protein complements the dominant effect resulting from overexpression of mutated versions of the yeast Smn1p. We noted that overexpression of the murine Smn protein did not alter the cytoplasmic localization of the point mutated yeast–GFP fusion proteins (data not shown). Thus, it is likely that the murine Smn protein functionally complements the loss of function of yeast Smn1p mutants evaluated, restoring viability to the cells. |
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
In this paper we describe the identification of an S.pombe orthologue of the SMA-determining protein SMN. We show that mutations associated with Type I SMA in humans also produce dominant-negative effects on cell viability and mislocalization of the protein in fission yeast. Expression of murine Smn is sufficient to complement the dominant-negative effects on cell viability associated with expression of the mutant yeast proteins suggesting that the murine and yeast proteins have related functions. The facile genetics of the fission yeast offers an attractive model system to explore the functions of the SMN protein.
The cellular functions associated with mammalian SMN and fission yeast Smn1p are not fully understood. To date, human SMN has been reported to function in various pathways including RNA splicing and snRNP biogenesis. At the N-terminus of Smn1p is a region which shows a high level of sequence conservation with a region at the N-terminus of human SMN known to interact with SIP1. Although BLASTP analysis of the incomplete S.pombe genome sequence database failed to reveal a fission yeast orthologue of SIP1, the complete genome sequence may yet reveal a potential binding partner. It is clear that the N- and C-terminal domains of Smn1p are important for function as overexpressing mutated versions of the protein produces dramatic phenotypes. Overexpression of a mutated Smn1p lacking the C-terminal region resulted in a dramatic reduction of cell viability and mislocalization of the protein. One interpretation of this phenotype is that the excess of the N-terminal domain in these cells is titrating out an essential protein, thereby interfering with the function of the chromosomally encoded Smn1p protein.
It has been shown previously that the C-terminal conserved domain is important for SMN oligomerization. Importantly, most intragenic mutations linked to Type I SMA are located within this region and interfere with oligomerization (26,28). It is interesting to note that dominant-negative effects on splicing and snRNP biogenesis are observed when deleted derivatives of SMN are overexpressed. For instance, this has been observed when the first 27 amino acids of the human SMN are deleted and the SMNN27 protein is overexpressed (23). Murine Smn shows a high degree of conservation with human SMN over this region, although in S.pombe smn1+ the sequence encoding these amino acids is absent. Nevertheless, this region may be part of the same protein interaction motif. A deletion of the N-terminal domain of Smn1p, resulting in overexpression of the C-terminal domain, like the human deletion, produces a dominant-negative phenotype. One possible explanation for this phenotype is sequestering of the functional Smn1p in an excess of non-functional protein, via the C-terminal oligomerization domain.
The C-terminal conserved region of SMN is also required for binding of Sm core proteins and U1 snRNP (22). Although the Sm core proteins are not absolutely conserved in S.pombe, some orthologues have been isolated. BLASTP analysis of the S.pombe genome database reveals potential orthologous proteins for Sm D3 and F. Splicing mechanism may therefore be partially conserved in fission yeast (47). In addition, mammalian introns can be correctly spliced in fission yeast (48). Although we have no evidence that the C-terminal domain of Smn1p interacts with Sm core proteins, another possible explanation for the phenotype observed when this region is overexpressed is sequestration of these binding proteins.
Although SMN is involved in splicing and other cellular functions, these may have evolved since the divergence of the SMN lineage. Fibrillarin also binds SMN at the C-terminal region and is highly conserved throughout evolution. S.pombe fibrillarin (49) shows high evolutionary conservation with other orthologues and appears to have the same properties in different organisms: it is localized within the nucleus (50) and is associated with U3 snRNA (47). It is possible, as with human SMN (22), that the C-terminal conserved domain in fission yeast Smn1p may interact with Sm protein and fibrillarin.
Both missense mutations analysed here would be predicted to present Type I SMA phenotypes if present in the human SMN protein. These mutations in SMN are known to affect oligomerization (26) and the Y272C mutation does not stimulate splicing (23). The Y272C mutant protein fails to oligomerize and as a result is unable to interact with Sm proteins (51). Both the C-terminal mutations in SMN, Y272C and G279V, show an increased propensity to associate with wild-type SMN and a decreased propensity to self-oligomerize (52). This behaviour provides an explanation for the dominant-negative phenotype observed when Smn1p containing mutations at these conserved residues is overexpressed in yeast.
GFP-tagged Smn1p reveals a predominantly nuclear localization. Human SMN localization is highly dependent on the cell type or tissue being investigated (53,54). SMN is found associated with gems in the nucleus (24,55). No gem-like structures were visible in fission yeast under the light microscope; instead a diffuse nuclear signal was observed. To date, there have been no reports of gem formation in S.pombe. SMN is also localized in the cytoplasm with a diffuse distribution. Although we only observe a cytoplasmic signal in cells with high levels of Smn1p–GFP expression, smn1+ may have specific cytoplasmic functions. It is uncertain whether it is the nuclear SMN protein distribution or localization that is affected in SMA. What is very marked, however, is the effect of deletions or point mutations on the distribution of Smn1p in the cell. There is no obvious nuclear localization signal in Smn1p suggesting that the Smn1p may require association with one or more proteins before import into the nucleus. The fact that nuclear localization is disrupted when either the N- or C-terminus of the protein is deleted would support this idea and further suggests that both domains on the protein form productive interactions required for nuclear localization.
Ablation of smn1+ results in a haploid lethal phenotype. This is similar to the lethality of the murine homozygous knockout (30) and the lethality demonstrated with double-stranded RNA interference in C.elegans (56). Both the metazoan and yeast proteins have essential functions and it is clear that the murine and yeast proteins are functionally related. Some functions of Smn1p, for instance the putative protein-interaction domain at the N-terminus of the protein, may be sufficiently conserved with the mammalian protein that a productive interaction with host-specific partners is possible, although the overall functions of the final complex are divergent. Our data showing the ability of the murine protein to rescue the dominant phenotypes associated with overexpression of mutant versions of Smn1p support the idea of some functionally similar domains. The fact that overexpression of the murine protein has no obvious effect on the yeast suggests that the murine protein does not interfere with function of the wild-type yeast protein.
The dominant effects reported here are in contrast to the recessive nature of SMA. However, that may simply reflect that fact that the mutant proteins are overexpressed in the yeast, as a dominant-negative effect has been reported with overexpression of a deleted human protein. How loss or mutation of SMN results in the specific neuronal phenotype associated with SMA is still unknown. Analysis of model systems such as mouse may aid in understanding this problem. Analysis of mammalian SMN in fission yeast may eventually lead to an understanding of the primary functions of these proteins.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Yeast strains and media
The yeast strains used in this study were: sp557, haploid wild-type (h–, ade6-M210, ura4D-18, leu1-32), and sp101, diploid wild-type (h+/h+, ade6-704/ade6-704, ura4D-18/ura4D-18, leu1-32/leu1-32). Strains created during this study were: spOX400 (h+/h+, smn1+/smn1::ura4+, ade6-704/ade6-704, ura4D-18/ura4D-18, leu1-32/leu1-32) and spOX402 (h+/h90, smn1+/smn1::ura4+, ade6-704/ade6-704, ura4D-18/ura4D-18, leu1-32/leu1-32).
The media used for growth of fission yeast strains was YES (0.5% yeast extract, 3% glucose plus amino acid supplements) or Edinburgh minimal medium (EMM2) (57). EMM2 was supplemented with amino acids for selection as required. For sporulation, low nitrogen agar was used which is made as for EMM2 except that NH4Cl is reduced from 5 g/l to 300 mg/l. Expression plasmids used were pREP3X and pREP4X (43,44).
Identification of S.pombe SMN orthologue (smn1+)
As previously reported we identified the full-length sequence of smn1+ from Blast searches using the full-length human SMN (GenBank accession no. Q16637) as bait through the Sanger Center S.pombe sequencing project Pombase (http://www.sanger.ac.uk/ ). Cosmid c2G11 from chromosome 1 contains this putative ORF denoted C2G11.08C which has a hypothetical protein size of 17.4 kDa.
Cloning of smn1+ and mutants
PCR primers were designed to amplify the ORF with restriction sites for cloning (spsmn-f, cggtcgaccgATGGACCAGAGC- CAAAAAGAAG, and spsmn-r, cgcggatccgcgATCTTTACGTTGCTCACTTTTAGC). Amplification was carried out on a pREP3X/cDNA library (a kind gift of Chris Norbury, ICRF, University of Oxford, UK) with a Ta of 56°C and extension time of 60 s. The PCR product was cloned into the pGEM T vector system (Promega, Southampton, UK). The insert was sequenced on both strands to confirm the ORF. Sequence was analysed using the Wisconsin Genetics Computer Group (GCG) package. smn1+ contains a single intron and this was absent from the cloned insert, confirming the amplicon to be of a cDNA. The insert was excised from pGEM T through digestion with SalI–BamHI and directionally cloned into the pREP3X SalI–BamHI sites.
Deletion mutants 5'smn1 and 3'smn1 were generated with PCR primers designed to sequence adjacent to regions to be deleted (spsmn-5, cggtcgaccgATGGAAACCGCTTTACATGAATTC, paired with spsmn-r, and spsmn-3, cgcggatccgcgCTTTTTGTAAAGTCTCGTC, paired with spsmn-f). 5'smn1 has amino acids 2–17 removed and 3'smn1 has amino acids 127–152 removed. PCR products were digested with SalI–BamHI and cloned into the SalI–BamHI sites of pREP3X. Missense mutations Y136C and G143V were generated by site-directed mutagenesis of the full-length smn1+ in pREP3X based on the QuickChange Site-Directed Mutagenesis system (Stratagene, Amsterdam, The Netherlands). All constructs were sequenced using an ABI377 automated sequencer (PE Biosystems, Warrington, UK) to confirm correct ORF.
Gene disruption of smn1+
Homologous recombination was used to integrate cloned sequences onto the chromosome (41). In order to disrupt the smn1+ gene genomic flanking arms were generated by PCR (left-arm primers: forward, GCCGTGCAACCTGATGGATC, and reverse, ctagtctagactagGCTATTGCTAAGATTTATTACTCC; right-arm primers: forward, gggtacccCAAGTTGTAGATAATCTATTCCTG, and reverse, CAGCGATGAATCTCGAATCTG) and cloned individually into pGEM T vector system. The left-flanking arm was excised using NotI–XbaI digest, the right with Asp718i–NcoI digest. The 1.8 kb XbaI–Asp718i ura4+ fragment from pTZURA4 plasmid was cloned with each flanking arm into pGEM T and excised as a complete 3.8 kb linear fragment using NotI–NcoI. The resulting fragment was used for transformation of diploid sp101. Southern blot analysis of total genomic DNA isolated from stable transformants was carried out using radiolabelled probe L generated by left-arm PCR primers.
Overexpression
pREP3X based constructs were electroporated as described (58,59) into S.pombe strain sp557 using a Bio-Rad (Hertfordshire, UK) electroporator. Colonies were grown at 30°C on selective EMM2 –leu agar in the presence of 2% thiamine to repress expression from the pREP3X nmt1 promoter. After 3–4 days colonies were streaked onto fresh EMM2 –leu and thiamine. Colonies were also streaked on selective media without thiamine and incubated at 30°C for 24 h. For analysis of growth rates 5 ml of EMM2 –leu medium containing 2% thiamine was inoculated with haploid sp557 strains containing constructs to be analysed. The cultures were incubated with shaking at 30°C for 18 h, after which time 100 ml of EMM2 –leu lacking thiamine was inoculated with 105 cells. Cultures were incubated with shaking at 30°C, and on hourly intervals 900 µl of culture was removed. One hundred microlitres of 37% formaldehyde was added to fix cells and optical density quantified by measurement at 595 nm.
Cellular localization of smn1+ and mutants
Each ORF (smn1+, 5'smn1, 3'smn1, Y136Csmn1 and G143Vsmn1) was directionally cloned into the SalI and BamHI restriction sites of pGP110 (a kind gift of Prof. M. Yanagida, Department of Gene Mechanisms, Kyoto University, Japan) resulting in a C-terminal translational GFP fusion protein. The constructs (pGP110–smn1, pGP110–5'smn1, pGP110–3'smn1, pGP110–Y136Csmn1 and pGP110–G143Vsmn1) were transformed by electroporation into strain sp557, grown on selective EMM2 –leu and 2% thiamine. Single colonies were used to inoculate selective EMM2 for 18 h at 30°C with shaking. GFP-tagged protein localization and DAPI staining was carried out by treating cells with 10% formaldehyde at 30°C for 30 min. Triton X-100 was added to permeabilize the cells, which were then washed with phosphate-buffered saline (PBS). Cells were centrifuged and resuspended in PBS after which cells were aliquoted onto the surface of poly-L-lysine-coated slides. Counterstaining with 4,6-diamidino-2-phenylindole (DAPI) was carried out by the addition of 15 µl of VectorShield mounting medium (Vector Laboratories, Peterborough, UK) containing DAPI to stain nuclear material.
Complementation with murine Smn and yeast Smn1p
Murine Smn (GenBank accession no. Q16637) cDNA was cloned into the SalI–BamHI restriction sites of pREP4X (a kind gift of Paul Nurse, ICRF, London, UK). The resulting plasmid (pREP4X-Smn) was transformed by electroporation into strain sp557, alongside the native vector pREP4X as control, and selected for with EMM2 –ura with thiamine medium. Into these strains all previous constructs containing the yeast ORFs were electroporated and selected for. Overexpression of the murine Smn in combination with S.pombe ORFs was carried out as for previous overexpression analysis using EMM2 –ura –leu selective medium.
Complementation of growth phenotypes with S.pombe Smn1p was carried out by co-transformation of pREP3X constructs containing yeast ORFs with pREP4X-smn1+. pREP4X-smn1+ was generated by the digestion of pTZURA4 with KpnI–PstI to isolate the ura4+ ORF which was ligated with pREP3X-smn1+ digested with KpnI–PstI. The resulting plasmid was identical to pREP3X-smn1+ but with the ura4+ ORF for selection instead of leu2+. Overexpression was carried out as previously described using EMM2 –ura –leu selective medium.
|
ACKNOWLEDGEMENTS |
|---|
We would like to thank Profs P. Nurse and M. Yanagida for providing vectors. We are grateful to Prof. S. Forsburg, Dr N. Rodrigues, Dr K. Talbot and Dr N. Loh for helpful discussions and to C. Owen for support. The Muscular Dystrophy Group, UK, and Muscular Dystrophy Association, USA, financially support the work presented. C.L.D. is supported by the Wellcome foundation.
|
FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +44 1865 272416; Fax: +44 1865 272427; Email: kay.davies@anat.ox.ac.uk
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Pearn, J. (1978) Incidence, prevalence, and gene frequency studies of chronic childhood spinal muscular atrophy. J. Med. Genet., 15, 409–413.
2 Pearn, J. (1980) Classification of spinal muscular atrophies. Lancet, 1, 919–922.[Web of Science][Medline]
3 Melki, J., Abdelhak, S., Sheth, P., Bachelot, M.F., Burlet, P., Marcadet, A., Aicardi, J., Barois, A., Carriere, J.P., Fardeau, M. et al. (1990) Gene for chronic proximal spinal muscular atrophies maps to chromosome 5q. Nature, 344, 767–768.[Medline]
4 Brzustowicz, L.M., Lehner, T., Castilla, L.H., Penchaszadeh, G.K., Wilhelmsen, K.C., Daniels, R., Davies, K.E., Leppert, M., Ziter, F., Wood, D. et al. (1990) Genetic mapping of chronic childhood-onset spinal muscular atrophy to chromosome 5q11.2–13.3. Nature, 344, 540–541.[Medline]
5 Francis, M.J., Morrison, K.E., Campbell, L., Grewal, P.K., Christodoulou, Z., Daniels, R.J., Monaco, A.P., Frischauf, A.M., McPherson, J., Wasmuth, J. et al. (1993) A contig of non-chimaeric YACs containing the spinal muscular atrophy gene in 5q13. Hum. Mol. Genet., 2, 1161–1167.
6 Lefebvre, S., Burglen, L., Reboullet, S., Clermont, O., Burlet, P., Viollet, L., Benichou, B., Cruaud, C., Millasseau, P., Zeviani, M. et al. (1995) Identification and characterization of a spinal muscular atrophy-determining gene. Cell, 80, 155–165.[Web of Science][Medline]
7 Ishikawa, Y., Ishikawa, Y. and Minami, R. (1996) Survival motor neuron and neuronal apoptosis inhibitor protein gene deletion analysis of childhood spinal muscular atrophy. No To Hattatsu, 28, 450–453.[Medline]
8 Rodrigues, N.R., Owen, N., Talbot, K., Ignatius, J., Dubowitz, V. and Davies, K.E. (1995) Deletions in the survival motor neuron gene on 5q13 in autosomal recessive spinal muscular atrophy. Hum. Mol. Genet., 4, 631–634.
9 Rodrigues, N.R., Owen, N., Talbot, K., Patel, S., Muntoni, F., Ignatius, J., Dubowitz, V. and Davies, K.E. (1996) Gene deletions in spinal muscular atrophy. J. Med. Genet., 33, 93–96.
10 Burglen, L., Lefebvre, S., Clermont, O., Burlet, P., Viollet, L., Cruaud, C., Munnich, A. and Melki, J. (1996) Structure and organization of the human survival motor neurone (SMN) gene. Genomics, 32, 479–482.[Web of Science][Medline]
11 Parsons, D.W., McAndrew, P.E., Monani, U.R., Mendell, J.R., Burghes, A.H.M. and Prior, T.W. (1996) An 11 base pair duplication in exon 6 of the SMN gene produces a type I spinal muscular atrophy (SMA) phenotype: further evidence for SMN as the primary SMA-determining gene. Hum. Mol. Genet., 5, 1727–1732.
12 Gennarelli, M., Lucarelli, M., Capon, F., Pizzuti, A., Merlini, L., Angelini, C., Novelli, G. and Dallapiccola, B. (1995) Survival motor neuron gene transcript analysis in muscles from spinal muscular atrophy patients. Biochem. Biophys. Res. Commun., 213, 342–348.[Web of Science][Medline]
13 Bussaglia, E., Clermont, O., Tizzano, E., Lefebvre, S., Burglen, L., Cruaud, C., Urtizberea, J.A., Colomer, J., Munnich, A., Baiget, M. and Melki, J. (1995) A frame-shift deletion in the survival motor neuron gene in Spanish spinal muscular atrophy patients. Nature Genet., 11, 335–337.[Web of Science][Medline]
14 Cobben, J.M., Van Der Steege, G., Grootscholten, P., De Visser, M., Scheffer, H. and Buys, C.H.C.M. (1995) Deletions of the survival motor neuron gene in unaffected siblings of patients with spinal muscular atrophy. Am. J. Hum. Genet., 57, 805–808.[Web of Science][Medline]
15 Hahnen, E., Forkert, R., Marke, C., Rudnik Schoeneborn, S., Schoenling, J., Zerres, K. and Wirth, B. (1995) Molecular analysis of candidate genes on chromosome 5q13 in autosomal recessive spinal muscular atrophy: evidence of homozygous deletions of the SMN gene in unaffected individuals. Hum. Mol. Genet., 4, 1927–1933.
16 Campbell, L., Potter, A., Ignatius, J., Dubowitz, V. and Davies, K. (1997) Genomic variation and gene conversion in spinal muscular atrophy: implications for disease process and clinical phenotype. Am. J. Hum. Genet., 61, 40–50.[Web of Science][Medline]
17 McAndrew, P.E., Parsons, D.W., Simard, L.R., Rochette, C., Ray, P.N., Mendell, J.R., Prior, T.W. and Burghes, A.H.M. (1997) Identification of proximal spinal muscular atrophy carriers and patients by analysis of SMN-T and SMN-C gene copy number. Am. J. Hum. Genet., 60, 1411–1422.[Web of Science][Medline]
18 Taylor, J.E., Thomas, N.H., Lewis, C.M., Abbs, S.J., Rodriguez, N.R., Davies, K.E. and Mathew, C.G. (1998) Correlation of SMNt and SMNc gene copy number with age of onset and survival in spinal muscular atrophy. Eur. J. Hum. Genet., 6, 467–474.[Web of Science][Medline]
19 Lefebvre, S., Burlet, P., Liu, Q., Bertrandy, S., Clermont, O., Munnich, A., Dreyfuss, G. and Melki, J. (1997) Correlation between severity and SMN protein level in spinal muscular atrophy. Nature Genet., 16, 265–269.[Web of Science][Medline]
20 Coovert, D.D., Le Thanh, T., McAndrew, P.E., Strasswimmer, J., Crawford, T.O., Mendell, J.R., Coulson, S.E., Androphy, E.J., Prior, T.W. and Burghes, A.H.M. (1997) The survival motor neuron protein in spinal muscular atrophy. Hum. Mol. Genet., 6, 1205–1214.
21 Fischer, U., Liu, Q. and Dreyfuss, G. (1997) The SMN-SIP1 complex has an essential role in spliceosomal snRNP biogenesis. Cell, 90, 1023–1029.[Web of Science][Medline]
22 Liu, Q., Fischer, U., Wang, F. and Dreyfuss, G. (1997) The spinal muscular atrophy disease gene product, SMN, and its associated protein SIP1 are in a complex with spliceosomal snRNP proteins. Cell, 90, 1013–1021.[Web of Science][Medline]
23 Pellizzoni, L., Kataoka, N., Charroux, B. and Dreyfuss, G. (1998) A novel function for SMN, the spinal muscular atrophy disease gene product, in pre-mRNA splicing. Cell, 95, 615–624.[Web of Science][Medline]
24 Liu, Q. and Dreyfuss, G. (1996) A novel nuclear structure containing the survival of motor neurons protein. EMBO J., 15, 3555–3565.[Web of Science][Medline]
25 Lorson, C.L. and Androphy, E.J. (1998) The domain encoded by exon 2 of the survival motor neuron protein mediates nucleic acid binding. Hum. Mol. Genet., 7, 1269–1275.
26 Lorson, C.L., Strasswimmer, J., Yao, J.M., Baleja, J.D., Hahnen, E., Wirth, B., Le, T., Burghes, A.H.M. and Androphy, E.J. (1998) SMN oligomerization defect correlates with spinal muscular atrophy severity. Nature Genet., 19, 63–66.[Web of Science][Medline]
27 Ponting, C.P. (1997) Tudor domains in proteins that interact with RNA. Trends Biochem. Sci., 22, 51–52.[Web of Science][Medline]
28 Talbot, K., Ponting, C.P., Theodosiou, A.M., Rodrigues, N.R., Surtees, R., Mountford, R. and Davies, K.E. (1997) Missense mutation clustering in the survival motor neuron gene: a role for a conserved tyrosine and glycine rich region of the protein in RNA metabolism? Hum. Mol. Genet., 6, 497–500.
29 Mohaghegh, P., Rodrigues, N.R., Owen, N., Ponting, C.P., Le, T.T., Burghes, A.H. and Davies, K.E. (1999) Analysis of mutations in the tudor domain of the survival motor neuron protein SMN. Eur. J. Hum. Genet., 7, 519–525.[Web of Science][Medline]
30 Schrank, B., Goetz, R., Gunnersen, J.M., Ure, J.M., Toyka, K.V., Smith, A.G. and Sendtner, M. (1997) Inactivation of the survival motor neuron gene, a candidate gene for human spinal muscular atrophy, leads to massive cell death in early mouse embryos. Proc. Natl Acad. Sci. USA, 94, 9920–9925.
31 Bertrandy, S., Burlet, P., Clermont, O., Huber, C., Fondrat, C., Thierry Mieg, D., Munnich, A. and Lefebvre, S. (1999) The RNA-binding properties of SMN: deletion analysis of the zebrafish orthologue defines domains conserved in evolution. Hum. Mol. Genet., 8, 775–782.
32 Russel, P. (1989) Gene cloning and expression in fission yeast. In Nasim, A., Young, P. and Johnson, B.F. (eds), Molecular Biology of the Fission Yeast. Academic Press, New York, NY, pp. 243–271.
33 Moreno, S., Klar, A. and Nurse, P. (1991) Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol., 194, 795–823.[Web of Science][Medline]
34 Olson, M.V. (1991) Genome structure and organisation in Saccharomyces cerevisiae. In Broach, J.R., Pringle, J.R. and Jones, E.W. (eds), The Molecular and Cellular Biology of the Yeast Saccharomyces cerevisiae. Cold Spring Harbor Laboratory, New York, NY, pp. 1–39.
35 Mertins, P. and Gallwitz, D. (1987) Nuclear pre-messenger RNA splicing in the fission yeast Schizosaccharomyces pombe strictly requires an intron-contained, conserved sequence element. EMBO J., 6, 1757–1764.[Web of Science][Medline]
36 Prabhala, G., Rosenberg, G.H. and Kaufer, N.F. (1992) Architectural features of pre-mRNA introns in the fission yeast Schizosaccharomyces pombe. Yeast, 8, 171–182.[Web of Science][Medline]
37 Tugendreich, S., Bassett Jr, D.E., McKusick, V.A., Boguski, M.S. and Hieter, P. (1994) Genes conserved in yeast and humans. Hum. Mol. Genet., 1509–1517.
38 Morrow, D.M., Tagle, D.A., Shiloh, Y., Collins, F.S. and Hieter, P. (1995) Tel1, an S.cerevisiae homolog of the human gene mutated in ataxia telangiectasia, is functionally related to the yeast checkpoint gene MEC1. Cell, 82, 831–840.[Web of Science][Medline]
39 Zhao, Y. and Lieberman, H.B. (1995) Schizosaccharomyces pombe: a model for molecular studies of eukaryotic genes. DNA Cell Biol., 14, 359–371.[Web of Science][Medline]
40 Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol., 215, 403–410.[Web of Science][Medline]
41 Rothstein, R. (1983) One-step gene disruption in yeast. Methods Enzymol., 101, 202–211.[Web of Science][Medline]
42 Grimm, C., Kohli, J., Murray, J. and Maundrell, K. (1988) Genetic engineering of Schizosaccharomyces pombe: a system for gene disruption and replacement using the ura4 gene as a selectable marker. Mol. Gen. Genet., 215, 81–86.[Web of Science][Medline]
43 Forsburg, S.L. (1993) Comparison of Schizosaccharomyces pombe expression systems. Nucleic Acids Res., 21, 2955–2956.
44 Maundrell, K. (1993) Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene, 123, 127–130.[Web of Science][Medline]
45 Maundrell, K. (1990) nmt1 of fission yeast. A highly transcribed gene completely repressed by thiamine. J. Biol. Chem., 265, 10857–10864.
46 Buhler, D., Raker, V., Luhrmann, R. and Fischer, U. (1999) Essential role for the tudor domain of SMN in spliceosomal U snRNP assembly: implications for spinal muscular atrophy. Hum. Mol. Genet., 8, 2351–2357.
47 Tollervery, D., Tessards, G. and Luhrmann, R. (1990) Immunoprecipitation distinguishes non-overlapping groups of snRNPs in Schizosaccharomyces pombe. Nucleic Acids Res., 18, 5207–5212.
48 Kaufer, N.F., Simanis, V. and Nurse, P. (1985) Fission yeast Schizosaccharomyces pombe correctly excises a mammalian RNA transcript intervening sequence. Nature, 318, 78–80.[Medline]
49 Girard, J.P., Feliu, J., Caizergues Ferrer, M. and Lapeyre, B. (1993) Study of multiple fibrillarin mRNAs reveals that 3' end formation in Schizosaccharomyces pombe is sensitive to cold shock. Nucleic Acids Res., 21, 1881–1887.
50 Potashkin, J.A., Derby, R.J. and Spector, D.L. (1990) Differential distribution of factors involved in pre-mRNA processing in the yeast cell nucleus. Mol. Cell Biol., 10, 324–334.
51 Pellizzoni, L., Charroux, B. and Dreyfuss, G. (1999) SMN mutants of spinal muscular atrophy patients are defective in binding to snRNP proteins. Proc. Natl Acad. Sci. USA, 96, 11167–11172.
52 Strasswimmer, J., Lorson, C.L., Breiding, D.E., Chen, J.J., Le, T., Burghes, A.H. and Androphy, E.J. (1999) Identification of survival motor neuron as a transcriptional activator-binding protein. Hum. Mol. Genet., 8, 1219–1226.
53 Battaglia, G., Princivalle, A., Forti, F., Lizier, C. and Zeviani, M. (1997) Expression of the SMN gene, the spinal muscular atrophy determining gene, in the mammalian central nervous system. Hum. Mol. Genet., 6, 1961–1971.
54 Williams, B.Y., Vinnakota, S., Sawyer, C.A., Waldrep, J.C., Hamilton, S.L. and Sarkar, H.K. (1999) Differential subcellular localization of the survival motor neuron protein in spinal cord and skeletal muscle. Biochem. Biophys. Res. Commun., 254, 10–14.[Web of Science][Medline]
55 Young, P.J., Le, T.T., Man, N.T., Burghes, A.H.M. and Morris, G.E. (1999) The spinal muscular atrophy protein, SMN, fails to form nuclear gems in some mammalian cell types which also lack coiled bodies. Annual Meeting of the American Society of Human Genetics. Am. J. Hum. Genet., 65, A608.
56 Miguel-Aliaga, I., Culetto, E., Walker, D.S., Baylis, H.A., Sattelle, D.B. and Davies, K.E. (1999) The C. elegans orthologue of the human gene responsible for spinal muscular atrophy is a maternal product critical for germline maturation and embryonic viability. Hum. Mol. Genet., 8, 2133–2143.
57 Nurse, P. (1970) Genetic control of cell size at cell division in yeast. Nature, 256, 457–551.
58 Hood, M.T. and Stachow, C. (1990) Transformation of Schizosaccharomyces pombe by electroporation. Nucleic Acids Res., 18, 688.
59 Prentice, H.L. (1992) High efficiency transformation of Schizosaccharomyces pombe by electroporation. Nucleic Acids Res., 20, 621.
60 Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22, 4673–4680.
61 Page, R.D.M. (1996) Treeview: an application to display phylogenetic trees on personal computers. Comp. Appl. Biosci., 12, 356.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  Z. Palfi, N. Jae, C. Preusser, K. H. Kaminska, J. M. Bujnicki, J. H. Lee, A. Gunzl, C. Kambach, H. Urlaub, and A. Bindereif SMN-assisted assembly of snRNP-specific Sm cores in trypanosomes Genes & Dev., July 15, 2009; 23(14): 1650 - 1664. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. B. Shpargel, K. Praveen, T. K. Rajendra, and A. G. Matera Gemin3 Is an Essential Gene Required for Larval Motor Function and Pupation in Drosophila Mol. Biol. Cell, January 1, 2009; 20(1): 90 - 101. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Y. Rawe, C. Payne, and G. Schatten Profilin and actin-related proteins regulate microfilament dynamics during early mammalian embryogenesis Hum. Reprod., May 1, 2006; 21(5): 1143 - 1153. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Feng, A. K. Gubitz, L. Wan, D. J. Battle, J. Dostie, T. J. Golembe, and G. Dreyfuss Gemins modulate the expression and activity of the SMN complex Hum. Mol. Genet., June 15, 2005; 14(12): 1605 - 1611. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Anderson, A. Potter, D. Baban, and K. E. Davies Protein expression changes in spinal muscular atrophy revealed with a novel antibody array technology Brain, September 1, 2003; 126(9): 2052 - 2064. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Ilangovan, W. L. Marshall, Y. Hua, and J. Zhou Inhibition of Apoptosis by Z-VAD-fmk in SMN-depleted S2 Cells J. Biol. Chem., August 15, 2003; 278(33): 30993 - 30999. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. B. Chan, I. Miguel-Aliaga, C. Franks, N. Thomas, B. Trulzsch, D. B. Sattelle, K. E. Davies, and M. van den Heuvel Neuromuscular defects in a Drosophila survival motor neuron gene mutant Hum. Mol. Genet., June 15, 2003; 12(12): 1367 - 1376. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Faustino and T. A. Cooper Pre-mRNA splicing and human disease Genes & Dev., February 15, 2003; 17(4): 419 - 437. [Full Text] [PDF]
|
|
|
|
|
|
S. Vyas, C. Bechade, B. Riveau, J. Downward, and A. Triller Involvement of survival motor neuron (SMN) protein in cell death Hum. Mol. Genet., October 15, 2002; 11(22): 2751 - 2764. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Dez, J. Noaillac-Depeyre, M. Caizergues-Ferrer, and Y. Henry Naf1p, an Essential Nucleoplasmic Factor Specifically Required for Accumulation of Box H/ACA Small Nucleolar RNPs Mol. Cell. Biol., October 15, 2002; 22(20): 7053 - 7065. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Baccon, L. Pellizzoni, J. Rappsilber, M. Mann, and G. Dreyfuss Identification and Characterization of Gemin7, a Novel Component of the Survival of Motor Neuron Complex J. Biol. Chem., August 23, 2002; 277(35): 31957 - 31962. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. J. Friesen, A. Wyce, S. Paushkin, L. Abel, J. Rappsilber, M. Mann, and G. Dreyfuss A Novel WD Repeat Protein Component of the Methylosome Binds Sm Proteins J. Biol. Chem., March 1, 2002; 277(10): 8243 - 8247. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Voss, A. Hille, S. Barth, A. Spurk, F. Hennrich, D. Holzer, N. Mueller-Lantzsch, E. Kremmer, and F. A. Grasser Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter J. Virol., December 1, 2001; 75(23): 11781 - 11790. [Abstract] [Full Text]
|
|
|
|
 |
|
 L. Pellizzoni, B. Charroux, J. Rappsilber, M. Mann, and G. Dreyfuss A Functional Interaction between the Survival Motor Neuron Complex and RNA Polymerase II J. Cell Biol., January 8, 2001; 152(1): 75 - 86. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. R. Monani, D. D. Coovert, and A. H.M. Burghes Animal models of spinal muscular atrophy Hum. Mol. Genet., October 1, 2000; 9(16): 2451 - 2457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. J. Friesen and G. Dreyfuss Specific Sequences of the Sm and Sm-like (Lsm) Proteins Mediate Their Interaction with the Spinal Muscular Atrophy Disease Gene Product (SMN) J. Biol. Chem., August 18, 2000; 275(34): 26370 - 26375. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang and G. Dreyfuss A Cell System with Targeted Disruption of the SMN Gene. FUNCTIONAL CONSERVATION OF THE SMN PROTEIN AND DEPENDENCE OF Gemin2 ON SMN J. Biol. Chem., March 23, 2001; 276(13): 9599 - 9605. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang and G. Dreyfuss Characterization of Functional Domains of the SMN Protein in Vivo J. Biol. Chem., November 21, 2001; 276(48): 45387 - 45393. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Gubitz, Z. Mourelatos, L. Abel, J. Rappsilber, M. Mann, and G. Dreyfuss Gemin5, a Novel WD Repeat Protein Component of the SMN Complex That Binds Sm Proteins J. Biol. Chem., February 8, 2002; 277(7): 5631 - 5636. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pellizzoni, J. Baccon, J. Rappsilber, M. Mann, and G. Dreyfuss Purification of Native Survival of Motor Neurons Complexes and Identification of Gemin6 as a Novel Component J. Biol. Chem., February 22, 2002; 277(9): 7540 - 7545. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||