Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (61)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Campbell, L.
Right arrow Articles by Davies, K. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Campbell, L.
Right arrow Articles by Davies, K. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2000, Vol. 9, No. 7 1093-1100
© 2000 Oxford University Press

Direct interaction of Smn with dp103, a putative RNA helicase: a role for Smn in transcription regulation?

Louise Campbell, Kara M. D. Hunter, Payam Mohaghegh, Jonathon M. Tinsley+, Michael A. Brasch1 and Kay E. Davies2,§

Department of Human Anatomy and Genetics, and 2MRC Functional Genetics Unit, Department of Human Anatomy and Genetics, University of Oxford, South Parks Road, Oxford OX1 3QU, UK and 1Life Technologies Inc., 9800 Medical Center Drive, Rockville, MD 20849-6482, USA

Received 9 December 1999; Revised and Accepted 14 February 2000.

DDBJ/EMBL/GenBank accession no. AJ250027.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Spinal muscular atrophy is an autosomal recessive neurodegenerative disease of childhood, resulting from deletion or mutation of the survival motor neuron (SMN) gene on chromosome 5q13. SMN exists as part of a 300 kDa multi-protein complex, incorporating several proteins critically required in pre-mRNA splicing. Although SMN mutations render SMN defective in this role, the specific {alpha}-motor neuron degenerative phenotype seen in the disease remains unexplained. Here we demonstrate the isolation from mouse brain of the murine homologue of a recently identified novel RNA helicase of the DEAD box family, DP103, and its direct and specific binding of SMN. Previous work has shown that DP103 binds viral proteins known to interact with a cellular transcription factor to modulate gene expression. We suggest that the interaction between SMN and DP103 is further evidence for a role for SMN in transcriptional regulation and that SMN may be involved in the regulation of neuron-specific genes essential in neuronal development.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Spinal muscular atrophy (SMA) is a common recessive genetic disease in which degeneration of the {alpha}-motor neurons of the spinal cord results in associated proximal muscle weakness (1). The disease varies in severity, with the most severe form, Type I SMA, resulting in death in early infancy. Type II SMA is an intermediate form, with onset typically around 18 months, in which affected individuals are unable to walk unaided. Type III SMA is a milder form with later onset, in which patients can stand and walk. Survival into adulthood is common in this form of the disease. A single gene, the survival motor neuron gene (SMN), located on chromosome 5q13, is responsible for all three clinical forms of SMA (2). Two SMN genes (SMN1 and SMN2) are present in man, one in each copy of a large inverted repeat on chromosome 5q13 (2). Deletion, gene conversion or mutation of SMN1 results in the disease phenotype (3,4). The SMN1 and SMN2 genes encode identical products, but differ in their expression of alternatively spliced mRNAs. SMN1 produces mainly full-length mRNA and therefore fully functional protein, the amount of which correlates with the disease, since high levels of the protein normally present in motor neurons are found to be greatly reduced in the motor neurons of Type I SMA patients (5,6). The main products of SMN2 are transcripts lacking either exon 7, exon 5 or both, although it does produce a small amount of functional protein (5,7). The copy number of SMN2 has been shown to determine disease severity (4,8,9). Absence of both SMN1 and SMN2 genes as a cause of SMA has not been observed, probably because such a mutation would be embryonic lethal. Homozygous null mutation of the single Smn gene present in the mouse is lethal early in embryogenesis, prior to implantation (10).

The 38 kDa SMN protein is ubiquitously expressed in both adult and fetal human tissues, although higher expression is observed in fetal development (5,6,11,12). SMN was found to be highly expressed in motor neurons of monkey and rat spinal cord (13). A marked decrease in SMN protein level in the spinal cord of affected individuals correlates with SMA severity (6). The cellular localization of SMN is both nuclear, where it is concentrated in punctate structures called gems, and cytoplasmic, where it exhibits a more diffuse staining in all cells except muscle, where it has been reported to localize to large cytoplasmic aggregates (11,14). SMN is found in the cytosol as part of a 300 kDa complex comprising several additional proteins, some of which have yet to be characterized (15). SMN has been shown to self-oligomerize (16), and to interact directly with SMN-interacting protein-1 (SIP1) and several Sm proteins, which are components of spliceosomal snRNPs (15,17,18). Using in vitro cell systems, SMN has been shown to be essential for correct spliceosomal snRNP biogenesis, since N-terminal deletion of SMN results in a dominant-negative phenotype whereby pre-mRNA splicing is inhibited (19). In addition, mutations found in SMA patients have been shown to result in impaired binding of mutant SMN to Sm proteins, resulting in defective snRNP metabolism (19).

Although SMN appears to play a fundamental part in cell metabolism, it is unclear as yet how loss of SMN directly relates to the major pathological defect in SMA, namely the degeneration of a specific subset of neurons, the {alpha}-motor neurons of the anterior spinal cord. Immunohistochemical analysis of spinal motor neurons suggests that SMN exists predominantly in the cytoplasm of such cells (20). However, in disagreement with such findings, SMN immunostaining has been observed in both the cytoplasm and in nuclear gems of many human central nervous system cell types, and in particular in both the cell bodies and proximal dendrites of {alpha}-motor neurons (21,22). This cytoplasmic staining pattern suggests that SMN may have an additional, neuron-specific role in addition to that proposed in pre-mRNA splicing.

Several studies into the function of SMN have utilized yeast two-hybrid analysis to investigate proteins interacting with SMN. The SIP1–SMN interaction was identified using a HeLa cell cDNA library, as was the SMN self-interaction (15,18). Similar studies using a thymus cell library identified a synergistic interaction between SMN and Bcl2 (23). Confirmation of this interaction is awaited since several other studies have failed to identify Bcl2 as an SMN-binding partner. However, Bcl2 has been shown to colocalize with SMN in regenerating muscle fibres and at the post-synaptic domain of normal human neuromuscular junctions (24).

In an attempt to identify SMN–protein interactions relevant to the specific nature of the motor neuron degeneration characteristic of SMA, we carried out yeast two-hybrid analysis using the entire coding sequence of the mouse Smn gene as bait in screening a mouse brain cDNA library. In view of the fact that the mouse and human SMN genes are highly homologous at the amino acid level (25,26), we chose to use mouse Smn as bait in order to facilitate characterization of positive interacting proteins, since mouse tissues are more readily available for analysis. Using this approach, we have identified a cDNA (LK2) whose predicted protein sequence contains all of the functional domains characteristic of an RNA helicase gene. Using database searches, we have now identified LK2 as the mouse homologue of DP103, a recently reported novel member of the DEAD box family of putative ATP-dependent RNA helicases (27). In addition to its role in pre-mRNA splicing, SMN has been proposed to participate in the transcriptional regulation of gene expression, having been shown to bind to the papillomavirus nuclear transcription activator E2 (28). In view of the recently reported association of DP103 with viral and cellular transcription factors, our finding demonstrating that dp103 directly binds Smn is further evidence for a role of Smn in the modulation of gene expression.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Isolation of Smn binding partners
In order to search for cDNA clones encoding proteins that interact with the mouse Smn gene, we used a yeast two-hybrid system in which the bait clone is expressed as part of a fusion protein also encoding the GAL4 DNA-binding domain (29). The entire coding sequence of Smn was used as bait to screen a mouse brain cDNA expression library in which clones were expressed in-frame with the GAL4 activation domain. Active GAL4 transcription factor dimers were reconstituted by the interaction of bait and prey plasmids, thereby activating three chromosomally integrated reporter genes driven by promoters containing the relevant DNA binding sites. Screening of ~2 x 106 library clones yielded 38 initial positives. Induction of all three reporter genes was confirmed by replica plating onto appropriate selection media or by assaying with X-Gal. The resulting combined phenotype was used as an indication of the strength of the proposed interaction. False positives could also be excluded at this point. An example of the type of result expected from such reporter gene assays is shown in Figure 1.



View larger version (165K):
[in this window]
[in a new window]
 
Figure 1. Induction of reporter genes by protein–protein interaction in the yeast two-hybrid assay. The master plate (A) shows four patches of each of four primary positive yeast colonies (y35–y38) from the yeast two-hybrid screen, on the left side. To the right are two patches each of five yeast control strains (a–e) containing interacting proteins of varying strengths (no interaction in strain a to strong interaction in strain e). On the far right are two patches of the pDBLeu-Smn self-activation control (t4). The master plate was replica-plated onto the following selection media; SC-Leu-Trp-His + 25 mM 3AT (B), SC-Leu-Trp-Ura (D) and SC-Leu-Trp + 0.2% 5-fluorootic acid (5-FOA) (C). The strength of interaction of the proteins contained in each test strain was assessed by the level of growth (B and D) or inhibition (C) following incubation at 30°C for 3 days, with replica cleaning at times as indicated in the protocol. One of the five LK2 clones is represented here by y36. Y36 patches grew well on plate B, indicating induction of the HIS3 reporter gene above the basal level of HIS expression, which is inhibited by addition of 25 mM 3AT. Y36 patches also grew well on plate D, indicating induction of URA3. Growth on plates lacking URA suggests the presence of strongly interacting proteins within the y36 cells, since weaker interactions are inhibited by the presence of an upstream repressor sequence within the URA3 promoter. The 5-FOA present on plate C is converted into the toxic 5-flourouracil following two-hybrid-dependent induction of URA3. Growth inhibition of y36 on plate C is therefore further evidence of strongly interacting proteins within these yeast cells. For comparison, the control yeast strains c, d and e containing the moderate to strong interacting protein pairs were also inhibited on this plate, whereas growth of the negative control strain t4 was observed.

 
Hybridization of PCR-amplified inserts of positive clones to specific DNA probes corresponding to the human SMN and SIP1 genes revealed that, as reported by other investigators, both Smn (three clones) and Sip1 (three clones) were represented among the positive interactors obtained (data not shown). Sequence analysis of the remaining positive cDNA clones facilitated identification of multiple isolates of the same sequence. Further analysis of one group of overlapping clones, named LK2, is described below.

Identification of a novel RNA helicase gene interacting with Smn
The five LK2 cDNAs were found to correspond to 2.1 kb of an apparently novel RNA helicase gene. Database searching with the predicted peptide sequence derived from the longest LK2 open reading frame (ORF) revealed homology to protein domains of several RNA helicase proteins. RNA helicases are characterized by a core region of 290–360 amino acids with high homology to the murine eIF-4A translation initiation factor (30). This common core region contains eight highly conserved domains, of which domain II is termed the DEAD box element, in reference to the amino acids contained therein (Asp-Glu-Ala-Asp). However, only domains III–VI were contained within the LK2 predicted protein sequence, suggesting that the remaining domains may be encoded by unidentified sequence 5' to the start of the LK2 clone. The sequence 3' to that encoding domain VI detected no homology on DNA database searching, indicating the presence of a novel 3' sequence. This is a characteristic of RNA helicases, and is believed to confer on the protein specific function(s) in addition to its helicase function.

LK2 binds the exon 4 region of Smn
In order to identify which region of Smn facilitates binding of LK2, Smn deletion constructs were generated in which only Smn exons 1–3, 3–5 or 5–7 were present. Binding of LK2 with each construct was assayed by yeast two-hybrid interaction. Only the Smn construct containing exons 3–5 retained the ability to bind LK2 (data not shown). Given the overlap of exons 3 and 5 in the other constructs, their failure to bind suggests that the minimal region of Smn required for interaction with LK2 is that encoded by exon 4. A schematic representation of the binding regions of SMN is shown in Figure 2.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 2. A schematic representation of the Smn coding sequence (exons 1–7) and the regions of this gene known to interact with various binding partners. Overlapping Smn deletion constructs containing exons 1–3, 3–5 and 5–7 are depicted below the gene.

 
LK2 (dp103) sequence analysis
Recent BLAST (31) searches identified LK2 as the mouse orthologue of DP103, a novel human DEAD box protein with ATPase activity (27). Alignment of the mouse LK2 sequence and that of its human orthologue is shown in Figure 3. Since we now know LK2 to be dp103, the LK2 clones identified by yeast two-hybrid analysis will be referred to as dp103 for the remainder of the manuscript. The dp103 clones identified by yeast two-hybrid screening represented partial cDNA clones, so we undertook to clone the full coding sequence of this gene. The dp103 sequence available at this point could not be extended by means of virtual cloning using expressed sequence tags (ESTs) extending 5' to the sequence, since no such ESTs existed in the database. 5' rapid amplification of cDNA ends (5' RACE) was therefore undertaken to extend the sequence. RACE products were cloned and were found to extend the original sequence by 511 bp. Translation of the resulting consensus sequence permitted identification of RNA helicase domains I–II (Fig. 3), the latter of which was found to be a DEAD box, enabling us to designate this gene as encoding a previously unidentified RNA helicase. An additional 99 nucleotides 5' to the sequence encoding domain I was generated by screening the mouse brain cDNA expression library from which dp103 was initially identified, using a probe corresponding to the 5' dp103 sequence identified by RACE. Although it was not possible to identify the putative translational start of the dp103 gene by either method, additional DNA sequence information was obtained following database searching with the extended dp103 sequence. This identified a murine kidney EST (GenBank accession no. AI315871), extending the 5' sequence by a further 94 nucleotides. This additional sequence contains the putative translational start codon.



View larger version (79K):
[in this window]
[in a new window]
 
Figure 3. Alignment of mouse and human DP103. The peptide sequences of the mouse dp103 (shown here as LK2) and human DP103 proteins are aligned and show 85% similarity. The highly conserved domains characteristic of RNA helicase proteins are boxed. The domain nomenclature observed here follows that described previously (34).

 
The ORF encoded by the two shortest dp103 yeast two-hybrid clones (LK2-32 and LK2-36) contained the C-terminal domain of dp103, starting from amino acid 591. Thus, the Smn-binding site is contained within the C-terminal unique region of the putative RNA helicase.

Chromosomal localization of the human DP103 gene
Database searching using the LK2 sequence also permitted identification of a 131 kb PAC (HSJ773A18), which contained the complete DP103 gene. This therefore localized DP103 to human chromosome 1p13.2–1p21.1. We predict the existence of 11 exons, which are well conserved between human and mouse, as well as a long and divergent 3'-untranslated region (3'-UTR). The predicted exon and intron sizes as well as exon–intron boundaries are described in Table 1. To our knowledge, no phenotypes resulting from nerve or muscle pathology occur as a result of mutations in genes contained in this region of chromosome 1 or in the region of synteny on mouse chromosome 3.


View this table:
[in this window]
[in a new window]
 
Table 1. Exon–intron structure and splice junction sequences of DP103
 
dp103 expression profile
Northern analysis of dp103 revealed a discrete transcript of ~3 kb in all mouse tissues examined (Fig. 4A). Similar levels of dp103 expression were observed in all tissues except testis, in which significantly higher levels were present. In testis, hybridization of the dp103 probe detected additional bands suggestive of either alternatively spliced products or related genes, which have yet to be investigated. Hybridization of the same dp103 probe to a mouse developmental northern blot showed high levels of dp103 expression as early as mouse embryonic day 7 (Fig. 4A). In addition, an EST (GenBank accession no. AA388624) with 97% identity to dp103 was identified from an embryonic day 5 mouse cDNA library, suggesting even earlier expression of this gene.



View larger version (68K):
[in this window]
[in a new window]
 
Figure 4. Mouse dp103 expression. (A) A single dp103 transcript of ~3 kb in size was present in mouse heart (He), brain (Br), spleen (Sp), lung (Lu), liver (Li), skeletal muscle (SM) and kidney (Ki). Significantly higher levels of the same transcript were present in testis (Te). Analysis of total mouse embryonic tissue identified dp103 expression as early as embryonic day 7 (e7), and at similar levels during later embryonic development (e11, e15 and e17). (B) Hybridization of control probe (ß-actin) to the same filters and demonstrates that the RNA loading is similar for all tissue samples, except in lane e7 where less RNA is present.

 
Co-immunoprecipitation of Smn and dp103
To examine the interaction of Smn and dp103 in vivo, we generated a polyclonal antibody, PabLK2-AP, specific to dp103. This was used to immunoaffinity purify dp103 complexes from mouse brain. The isolated complexes were then analysed by immunoblotting. Purification of Smn from the dp103 complex was demonstrated using an Smn-specific monoclonal antibody (mAb) (Fig. 5). This demonstrates that in the brain, Smn and dp103 are part of a stable protein complex. PabLK2-AP was not successfully used for immunodetection of bound complexes on western blots, but its specificity was ascertained by detection of a partial in vitro translated dp103 protein and by detection of a band of ~103 kDa in protein isolated from mouse brain (data not shown). Negative controls (unrelated antibody and no antibody in the immunoprecipitation reaction) showed no bands corresponding to Smn when blotted and detected with the anti-Smn mAb. Addition of anti-Smn mAb to a control reaction resulted in detection of bound Smn, as expected.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 5. In vivo interaction between mouse proteins Smn and dp103, by co-immunoprecipitation. Immunodetection of western-blotted proteins using {alpha}-SMN antibody showed the presence of an Smn-immunoreactive band in the total brain lysate. Bands corresponding to Smn were also detected following immunoprecipitation in mouse brain protein with either {alpha}-dp103 antibody (PabLK2-AP) or {alpha}-Smn antibody ({alpha}-SMN-TL). No such bands were observed in the negative control lanes where immunoprecipitation was carried out using an unrelated antibody ({alpha}-MHCs), or where no antibody was added. The larger band in the {alpha}-SMN-TL lane corresponds to the immunoglobulin heavy chain (IgH).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In an attempt to identify SMN–protein interactions relevant to the {alpha}-motor neuron degeneration observed in SMA, we carried out yeast two-hybrid screening of a mouse brain cDNA library using the mouse Smn coding sequence as bait. We have identified a direct interaction between Smn and a protein which we termed LK2, and which database searching has shown to be the mouse homologue of a novel DEAD box RNA helicase, DP103 (27). We have shown, using truncated forms of Smn, that dp103 binds to the region of the Smn protein encoded by exon 4. This region is also implicated in the binding of the papillomavirus nuclear transcription activator E2 (28). It is the unique C-terminus of dp103 which interacts with Smn. The presence of a complex containing Smn and dp103 was confirmed in vivo by co-immunoprecipitation of both proteins from normal mouse brain. Immunocytochemistry studies of dp103 demonstrated weak staining of nuclear gems and uniform staining of the cytoplasm (data not shown). This correlates well with the subcellular distribution of Smn. Human DP103 maps to chromosome 1p13.2–1p21.1, the region of synteny in mouse being on chromosome 3. As yet, we have not identified any gene in this region as a plausible functional candidate for diseases with nerve and/or muscle pathology.

SMN exists as part of a 300 kDa complex and has been shown to directly bind several other protein components, all of which are required for the generation of an active spliceosome. A diagrammatic representation of these interactions, including that between SMN and DP103, showing the SMN regions involved in binding, is shown in Figure 2. SMN has been shown to be critical for snRNP assembly in the cytoplasm since SMN mutations such as those found in SMA patients have been shown to severely affect SMN self association, binding of Sm proteins by SMN and SMN–RNA binding activity (16,32,33).

Although much is now known about the binding partners of SMN and their function, it has not been possible to assign to SMN a function in the spliceosome. In order for the spliceosome to be regenerated, its constituents must be recycled. Mutant SMN mimicking that present in SMA patients has been shown to lack the function of wild-type SMN in regenerating the spliceosome in vitro, suggesting the association of this functional defect with the disease phenotype (32). RNA helicases of the DEAD-box family are known to be involved in many aspects of RNA metabolism, including transcription, pre-mRNA splicing, ribosome biogenesis, nucleocytoplasmic transport, translation and RNA degradation (reviewed in ref. 34). RNA helicases have been extensively studied in the yeast, Saccharomyces cerevisiae, and functions associated with their helicase activity have been assigned to the majority of these proteins (34). In addition, despite having highly conserved core regions with helicase function, they usually posses variable N- or C-terminal regions believed to carry out specific functions, possibly by their interaction with other proteins or RNAs. It has already been suggested that a DEAD box helicase may yet be identified as a constituent of the large protein complex incorporating SMN and SIP1 (19). The Smn-interacting protein described here, dp103, contains a DEAD-box domain which specifies it as a member of a subset of RNA helicases, the DEAD-box family. In addition, dp103 contains novel 5' and 3' ends, which presumably confer on the protein either substrate specificity or a separate function.

One possibility is that DP103 acts as a recycling factor in the reconstitution of an active spliceosome. Indeed, recycling factors essential for splicing have been shown previously to be DEAD box helicases (35). Although generally assumed to act on dsRNA, the substrate of DEAD box proteins can also be an RNA–protein complex. SMN is known to bind nucleic acid, both RNA and DNA, mediated by the region encoded by exon 2 (33). SMN may therefore act as a scaffold protein, localizing in very close proximity important constituents involved in generation/regeneration of the spliceosome, such as the helicase, SIP1 and the Sm proteins, as well as directly binding DNA and/or RNA.

During preparation of this manuscript, Charroux et al. (36) identified a putative RNA helicase as part of the SMN–SIP1 complex. These authors report the molecular cloning and characterization of a protein designated Gemin3, identified by immunoprecipitation with SMN, followed by mass spectrometry. Antibodies specific to Gemin3 colocalize with SMN in gems. In vitro assays demonstrate that Gemin3 interacts directly with SMN and with several spliceosomal Sm proteins. Although not identified by Charroux et al. (36), sequence comparison shows that Gemin3 is identical to DP103. Both ourselves and Charroux et al. (36) have therefore demonstrated, by different methods, a direct interaction between SMN and the same putative RNA helicase. However, discrepancies exist in the predicted SMN-binding region of DP103. Using in vitro binding of fusion proteins, Charroux et al. (36) deduced the binding site to exist between amino acids 456 and 547 of Gemin3. A fusion protein containing amino acids 548–824 failed to bind SMN. Our in vivo method, yeast two-hybrid analysis, has shown that interaction with Smn occurs between amino acids 591 and 824. It is difficult to reconcile these differences at present, although they may result from the different experimental approaches taken. A similar problem has existed in the determination of the correct SMN-binding domain for Sm proteins, where the use of different approaches resulted in discrepant results (15,17). Charrroux et al. (36) also found that the deletion of SMN exon 7 results in defective binding of SMN to Gemin 3 (DP103) in an in vitro binding assay. It would be of interest to determine whether the inter­action between SMN and DP103 in a yeast two-hybrid assay would be affected by deletion of SMN exon 7. Although discrepancies exist in the reported SMN-binding region, the use of different experimental approaches should help to clarify this, as has been the case with the Sm binding region of SMN. It will be important to determine the exact SMN-binding domain, since inference may then be made as to how individual patient mutations may affect such SMN–protein interactions.

Human DP103 binds viral nuclear proteins EBNA2 and EBNA3C (27). These proteins interact with a cellular transcription factor, which in turn modulates expression of several shared target genes. SMN has also been shown to interact with a nuclear transcription factor, the E2 gene of papillomavirus, implying that SMN may play a role in modulation of gene expression (28). DP103 was found to exist in high molecular weight complexes in the soluble nuclear fraction of both EBV-positive and EBV-negative cell lines, suggesting its localization to such complexes is independent of its binding to EBNA2 and EBNA3C proteins (27). Charroux et al. (36) have now shown that DP103 (Gemin3) exists as part of the 300 kDa protein complex also containing SMN.

At least two other RNA helicases have been identified as spliceosome-associated proteins, following purification of human splicing complexes by mass spectrometry, neither of which is dp103 (37). It has been proposed that SMA results from a defect in pre-mRNA splicing (19). Indeed, the complete lack of SMN has a devastating effect on embryogenesis in the homozygous null mutant mouse, presumably due to the absence of splicing (10). However, in SMA patients, the presence of SMN2 gene copies ensures that SMN is never completely lacking. Thus, SMN levels may be high enough for the assembly of functional spliceosomes. The defect observed in SMA may therefore lie in the failure of correct gene expression in neurons and/or muscle. It remains to be seen whether DP103 is directly involved in splicing. Charroux et al. (36) present evidence that this is the case. However, DP103 may also play a role with SMN as part of a protein complex involved in the regulation of a target gene or genes, as suggested by its involvement with EBNA2 and EBNA3C.

The 3 kb dp103 transcript is expressed in all tissues tested and from a very early stage in mouse development, suggesting that it may have a fundamental biological role. However, the ubiquitous nature of its expression does not preclude a role for dp103 in a specific subset of neurons. Interestingly, a very similar observation is made in a mouse whose phenotype bears a remarkable resemblance to SMA. The spontaneous autosomal recessive mouse neuromuscular degeneration (nmd) mutant has progressive degeneration of spinal motor neurons and subsequent skeletal muscle atrophy (38). The causative mutation occurs in a putative transcriptional activator and ATPase/DNA helicase which leads, via an unknown pathway, to the specific degeneration of {alpha}-motor neurons of the spinal cord. As is the case for RNA helicases, members of the DNA helicase superfamily are known to participate in many cellular activities, often with multiple functions. Although the nmd gene is potentially involved in transcriptional activation, its true biological activity is as yet unknown. Despite the lack of any obvious pathological mechanism suggested by the ubiquitous expression pattern of nmd or by its possible biochemical activities, just as in the case of SMA, the specific neuronal degeneration remains unexplained.

The results presented here do not identify the cause of motor neuron death due to SMN deficiency. However, these results have identified another SMN-binding protein, DP103, which may play a role in snRNP biogenesis, but which we believe adds weight to the involvement of SMN in regulating gene expression. For the future, identification of genes whose expression is modulated by SMN may yield valuable clues as to why motor neurons fail to thrive in conditions of low SMN levels.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Yeast two-hybrid analysis
A mouse Smn cDNA construct containing the entire coding sequence (amino acids 1–288) was generated by PCR using gene specific primers flanked by SalI recognition sites, and was cloned in-frame into the SalI site downstream of the sequence encoding the GAL4 DNA binding domain in the yeast two-hybrid vector pDBLeu (ProQuest Two-Hybrid system; Life Technologies, Rockville, MD), to generate pDBLeu-Smn, encoding a GAL4-Smn fusion protein. Screening of a mouse brain cDNA expression library cloned in pPC86 (kindly provided by Life Technologies), for cDNAs encoding putative Smn-interacting proteins, was carried out as directed in the ProQuest protocol. Briefly, a self-activation assay of pDBLeu-Smn was carried out in yeast strain MaV203. The basal level of expression of the reporter gene HIS3 in MaV203 transformed with the bait construct pDBLeu-Smn and the prey vector pPC86 was titrated by inclusion of 3-aminotriazole (3AT) in plates lacking histidine. Levels of 3AT in excess of 10 mM were found to inhibit growth of transformants, so 25 mM 3AT was included in all selection plates lacking histidine when the screen was performed.

Competent yeast cells of strain MaV203 were co-transformed with 10 µg pDBLeu-Smn bait plasmid and 10 µg pPC86-library plasmid, and ~2 x 106 transformants were plated on SC-Leu-Trp + 25 mM 3AT. Following incubation for 3 days at 30°C, plates were replica-cleaned and replaced at 30°C for a further 2 days. Positive colonies were streaked out for single colonies, then four such colonies were patched onto SC-Leu-Trp master plates, along with two colonies of control strains containing interacting proteins of differing strengths (provided in the ProQuest kit).

Master plates were replica-plated onto selection media to assay for induction of each of three reporter genes, HIS3, URA3 and lacZ, as described in the ProQuest protocol. Plasmid DNA was isolated from positive yeast colonies and prey plasmids were selected on L-amp plates following electroporation into Escherichia coli. Insert sizing by PCR was carried out on several colonies of each potential interactor to check for the presence of more than one prey plasmid. Representative plasmids for each potential interactor were then re-transformed into MaV203 containing pDBLeu-Smn, to check for re-establishment of the interaction phenotype. Secondary positives were thus identified for further analysis.

DNA sequence analysis
Oligonucleotide primers complimentary to sites flanking the prey inserts in pPC86 were used to sequence both ends of each secondary positive by automated dye termination sequencing. Consensus sequence was obtained from multiple cDNAs representative of the same gene by the generation of sequence contigs. The BLAST server at the National Institutes of Health (http://www.ncbi.nlm.nih.gov ) (31) was used to search for sequence similarities with known DNA (blastn) or protein (blastp) sequences.

5' RACE and cDNA library screening
In order to obtain additional 5' sequence of the LK2 gene, 5' RACE was performed using a mouse brain cDNA RACE library according to the manufacturer’s instructions (Clontech, Palo Alto, CA). In addition to this approach, additional 5' sequence was obtained by screening the pPC86 mouse brain cDNA library supplied in the ProQuest yeast two-hybrid kit with a cDNA probe contained within the sequence obtained by RACE.

Northern analysis
Mouse multiple tissue and developmental northern blots (Clontech) were hybridized with a 32P-labelled 1.1 kb ApoI fragment derived from the 3' end of LK2 or the control ß-actin coding sequence. Hybridization was carried out for 1 h at 50°C in ExpressHyb (Clontech). Filters were washed to 0.2x SSC/0.1% SDS and exposed to X-ray film for 1–3 days.

Immunoprecipitation
A peptide antibody to LK2 was raised in rabbits by immunization with the following synthetic peptide corresponding to a sequence near the C-terminus of the predicted LK2 protein sequence (RHKEGANQRSKQSRRNPARR) (Sigma-Genosys, Pampisford, UK). Serum was initially precipitated with NaSO4, then affinity-purified. This antibody (PabLK2-AP) was then used in immunoprecipitation studies. Total protein extract was prepared from a fresh C57/B10 mouse brain by brief homogenization with 7 ml of lysis buffer according to the protocol (Protein G immunoprecipitation kit; Roche Diagnostics Ltd, Lewes, UK). Lysate was centrifuged (12 000 g/10 min at 4°C), and supernatant was then incubated with PabLK2-AP, {alpha}-SMN-TL (mouse mAb specific to SMN; Transduction Laboratories, Lexington, KY), or control antibody {alpha}-MHCs (mouse mAb specific to the slow isoform of the myosin heavy chain; Novocastra Laboratories Ltd, Newcastle upon Tyne, UK) for 6 h at 4°C. Protein G beads (50 ml; Roche) were added and incubated overnight at 4°C. Washing was carried out as directed by the protocol and the final pellet was boiled in 1x Laemmli sample buffer and electrophoresed on a 12% SDS–PAGE gel. Proteins were transferred onto nitrocellulose and blocked overnight in 5% non-fat milk/TBST. Immunodetection was performed using {alpha}-SMN-TL at 1:3000 dilution. Bound antibody was detected using {alpha}-mouse HRP and visualized using chemiluminescence (Roche).

Generation of Smn deletion constructs
Three overlapping Smn bait constructs, containing specific Smn exons only, were generated for yeast two-hybrid interaction with two LK2 prey clones (LK2-11 and LK2-25). These were designed as: Smn1-3, Smn3-5 and Smn5-7. Inserts were generated by amplification from the pDBLeu-Smn bait plasmid using a high fidelity PCR system (Roche). Oligonucleotide primers containing SalI (forward primers) or NotI (reverse primers) restriction sites were designed as follows:

exon 1 for, gtcgaccatggcgatgggcagtggc;

exon 3 for, gtcgacctggaaagttggtgacaagtgttc;

exon 3 rev, gcggccgcctcctgagtgttctgttctg;

exon 5 for, gtcgaccccaggtctaaaattcaacggc;

exon 5 rev, gcggccgctggtggtcctgaagggaacg;

exon 7 rev, gcggccgcatttgtatgtgagcactttcc.

PCR products were cloned into pGEM-T (Promega, Madison, WI) then directionally cloned into pDBLeu (Life Technologies). Binding of each deletion construct with LK2-11 and LK2-25 was assayed by yeast two-hybrid interaction according to the protocol described above (ProQuest, Life Technologies).


    ACKNOWLEDGEMENTS
 
We are grateful to Derek Blake, Sarah Newey, Allyson Potter and Chris Ponting for useful discussion and technical help. We thank Life Technologies for access to the ProQuest system prior to its commercial release. This work was supported by the Wellcome Trust, the Muscular Dystrophy Campaign UK, the Families of SMA and the Muscular Dystrophy Association USA.


    FOOTNOTES
 
+ Present address: Mammalian Genetics Unit, MRC Harwell, Oxfordshire OX11 0RD, UK Back

§ To whom correspondence should be addressed. Tel: +44 1865 275317; Fax: +44 1865 272427; Email: kay.davies@anat.ox.ac.uk Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
1 Dubowitz, V. (1995) Muscle Disorders in Childhood, 2nd edn. WB Saunders, London, UK.

2 Lefebvre, S., Burglen, L., Reboullet, S., Clermont, O., Burlet, P., Viollet, L., Benichou, B., Cruaud, C., Millasseau, P., Zeviani, M. et al. (1995) Identification and characterization of a spinal muscular atrophy-determining gene. Cell, 80, 155–165.[Web of Science][Medline]

3 Burghes, A.H. (1997) When is a deletion not a deletion? When it is converted. Am. J. Hum. Genet., 61, 9–15.[Web of Science][Medline]

4 Campbell, L., Potter, A., Ignatius, J., Dubowitz, V. and Davies, K. (1997) Genomic variation and gene conversion in spinal muscular atrophy: implications for disease process and clinical phenotype. Am. J. Hum. Genet., 61, 40–50.[Web of Science][Medline]

5 Coovert, D.D., Le, T.T., McAndrew, P.E., Strasswimmer, J., Crawford, T.O., Mendell, J.R., Coulson, S.E., Androphy, E.J., Prior, T.W. and Burghes, A.H. (1997) The survival motor neuron protein in spinal muscular atrophy. Hum. Mol. Genet., 6, 1205–1214.[Abstract/Free Full Text]

6 Lefebvre, S., Burlet, P., Liu, Q., Bertrandy, S., Clermont, O., Munnich, A., Dreyfuss, G. and Melki, J. (1997) Correlation between severity and SMN protein level in spinal muscular atrophy. Nature Genet., 16, 265–269.[Web of Science][Medline]

7 Gennarelli, M., Lucarelli, M., Capon, F., Pizzuti, A., Merlini, L., Angelini, C., Novelli, G. and Dallapiccola, B. (1995) Survival motor neuron gene transcript analysis in muscles from spinal muscular atrophy patients. Biochem. Biophys. Res. Commun., 213, 342–348.[Web of Science][Medline]

8 McAndrew, P.E., Parsons, D.W., Simard, L.R., Rochette, C., Ray, P.N., Mendell, J.R., Prior, T.W. and Burghes, A.H. (1997) Identification of proximal spinal muscular atrophy carriers and patients by analysis of SMNT and SMNC gene copy number. Am. J. Hum. Genet., 60, 1411–1422.

9 Taylor, J.E., Thomas, N.H., Lewis, C.M., Abbs, S.J., Rodrigues, N.R., Davies, K.E. and Mathew, C.G. (1998) Correlation of SMNt and SMNc gene copy number with age of onset and survival in spinal muscular atrophy. Eur. J. Hum. Genet., 6, 467–474.[Web of Science][Medline]

10 Schrank, B., Gotz, R., Gunnersen, J.M., Ure, J.M., Toyka, K.V., Smith, A.G. and Sendtner, M. (1997) Inactivation of the survival motor neuron gene, a candidate gene for human spinal muscular atrophy, leads to massive cell death in early mouse embryos. Proc. Natl Acad. Sci. USA, 94, 9920–9925.[Abstract/Free Full Text]

11 Burlet, P., Huber, C., Bertrandy, S., Ludosky, M.A., Zwaenepoel, I., Clermont, O., Roume, J., Delezoide, A.L., Cartaud, J., Munnich, A. and Lefebvre, S. (1998) The distribution of SMN protein complex in human fetal tissues and its alteration in spinal muscular atrophy. Hum. Mol. Genet., 7, 1927–1933.[Abstract/Free Full Text]

12 Novelli, G., Calza, L., Amicucci, P., Giardino, L., Pozza, M., Silani, V., Pizzuti, A., Gennarelli, M., Piombo, G., Capon, F. and Dallapiccola, B. (1997) Expression study of survival motor neuron gene in human fetal tissues. Biochem. Mol. Med., 61, 102–106.

13 Battaglia, G., Princivalle, A., Forti, F., Lizier, C. and Zeviani, M. (1997) Expression of the SMN gene, the spinal muscular atrophy determining gene, in the mammalian central nervous system. Hum. Mol. Genet., 6, 1961–1971.[Abstract/Free Full Text]

14 Liu, Q. and Dreyfuss, G. (1996) A novel nuclear structure containing the survival of motor neurons protein. EMBO J., 15, 3555–3565.[Web of Science][Medline]

15 Liu, Q., Fischer, U., Wang, F. and Dreyfuss, G. (1997) The spinal muscular atrophy disease gene product, SMN, and its associated protein SIP1 are in a complex with spliceosomal snRNP proteins. Cell, 90, 1013–1021.[Web of Science][Medline]

16 Lorson, C.L., Strasswimmer, J., Yao, J.M., Baleja, J.D., Hahnen, E., Wirth, B., Le, T., Burghes, A.H. and Androphy, E.J. (1998) SMN oligomerization defect correlates with spinal muscular atrophy severity. Nature Genet., 19, 63–66.[Web of Science][Medline]

17 Buhler, D., Raker, V., Luhrmann, R. and Fischer, U. (1999) Essential role for the tudor domain of SMN in spliceosomal U snRNP assembly: implications for spinal muscular atrophy. Hum. Mol. Genet., 8, 2351–2357.[Abstract/Free Full Text]

18 Fischer, U., Liu, Q. and Dreyfuss, G. (1997) The SMN–SIP1 complex has an essential role in spliceosomal snRNP biogenesis. Cell, 90, 1023–1029.[Web of Science][Medline]

19 Pellizzoni, L., Kataoka, N., Charroux, B. and Dreyfuss, G. (1998) A novel function for SMN, the spinal muscular atrophy disease gene product, in pre-mRNA splicing. Cell, 95, 615–624.[Web of Science][Medline]

20 Williams, B.Y., Vinnakota, S., Sawyer, C.A., Waldrep, J.C., Hamilton, S.L. and Sarkar, H.K. (1999) Differential subcellular localization of the survival motor neuron protein in spinal cord and skeletal muscle. Biochem. Biophys. Res. Commun., 254, 10–14.[Web of Science][Medline]

21 Francis, J.W., Sandrock, A.W., Bhide, P.G., Vonsattel, J.P. and Brown, R.H. Jr (1998) Heterogeneity of subcellular localization and electrophoretic mobility of survival motor neuron (SMN) protein in mammalian neural cells and tissues. Proc. Natl Acad. Sci. USA, 95, 6492–6497.[Abstract/Free Full Text]

22 Bechade, C., Rostaing, P., Cisterni, C., Kalisch, R., La Bella, V., Pettmann, B. and Triller, A. (1999) Subcellular distribution of survival motor neuron (SMN) protein: possible involvement in nucleocytoplasmic and dendritic transport. Eur. J. Neurosci., 11, 293–304.[Web of Science][Medline]

23 Iwahashi, H., Eguchi, Y., Yasuhara, N., Hanafusa, T., Matsuzawa, Y. and Tsujimoto, Y. (1997) Synergistic anti-apoptotic activity between Bcl-2 and SMN implicated in spinal muscular atrophy. Nature, 390, 413–417.[Medline]

24 Broccolini, A., Engel, W.K. and Askanas, V. (1999) Localization of survival motor neuron protein in human apoptotic-like and regenerating muscle fibers, and neuromuscular junctions. Neuroreport, 10, 1637–1641.[Web of Science][Medline]

25 Viollet, L., Bertrandy, S., Bueno Brunialti, A.L., Lefebvre, S., Burlet, P., Clermont, O., Cruaud, C., Guenet, J.L., Munnich, A. and Melki, J. (1997) cDNA isolation, expression, and chromosomal localization of the mouse survival motor neuron gene (Smn). Genomics, 40, 185–188.[Web of Science][Medline]

26 DiDonato, C.J., Chen, X.N., Noya, D., Korenberg, J.R., Nadeau, J.H. and Simard, L.R. (1997) Cloning, characterization, and copy number of the murine survival motor neuron gene: homolog of the spinal muscular atrophy-determining gene. Genome Res., 7, 339–352.[Abstract/Free Full Text]

27 Grundhoff, A.T., Kremmer, E., Tureci, O., Glieden, A., Gindorf, C., Atz, J., Mueller-Lantzsch, N., Schubach, W.H. and Grasser, F.A. (1999) Characterization of DP103, a novel DEAD box protein that binds to the Epstein–Barr virus nuclear proteins EBNA2 and EBNA3C. J. Biol. Chem., 274, 19136–19144.[Abstract/Free Full Text]

28 Strasswimmer, J., Lorson, C.L., Breiding, D.E., Chen, J.J., Le, T., Burghes, A.H. and Androphy, E.J. (1999) Identification of survival motor neuron as a transcriptional activator-binding protein. Hum. Mol. Genet., 8, 1219–1226.[Abstract/Free Full Text]

29 Fields, S. and Song, O. (1989) A novel genetic system to detect protein–protein interactions. Nature, 340, 245–246.[Medline]

30 Luking, A., Stahl, U. and Schmidt, U. (1998) The protein family of RNA helicases. Crit. Rev. Biochem. Mol. Biol., 33, 259–296.[Web of Science][Medline]

31 Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol., 215, 403–410.[Web of Science][Medline]

32 Pellizzoni, L., Charroux, B. and Dreyfuss, G. (1999) SMN mutants of spinal muscular atrophy patients are defective in binding to snRNP proteins. Proc. Natl Acad. Sci. USA, 96, 11167–11172.[Abstract/Free Full Text]

33 Lorson, C.L. and Androphy, E.J. (1998) The domain encoded by exon 2 of the survival motor neuron protein mediates nucleic acid binding. Hum. Mol. Genet., 7, 1269–1275. [Erratum (1998) Hum. Mol. Genet., 7, 1831.][Abstract/Free Full Text]

34 de la Cruz, J., Kressler, D. and Linder, P. (1999) Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci., 24, 192–198.[Web of Science][Medline]

35 Staley, J.P. and Guthrie, C. (1998) Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell, 92, 315–326.[Web of Science][Medline]

36 Charroux, B., Pellizzoni, L., Perkinson, R.A., Shevchenko, A., Mann, M. and Dreyfuss, G. (1999) Gemin3: a novel DEAD box protein that interacts with SMN, the spinal muscular atrophy gene product, and is a component of gems. J. Cell Biol., 147, 1181–1193.[Abstract/Free Full Text]

37 Neubauer, G., King, A., Rappsilber, J., Calvio, C., Watson, M., Ajuh, P., Sleeman, J., Lamond, A. and Mann, M. (1998) Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nature Genet., 20, 46–50.[Web of Science][Medline]

38 Cox, G.A., Mahaffey, C.L. and Frankel, W.N. (1998) Identification of the mouse neuromuscular degeneration gene and mapping of a second site suppressor allele. Neuron, 21, 1327–1337.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
JCBHome page
L. Trinkle-Mulcahy, S. Boulon, Y. W. Lam, R. Urcia, F.-M. Boisvert, F. Vandermoere, N. A. Morrice, S. Swift, U. Rothbauer, H. Leonhardt, et al.
Identifying specific protein interaction partners using quantitative mass spectrometry and bead proteomes
J. Cell Biol., October 20, 2008; 183(2): 223 - 239.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Piazzon, F. Rage, F. Schlotter, H. Moine, C. Branlant, and S. Massenet
In Vitro and in Cellulo Evidences for Association of the Survival of Motor Neuron Complex with the Fragile X Mental Retardation Protein
J. Biol. Chem., February 29, 2008; 283(9): 5598 - 5610.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Ogawa, K. Usui, M. Aoki, F. Ito, M. Itoh, C. Kai, M. Kanamori-Katayama, Y. Hayashizaki, and H. Suzuki
Gemin2 Plays an Important Role in Stabilizing the Survival of Motor Neuron Complex
J. Biol. Chem., April 13, 2007; 282(15): 11122 - 11134.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Otter, M. Grimmler, N. Neuenkirchen, A. Chari, A. Sickmann, and U. Fischer
A Comprehensive Interaction Map of the Human Survival of Motor Neuron (SMN) Complex
J. Biol. Chem., February 23, 2007; 282(8): 5825 - 5833.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
F. V. Fuller-Pace
DExD/H box RNA helicases: multifunctional proteins with important roles in transcriptional regulation
Nucleic Acids Res., September 10, 2006; 34(15): 4206 - 4215.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
B. Renvoise, K. Khoobarry, M.-C. Gendron, C. Cibert, L. Viollet, and S. Lefebvre
Distinct domains of the spinal muscular atrophy protein SMN are required for targeting to Cajal bodies in mammalian cells
J. Cell Sci., February 15, 2006; 119(4): 680 - 692.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
R. Olaso, V. Joshi, J. Fernandez, N. Roblot, S. Courageot, J. P. Bonnefont, and J. Melki
Activation of RNA metabolism-related genes in mouse but not human tissues deficient in SMN
Physiol Genomics, January 12, 2006; 24(2): 97 - 104.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
D.J. BATTLE, M. KASIM, J. YONG, F. LOTTI, C.-K. LAU, J. MOUAIKEL, Z. ZHANG, K. HAN, L. WAN, and G. DREYFUSS
The SMN Complex: An Assembly Machine for RNPs
Cold Spring Harb Symp Quant Biol, January 1, 2006; 71(0): 313 - 320.
[Abstract] [PDF]


Home page
Hum Mol GenetHome page
J. Irobi, P. De Jonghe, and V. Timmerman
Molecular genetics of distal hereditary motor neuropathies
Hum. Mol. Genet., October 1, 2004; 13(suppl_2): R195 - R202.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Zou, F. Barahmand-pour, M. L. Blackburn, Y. Matsui, H. A. Chansky, and L. Yang
Survival Motor Neuron (SMN) Protein Interacts with Transcription Corepressor mSin3A
J. Biol. Chem., April 9, 2004; 279(15): 14922 - 14928.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. L. Gillian and J. Svaren
The Ddx20/DP103 Dead Box Protein Represses Transcriptional Activation by Egr2/Krox-20
J. Biol. Chem., March 5, 2004; 279(10): 9056 - 9063.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
K. Anderson, A. Potter, D. Baban, and K. E. Davies
Protein expression changes in spinal muscular atrophy revealed with a novel antibody array technology
Brain, September 1, 2003; 126(9): 2052 - 2064.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Y. B. Chan, I. Miguel-Aliaga, C. Franks, N. Thomas, B. Trulzsch, D. B. Sattelle, K. E. Davies, and M. van den Heuvel
Neuromuscular defects in a Drosophila survival motor neuron gene mutant
Hum. Mol. Genet., June 15, 2003; 12(12): 1367 - 1376.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
G. K. Carnegie, J. E. Sleeman, N. Morrice, C. J. Hastie, M. W. Peggie, A. Philp, A. I. Lamond, and P. T. W. Cohen
Protein phosphatase 4 interacts with the Survival of Motor Neurons complex and enhances the temporal localisation of snRNPs
J. Cell Sci., May 15, 2003; 116(10): 1905 - 1913.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Barth, M. Liss, M. D. Voss, T. Dobner, U. Fischer, G. Meister, and F. A. Grasser
Epstein-Barr Virus Nuclear Antigen 2 Binds via Its Methylated Arginine-Glycine Repeat to the Survival Motor Neuron Protein
J. Virol., April 15, 2003; 77(8): 5008 - 5013.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
U. R. Monani, M. T. Pastore, T. O. Gavrilina, S. Jablonka, T. T. Le, C. Andreassi, J. M. DiCocco, C. Lorson, E. J. Androphy, M. Sendtner, et al.
A transgene carrying an A2G missense mutation in the SMN gene modulates phenotypic severity in mice with severe (type I) spinal muscular atrophy
J. Cell Biol., January 2, 2003; 160(1): 41 - 52.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X. Yan, J.-F. Mouillet, Q. Ou, and Y. Sadovsky
A Novel Domain within the DEAD-Box Protein DP103 Is Essential for Transcriptional Repression and Helicase Activity
Mol. Cell. Biol., January 1, 2003; 23(1): 414 - 423.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
S. Massenet, L. Pellizzoni, S. Paushkin, I. W. Mattaj, and G. Dreyfuss
The SMN Complex Is Associated with snRNPs throughout Their Cytoplasmic Assembly Pathway
Mol. Cell. Biol., September 15, 2002; 22(18): 6533 - 6541.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Jablonka, B. Holtmann, G. Meister, M. Bandilla, W. Rossoll, U. Fischer, and M. Sendtner
Gene targeting of Gemin2 in mice reveals a correlation between defects in the biogenesis of U snRNPs and motoneuron cell death
PNAS, July 23, 2002; 99(15): 10126 - 10131.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Lefebvre, P. Burlet, L. Viollet, S. Bertrandy, C. Huber, C. Belser, and A. Munnich
A novel association of the SMN protein with two major non-ribosomal nucleolar proteins and its implication in spinal muscular atrophy
Hum. Mol. Genet., May 1, 2002; 11(9): 1017 - 1027.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
W. Rossoll, A.-K. Kroning, U.-M. Ohndorf, C. Steegborn, S. Jablonka, and M. Sendtner
Specific interaction of Smn, the spinal muscular atrophy determining gene product, with hnRNP-R and gry-rbp/hnRNP-Q: a role for Smn in RNA processing in motor axons?
Hum. Mol. Genet., January 1, 2002; 11(1): 93 - 105.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. D. Voss, A. Hille, S. Barth, A. Spurk, F. Hennrich, D. Holzer, N. Mueller-Lantzsch, E. Kremmer, and F. A. Grasser
Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter
J. Virol., December 1, 2001; 75(23): 11781 - 11790.
[Abstract] [Full Text]


Home page
Hum Mol GenetHome page
S. Jablonka, M. Bandilla, S. Wiese, D. Buhler, B. Wirth, M. Sendtner, and U. Fischer
Co-regulation of survival of motor neuron (SMN) protein and its interactor SIP1 during development and in spinal muscular atrophy
Hum. Mol. Genet., March 1, 2001; 10(5): 497 - 505.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Q. Ou, J.-F. Mouillet, X. Yan, C. Dorn, P. A. Crawford, and Y. Sadovsky
The DEAD Box Protein DP103 Is a Regulator of Steroidogenic Factor-1
Mol. Endocrinol., January 1, 2001; 15(1): 69 - 79.
[Abstract] [Full Text]


Home page
Hum Mol GenetHome page
U. R. Monani, D. D. Coovert, and A. H.M. Burghes
Animal models of spinal muscular atrophy
Hum. Mol. Genet., October 1, 2000; 9(16): 2451 - 2457.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G. Meister, D. Buhler, B. Laggerbauer, M. Zobawa, F. Lottspeich, and U. Fischer
Characterization of a nuclear 20S complex containing the survival of motor neurons (SMN) protein and a specific subset of spliceosomal Sm proteins
Hum. Mol. Genet., August 12, 2000; 9(13): 1977 - 1986.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang and G. Dreyfuss
A Cell System with Targeted Disruption of the SMN Gene. FUNCTIONAL CONSERVATION OF THE SMN PROTEIN AND DEPENDENCE OF Gemin2 ON SMN
J. Biol. Chem., March 23, 2001; 276(13): 9599 - 9605.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang and G. Dreyfuss
Characterization of Functional Domains of the SMN Protein in Vivo
J. Biol. Chem., November 21, 2001; 276(48): 45387 - 45393.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. K. Gubitz, Z. Mourelatos, L. Abel, J. Rappsilber, M. Mann, and G. Dreyfuss
Gemin5, a Novel WD Repeat Protein Component of the SMN Complex That Binds Sm Proteins
J. Biol. Chem., February 8, 2002; 277(7): 5631 - 5636.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. A. Kerr, J. P. Nery, R. J. Traystman, B. N. Chau, and J. M. Hardwick
Survival motor neuron protein modulates neuron-specific apoptosis
PNAS, November 21, 2000; 97(24): 13312 - 13317.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (61)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Campbell, L.
Right arrow Articles by Davies, K. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Campbell, L.
Right arrow Articles by Davies, K. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?