Human Molecular Genetics, 2000, Vol. 9, No. 8 1177-1183
© 2000 Oxford University Press
Did nucleotides or amino acids drive evolutionary conservation of the WT1 ±KTS alternative splice?
1MRC Human Genetics Unit, Western General Hospital, Crewe Road, Edinburgh EH4 2XU, UK and 2Karolinska Institute, Department of Cell and Molecular Biology, S-171 77 Stockholm, Sweden
Received 8 December 1999; Revised and Accepted 29 February 2000.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Evolutionary comparisons frequently pinpoint crucial parts of a protein but, even within coding regions, nucleotides can do more than determine amino acid sequence. One highly conserved feature of the Wilms’ tumour suppressor gene, WT1, is the potential, following alternative pre-mRNA splicing, to insert three amino acids (KTS) between the third and fourth zinc fingers. The nucleotides at this position simultaneously define amino acids and the alternative splice site. At the protein level this insertion influences DNA binding affinity and specificity, protein–protein interactions and subnuclear localization. Mutations within the ±KTS splice junction lead to severe urogenital developmental abnormalities such as Frasier syndrome, indicating that the isoform ratio is critical for wild-type function. Using a series of site-directed mutations in both the genomic and cDNA context, the nucleotide–amino acid relationship was investigated. Mutational analysis within the cDNA suggests that the precise amino acids inserted may not be critical, but rather the disruption of the zinc finger structure alone may be sufficient to generate proteins with different in vitro properties. However, analysis within the genomic context suggests that the precise structure of the splice junction is crucial in retaining the balance between the isoforms, and this may account for the high nucleotide conservation of this unusual gene structure from fish to mammals.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
It is commonly assumed that during the course of evolution nucleotides have mutated randomly, and a particular base will become conserved if it defines a specific, and important, function. Thus, because of the degenerate nature of the genetic code, the first base of a codon is more likely to be conserved than the third. As nucleotides determine everything about a gene, from its expression to protein function, any position may be conserved for a variety of reasons. The strong conservation of the Wilms’ tumour suppressor gene, WT1, during vertebrate evolution (1,2) has provided an opportunity to study the nucleotide–amino acid relationship where the nucleotides form both part of an alternative splice site and contribute to the coding region.
Defects in the WT1 gene lead to severe kidney and gonad abnormalities (3–5). Multiple proteins are made from the gene by a combination of alternative translational start sites, RNA editing and RNA splicing (6–8). The protein has four zinc fingers and one of the features that has been highly conserved during evolution is the ability to insert three amino acids, KTS, between the third and fourth zinc fingers (1). WT1 proteins have quite different properties depending on their KTS status. WT1 binds to DNA, but the –KTS isoforms bind with strongest affinity and specificity (9). WT1 is a nuclear protein, with the +KTS proteins displaying a predominantly ‘speckled’ pattern, and the –KTS proteins having a more diffuse distribution (10). In addition, the KTS insertion influences protein–protein interactions, +KTS proteins having strongest affinity for the essential splice factor, U2AF65 (11), and –KTS proteins having higher affinity for steroidogenic factor, SF1 (12). Although the functional significance of some of these properties remains to be understood, cumulatively, these data strongly suggest that the different isoforms have different roles within the cell. Indeed it has been possible to demonstrate this in some biological assays. For example, +KTS protein reduces the tumorigenicity of a transformed cell line (13), while –KTS protein can induce apoptosis (14).
Genetic evidence suggests that not only is it important to have both isoforms present within the cell but in addition the precise ratio between the isoforms is critical for wild-type function. WAGR patients, who have a chromosomal deletion encompassing one allele of the WT1 gene (15), and are likely to have reduced levels of both + and –KTS proteins, develop normally, albeit with increased risk of tumours. On the other hand, Frasier syndrome patients, who frequently have mutations that prevent generation of the +KTS isoforms from one allele (16–18), have severe kidney and gonad malformations, suggesting that it is an incorrect balance between the isoforms that leads to the abnormalities, rather than reduced levels of protein per se.
The KTS residues are inserted through use of an alternative splice donor site. The gene has an unusual structure at this location such that the coding residues also define the splice sites (Fig. 1A). The nucleotides across this region are highly conserved amongst vertebrates, with only one change so far reported from man to Fugu (Fig. 1B). A mutational analysis was undertaken to examine more closely whether particular nucleotides were likely to have been conserved because of the amino acids they encoded, or because of their role in maintaining the splice ratio.
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Insertion of residues other than KTS can influence properties of WT1
The KTS insertion influences many aspects of the WT1 protein. One instance where the + and –KTS proteins differ is in their binding to the splice factor U2AF65, the +KTS proteins showing much higher affinity than –KTS proteins, at least in vitro and in the yeast two-hybrid system (11). These residues are highly conserved, the only change reported in vertebrates to date is KPS in Fugu (2). Following site-directed mutagenesis the C-terminal portion of WT1 carrying a KPS motif was introduced into a yeast two-hybrid assay system to test its interaction with U2AF65, a previous study having shown that the C-terminus is sufficient for U2AF65 binding (11). By measuring ß-galactosidase activity produced in the transformed Y190 yeast as a reporter of protein–protein affinity (19) it was found that C+KPS showed strong U2AF65 binding activity, like the C-terminal portion of +KTS isoforms (Fig. 2A).
|
Considering the KTS motif in more detail, both serine and threonine are potentially sites for phosphorylation. While there is no suggestive evidence that the KTS motif becomes phosphorylated it is nevertheless possible that this may contribute to the differences between the + and –KTS proteins. To investigate this the serine and threonine residues were mutated within the cDNA to either alanine residues, which cannot be phosphorylated, or to aspartic acid, the charged state of which mimics constitutive phosphorylation. It was found that again the C-terminal portion of both these proteins, KDD and KAA, behaved like that of +KTS in binding to U2AF65 in the yeast two-hybrid system (Fig. 2A). As a triple alanine mutant, AAA, also retained +KTS-like properties, it seemed that the precise amino acids inserted at this point between the third and fourth zinc fingers were not critical.
To investigate whether the particular number of amino acids inserted affected the properties of the protein, mutants were made that increased or decreased the size of the insertion. Both mutants with increased insertions, KTTS and KTATS, behaved similarly to the +KTS protein, showing strong interaction with U2AF65. Interestingly, the proteins with smaller deletions, AA and A also behaved like +KTS proteins, and it was not until the motif was removed completely in 
KTS that U2AF65 binding was much diminished (Fig. 2A). The ability to regenerate a –KTS phenotype by site-directed mutagenesis shows that the +KTS-like properties of the remaining mutants were unlikely to have arisen artefactually during the mutagenesis procedure. Western blots showed that the differences observed did not reflect relative expression levels, as all constructs were expressed equivalently (data not shown).
To investigate further the properties of the mutant proteins additional tests were carried out. WT1 binds to another protein, SF1, but in contrast to U2AF65 binding, the –KTS proteins appear to have higher affinity (12). An array of WT1 mutants was tested for SF1 binding, this time in the context of the full-length protein, as the WT1 N-terminus is required for interaction (12). It was not possible to examine this within the same yeast strain as the WT1–U2AF65 association, as SF1 appeared toxic to Y190. Unfortunately there was some residual activation of the lacZ reporter in the alternative strain (L40) with the wild-type SF1 and WT1 constructs, as measured in preliminary experiments against various control proteins. The WT1–SF1 interaction was therefore assessed by the ability of transformed L40 colonies to grow without histidine. Although the effect in this assay was quite subtle the WT1 mutant with the best growth was KTS (Fig. 2B), indicating that this protein had the strongest interaction with SF1, and again suggesting that insertion of any number of residues between the third and fourth zinc finger influences protein function.
Another KTS-dependent feature of WT1 is nuclear distribution. +KTS proteins display a characteristic speckled pattern that overlaps with the distribution of splice factors, whilst –KTS proteins tend to aggregate in large domains (10). The mutant proteins were transiently transfected into cos7 cells and the nuclear localization examined. All the mutants tested, except KTS, displayed good co-localization with splice factors (Fig. 2C). KTS adopted a distribution very similar to –KTS wild-type protein (data not shown). While the assays used here are essentially in vitro, considered together the results suggest that although the + and –KTS proteins have different properties these differences are not reliant on the precise amino acids inserted, or indeed the size of the insertion, rather the mere disruption of the zinc fingers is sufficient to alter phenotype.
Splicing at the ±KTS splice junction
The nucleotides encoding the KTS motif also form part of the alternative splice donor used to generate the isoforms (Fig. 1A). As the ratio between the isoforms is critical for wild-type function (16–18) it was clearly important to examine the role of the nucleotides in splice site definition in addition to protein function. The ability to generate two isoforms with different properties in a defined ratio may have been more important for gene function than the precise amino acids inserted, and it may have been constraints at the splice site that led to the evolutionary conservation. To study this aspect a mini-gene was constructed from the mouse genome, comprising the 3' end of exon 9 and the 5' end of exon 10, with the entire intervening intron (2.3 kb). The mini-gene, driven by a CMV promoter, was HA tagged at the 5' end and myc tagged at the 3' end; thus, using HA and myc primers, any transcripts coming from the mini-gene could be detected by RT–PCR in the background of a WT1 expressing cell (Fig. 3A). To verify that the mini-gene generated spliceable products, the reporter was introduced into a WT1 expressing cell line, M15, and messages arising from the mini-gene compared with those arising endogenously (Fig. 3B). The results showed that transcripts could be derived from the mini-gene both containing or lacking the KTS insertion. Although the precise ratio, deduced following scanning of the gels from a series of experiments (+KTS:–KTS, 1:1), differed slightly from the endogenous ratio (+KTS:–KTS, 1.3:1), the mini-gene provided a tool to dissect splicing at this site.
|
Interestingly, the +/–KTS ratio appeared constant when the reporter was introduced into a variety of cell lines, suggesting that the splice factors involved at the splicing of this junction are not cell type specific (data not shown). It seems more likely that the precise structure of the splice junction at the nucleotide level is the major determinant of splicing at this site. Aligning the sequence with a consensus donor splice site it is apparent that all the nucleotides across this region form part of either the + or the –KTS splice sites (Fig. 1A). Neither the + nor the –KTS sites match precisely to a consensus 5' splice site, derived following comparison of many different vertebrate genes (20). This deviation from the optimal splice sites is likely to contribute to the ratio between the isoforms generated at this position. One of the most frequent changes seen in Frasier syndrome alters the intronic sequence (16,17). This weakens the homology with the consensus at the +KTS site and results in generation of exclusively –KTS species (Fig. 4A and B). Conversely, a mutation at the +KTS junction, which would code for a KTG WT1 protein, and takes the sequence nearer to the consensus splice donor, results in exclusive use of the +KTS site (Fig. 4A and B). Significantly, a mutation taking the –KTS site closer to the consensus would actually be a silent change at the amino acid level, but clearly disrupts the splicing ratio, with only –KTS species being generated (Fig. 4B). Thus, it seems likely that at this position there was strong selection for a particular nucleotide in order to maintain the ability to generate two alternative splice forms.
|
Nucleotide conservation at the ±KTS junction
The strong sequence conservation across this region made it particularly interesting to address whether the only change determined so far, A to C in Fugu (Fig. 1B), had any effect on the splicing ratio. Generating the Fugu equivalent in the mini-gene context, designated KPS, did not appear to affect the splicing ratio, but interestingly neither did changing this residue to other nucleotides in the constructs KAS and KSS (Fig. 4C and D). The altered residue is the last defining the –KTS splice site, and makes the lowest contribution to the consensus, presumably giving it the most freedom (Fig. 1A). Conservation of the A at this position might therefore suggest that the T (or P in Fugu) contributes to protein function in a manner that may not have been detected in the simple assays above.
+/-KTS splice ratio is dependent upon the precise spacing between splice donor sites
In vitro analysis at the protein level suggested that the precise number of amino acids inserted at the KTS position may not be critical for protein function, so it was of interest to see what would happen to splicing across this junction when the size was altered. Initially the distance between the splice junctions was increased, generating KTTS and KTATS (Fig. 5A). This appeared to reduce usage of the +KTS site, as can be most clearly seen from the gel photograph after 18 cycles. Scanning the results from multiple experiments revealed that usage of the +KTS site dropped from 50 to ~33%, even though exactly the same sequences had been retained at the splice sites (Fig. 5B). This suggests that the precise separation between the sites contributes to the splice ratio, and perhaps that the –KTS site somehow helps to recruit splice factors to the +KTS site. Reducing the size of the splice site such that the region would only encode two amino acids, in the case of KS or TS, generated two constructs that only differed by a single residue (Fig. 5A) and had very similar matches to the splice donor consensus. Both these constructs appeared able to generate both + and – species in the same ratio as the wild-type reporter, although there did appear to be activation of a cryptic splicing event (Fig. 5C). Further reduction to the equivalent of inserting only a single amino acid, S (Fig. 5A), destroys the consensus at the +KTS site and results in exclusive use of the –KTS site (data not shown). These results suggest that the size of the KTS splice site makes a significant contribution to the maintenance of the ratio between the isoforms.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The nucleotides forming the KTS insertion site in WT1 are highly conserved throughout vertebrate evolution (1,2). As these residues contribute to both the coding region and splice site definition it provided an opportunity to examine the nucleotide–amino acid relationship. Mutagenesis within the cDNA and genomic context suggests that at some positions the selective pressure may be the resultant amino acid, whilst at others the necessity to control splicing at this complex junction may be the overriding force. Given the severe phenotypes that can arise by following abnormal splicing at this junction in man (16–18), these results serve to emphasize the different behaviour of the WT1 isoforms and the need to generate both forms in a defined ratio, and furthermore, underlines the way that nucleotide sequence dictates gene function.
The + and –KTS proteins have quite different properties in terms of DNA binding, protein–protein interactions and distribution (9–12). The analysis undertaken here, although using simple in vitro assays, would suggest that these differences are not due to the precise amino acids inserted, but more likely to the disruption of the zinc finger structure itself. Amongst all the proteins tested the –KTS isoform has unique properties, which even insertion of a single alanine residue was sufficient to abrogate. This suggests that generation of a protein with specifically –KTS properties makes a significant contribution to wild-type WT1 function and it will be interesting to examine the consequences of loss of exclusively –KTS isoforms in vivo.
The observations that regions other than the fingers are required for binding to both U2AF65 and SF1 (11,12), and yet at the same time binding is influenced so dramatically by KTS status, strongly suggest that the conformation of the entire molecule may be affected by the KTS insertion and it will be interesting in future studies to examine the tertiary structure of WT1 in more detail. It was of particular interest to find, through use of the KAA and KDD mutants, that any potential changes in phosphorylation state at the KTS motif would be unlikely to affect the properties of WT1 assayed here. However, the assays undertaken were very simple and it is possible that in vivo the precise residues, and any potential changes in phosphorylation state, are more important. The observation that altering KTS to KPS, KAS or KSS in the genomic context did not appear to affect the splicing ratio, perhaps suggests that the specific residue at this position was selected because of the amino acid it helps encode. Clearly in vivo genetic studies are required to dissect the precise role of the KTS residues in more detail.
In addition to selection of a particular amino acid it also seems likely that there were evolutionary constraints leading to selection for the ability to produce the two isoforms in a defined ratio. For example, changing A to G at a position that would be silent in the context of the protein severely disrupts the splicing ratio. A very similar observation was recently reported where silent changes at wobble positions effectively abolished an exonic splicing enhancer (21). These results clearly imply that there is co-evolution of nucleotide and amino acid sequence and together these optimize gene function. The mutations (FS, Silent and KTG) that change the splicing at the junction to produce exclusively + or –KTS-containing mRNAs may prove useful in trying to dissect the function of the individual isoforms in vivo. Additionally, the question is raised as to whether some genitourinary disorders in man reflect WT1 mutations such as KTG, generating solely +KTS mRNAs: the reciprocal of Frasier syndrome. This work also highlights the dramatic effect intronic mutations can have and it is important to screen for these in patients.
It is clear that not only is the precise sequence of the splice junctions important but the precise separation between the junctions also contributes to gene function. Increasing the separation between the junctions reduced the ability to splice from the +KTS site despite preserving the precise sequences at the junctions themselves. This suggests that the proximity of the two splice sites helps to recruit the splicing machinery. Interestingly, the use of the +KTS site was not decreased proportionally to increased distance, remaining at ~33% whether spaced an additional three or six residues away from the –KTS site. Although more sophisticated analysis would need to be done to establish whether in these circumstances there was an absolute increase in the use of the –KTS site it does at least suggest that the +KTS site has an intrinsic ability to be recognized by the splicing machinery, and that use of this site is enhanced by proximity to the –KTS site, but only across a limited distance.
Decreasing the separation between the splice sites also appeared to deregulate splicing. Reducing the splice site such that only a single amino acid would be inserted effectively destroyed the +KTS consensus, leading to only –KTS mRNA. Introducing overlapping splice donor sites, in the cases of KS and TS, appeared to activate a cryptic splice site. Although attempts to clone and sequence this product failed, the size and proximity to a cryptic product coming from the wild-type reporter strongly suggests that it is a product of an activated cryptic 3' site. It is interesting to note that according to the ‘exon definition’ model (22), recognition of a 3' splice site is aided by a downstream 5' splice site, or in the case of a terminal exon the poly(A) tract. As the ±KTS splice junction is normally the final intron in the WT1 pre-mRNA it seems likely that sequences at the poly(A) tract may influence splicing at this site. In the mini-gene, the WT1 poly(A) sequences have been replaced by those of SV40 present in the vector. Although activation of the cryptic splice site may be an artefact of the mini-gene reporter, the fact that this only occurred when specific changes were made to the reporter might suggest that there were difficulties defining the specific ±KTS splice sites when they were too close together.
Taken together, these data suggest that the generation of the two WT1 isoforms in a defined ratio is controlled by the nucleotides themselves. The effects of altering the spacing between the splice junction clearly suggest that the optimal number of amino acids to insert that would maintain the defined ratio is three. Given these constraints, there was presumably little opportunity during evolution in which to superimpose selection for precise amino acids. Therefore, it would seem likely that the amino acid motif KTS largely became conserved as a by-product of the function of its coding nucleotides. The fundamental importance of the nucleotides in controlling the alternative splicing is further supported by the findings that + and –KTS mRNA could be generated in the same ratio from the mini-gene in cells other than WT1 expressing cells and is thus unlikely to use cell-type-specific factors (data not shown). It was also interesting to observe no apparent change in the relative production of the two messages when the ratio between the WT1 isoforms was artificially disrupted following introduction of a cDNA construct expressing a single isoform at the same time as the reporter (data not shown). Thus, it would appear that cells have no feedback loop allowing them to detect and control the relative levels of the transcripts synthesized. This is perhaps surprising given the severity of the Frasier syndrome phenotype when the ratio is disrupted (16–18). Instead it would appear that this crucial aspect of WT1 function is maintained precisely by its genomic structure, and ultimately by the nucleotides that underpin it. This study therefore helps underline the importance of retaining wild-type sequences across this junction for correct WT1 function.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Plasmids
For yeast two-hybrid analysis WT1 was cloned into pACT2 and U2AF65 into pAS2 (23). The endogenous NcoI site of WT1 was used to generate constructs lacking the first 180 amino acids. The SF1 cDNA, kindly provided by Holly Ingraham, was subcloned into pBTM116 (24) to make a LexA DNA binding domain fusion. For expression in eukaryotic cells the WT1 cDNAs were maintained in Rc/CMV (Invitrogen, San Diego, CA). To construct the splicing mini-gene reporter a two-step cloning procedure was adopted. A 2.3 kb RsrII–PvuII fragment of mouse genomic WT1, encompassing intron 9, was ligated via a PstI linker into a Bluescript plasmid (Stratagene, La Jolla, CA) with a myc tag. This unit was then cloned into pCI-neo (Promega Corp., Madison, WI) carrying three N-terminal HA tags as a Klenow-treated RsrII–SalI fragment. Site directed mutagenesis was performed with either the altered sites (Promega) or Quik-change (Stratagene) kits and verified by sequencing.
Yeast strains
Y190 (MATa gal4 gal80 his3 trp1-901 ade2-101 ura3-52 leu2-3,-112 + URA3::GAL-lacZ, LYS2::GAL(UAS)-HIS3 cyhr) (19) or L40 (MATa ade2 trp1-901 leu2-3,-112 his3200 lys2-80lam, URA3::{lexAop}3-lacZ, LYS2::{lexAop}4-HIS3) (20).
Cell lines
M15 (10) and cos7 (ECACC) cells were maintained at 37°C in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal calf serum (FCS) in a humidified 5% CO2 atmosphere.
Antibodies
For immunohistochemistry, splicing proteins were detected with 3C5 (25) followed by fluorescein isothiocyanate (FITC) anti-mouse IgM, whereas C19 (Santa Cruz) followed by rhodamine anti-rabbit was used to detect WT1.
Yeast two-hybrid analysis
To test WT1–U2AF65 interactions the appropriate pAS and pACT plasmids were introduced into the Y190 strain by lithium acetate transformation. pAS SNF1 and pACT SNF4 were used in appropriate combinations to provide internal controls. Transformed colonies were selected on leu–trp– media (23). For ß-galactosidase quantitation at least three colonies from each of three independent transformations were grown in liquid culture and assayed as previously described (26). Activity was calculated according to the formula 1000 x A420/(time x volume x protein concentration). To test SF1–WT1 interactions the appropriate pBTM and pACT plasmids were introduced into the L40 strain by lithium acetate transformation (24). pBTM SNF1 and pACT mts4 were used as controls. Transformed colonies were selected in leu–trp– media, and synthesis of histidine examined by growth on leu–trp–his– media containing 5, 10, 25 or 50 mM 3-amino-triazole (AT). For the spot assays individual colonies were grown in liquid culture (leu–trp– media), and spotted at 5-fold dilutions from ~50 000 cells on to selective media containing His or 10 mM AT, before being allowed to grow at 30°C for several days.
Immunofluorescence
Cos7 cells were electroporated with the appropriate construct and the distribution of WT1 was compared with that of splicing factors by staining with the antibody 3C5 as previously described (11). At least 30 cells were scored from each of two transfections.
Analysis of splicing
Lipofectamine (20 µg) (Gibco BRL, Gaithersburg, MD) was used to transfect ~15 x 105 M15 cells with 1.5 µg of DNA in a 60 mm dish. Cells were re-fed 12 h after the start of the transfection. RNA was harvested 12 h later using the total RNA extraction kit (Promega) and DNase treated for 30 min at 37°C. After phenol–chloroform extraction and precipitation 1 µl of RNA (out of 50) was used with the Access RT–PCR kit (Promega) to amplify the appropriate message. For the endogenous WT1 the primer pair CCACACCAGGACTCATACAG/TGCATGTTGTGATGGCGGAC was used to produce products of either 103 bp for –KTS or 112 bp for +KTS messages. For the mini-gene reporter, TACGCTTCTAGGTCCGACCATCTG/CTCCAATTCCTGCAGCCTGAAGGG was used to yield a –KTS product of 80 bp, and +KTS 89 bp. Samples were removed after the number of cycles indicated, run on 6% acrylamide/TBE gels and silver stained. Quantitation was performed by scanning the gels and analysis with Labworks software. The RNA from at least three transfections for each construct was analysed.
|
ACKNOWLEDGEMENTS |
|---|
We thank Veronica van Heyningen and Isabel Hanson for helpful discussions. We are grateful to Holly Ingraham, Jean Beggs, Andreas Schedl, Brian Turner, Caroline Wilkinson and Matteo Ruggio for the gift of reagents.
|
FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +44 131 332 2471; Fax: +44 131 343 2620; Email: Nick.Hastie@hgu.mrc.ac.uk
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Kent, J., Coriat, A.-M., Sharpe, P.T., Hastie, N.D. and van Heyningen, V. (1995) The evolution of WT1 sequence and expression pattern in the vertebrates. Oncogene, 11, 1781–1792.[Web of Science][Medline]
2 Miles, C., Elgar, G., Coles, A., Kleinjan, D.-J., van Heyningen, V. and Hastie, N.D. (1998) Complete sequencing of the Fugu WAGR region from WT1 to PAX6: dramatic compaction and conservation of synteny with human chromosome 11p13. Proc. Natl Acad. Sci. USA, 95, 13068–13072.
3 Pritchard-Jones, K., Fleming, S., Davidson, D., Bickmore, W., Porteous, D., Gosden, C., Bard, J., Buckler, A., Pelletier, J., Housman, D. et al. (1990) The candidate Wilms’ tumour gene is involved in genitourinary development. Nature, 346, 194–197.[Medline]
4 Pelletier, J., Bruening, W., Kashtan, C.E., Mauer, S.M., Manivel, J.C., Striegel, J.E., Houghton, D.C., Junien, C., Habib, R., Fouser, L. et al. (1991) Germline mutations in the Wilms’ tumour suppressor gene are associated with abnormal urogenital development in Denys–Drash syndrome. Cell, 67, 437–447.[Web of Science][Medline]
5 Kreidberg, J.A., Sariola, H., Loring, J.M., Maeda, M., Pelletier, J., Housman, D. and Jaenish, R. (1993) WT-1 is required for early kidney development. Cell, 74, 679–691.[Web of Science][Medline]
6 Breuning, W. and Pelletier, J. (1996) A non-AUG translational initiation event generates novel WT1 isoforms. J. Biol. Chem., 271, 8646–8654.
7 Sharma, P.M., Bowman, M., Madden, S.L., Rauscher, F.J. and Sukumar, S. (1994) RNA editing in the Wilms’ tumour susceptibility gene, WT1. Genes Dev., 8, 720–731.
8 Haber, D.A., Sohn, R.L., Buckler, A.J., Pelletier, J., Call, K.M. and Housman, D.E. (1991) Alternative splicing and genomic structure of the Wilms’ tumour gene WT1. Proc. Natl Acad. Sci. USA, 88, 9618–9622.
9 Bickmore, W.A., Oghene, K., Little, M.H., Seawright, A., van Heyningen, V. and Hastie, N.D. (1992) Modulation of DNA binding specificity by alternative splicing of the Wilms’ tumour wt1 transcript. Science, 257, 235–237.
10 Larsson, S., Charlieu, J.P., Miyagawa, K., Engelkamp, D., Rassoulzadegan, M., Ross, A., Cuzin, F., van Heyningen, V. and Hastie, N.D. (1995) Subnuclear localisation of WT1 in splicing or transcription factor domains is regulated by alternative splicing. Cell, 81, 391–401.[Web of Science][Medline]
11 Davies, R.C., Calvio, C., Bratt, E., Larsson, S.H., Lamond, A.I. and Hastie, N.D. (1998) WT1 interacts with the splicing factor U2AF65 in an isoform-dependent manner and can be incorporated into spliceosomes. Genes Dev., 12, 3217–3225.
12 Nachtigal, M.W., Hirokawa, Y., Enyeart-VanHouten, D.L., Flanagan, J.N., Hammer, G.D. and Ingraham, H.A. (1998) Wilms’ tumour and Dax-1 modulate the orphan nuclear receptor SF-1 in sex-specific gene expression. Cell, 93, 445–454.[Web of Science][Medline]
13 Menke, A.L., Riteco, N., van Ham, R.C.A., de Bruyne, C., Rauscher, F.J., van der Eb, A.J. and Jochemsen, A.G. (1996) Wilms’ Tumour 1 splice variants have opposite effects on the tumorigenicity of adenovirus-transformed baby-rat kidney cells. Oncogene, 12, 537–546.[Web of Science][Medline]
14 Menke, A.L., Shvarts, A., Riteco, N., van Ham, R.C.A., van der Eb, A.J. and Jochemsen, A.G. (1997) Wilms’ Tumour 1–KTS isoforms induce p53-independent apoptosis that can be partially rescued by expression of the epidermal growth factor receptor or the insulin receptor. Cancer Res., 57, 1353–1363.
15 Call, K.M., Glaser, T., Ito, C.Y., Buckler, A.J., Pelletier, J., Haber, D.A., Rose, E.A., Krai, A., Yeger, H., Lewis, W.H. et al. (1990) Isolation and characterisation of a zinc finger polypeptide at the human chromosome 11 Wilms’ tumour locus. Cell, 60, 509–520.[Web of Science][Medline]
16 Barbaux, S., Niaudet, P., Gubler, M.-C., Grünfield, J.-P., Jaubert, F., Kuttenn, F., Fékété, C.N., Souleyreau-Therville, N., Thibaud, E., Fellous, M. and McElreavey, K. (1997) Donor splice site mutations in WT1 are responsible for Frasier syndrome. Nature Genet., 17, 467–470.[Web of Science][Medline]
17 Klamt, B., Koziell, A., Poulat, F., Wieacker, P., Scambler, P., Berta, P. and Gessler, M. (1998) Frasier syndrome is caused by defective alternative splicing of WT1 leading to an altered ratio of WT1 +/–KTS splice forms. Hum. Mol. Genet., 7, 709–714.
18 Kikuchi, H., Takata, A., Akasaka, Y., Fukuzawa, R., Yoneyama, H., Kurosawa, Y., Honda, M., Kamiyama, Y. and Hata, J. (1998) Do intronic mutations affecting splicing of WT1 exon 9 cause Frasier syndrome? J. Med. Genet., 35, 45–48.
19 Estojak, J., Brent, R. and Golemis, E.A. (1995) Correlation of two-hybrid affinity data with in vitro measurements. Mol. Cell. Biol., 15, 5820–5829.[Abstract]
20 Padgett, R.A., Grabowski, P.J., Konarska, M.M., Seiler, S. and Sharp, P.A. (1986) Splicing of messenger RNA precursors. Annu. Rev. Biochem., 55, 1119–1150.[Web of Science][Medline]
21 Schaal, T.D. and Maniatis, T. (1999) Multiple distinct splicing enhancers in the protein-coding sequences of a constitutively spliced pre-mRNA. Mol. Cell. Biol., 19, 261–273.
22 Berget, S.M. (1995) Exon recognition in vertebrate splicing. J. Biol. Chem., 270, 2411–2414.
23 Harper, J.W., Adami, G.R., Wei, N., Keyomarsi, K. and Elledge, S.J. (1993) The p21 cdk-interacting protein is a potent inhibitor of G1 cyclin-dependent kinases. Cell, 75, 805–816.[Web of Science][Medline]
24 Vojtek, A.B., Hollenberg, S.M. and Cooper, J.A. (1993) Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell, 74, 205–214.[Web of Science][Medline]
25 Turner, B.M. and Franchi, L. (1987) Identification of protein antigens associated with the nuclear matrix and clusters of interchromatin granules in both interphase and mitotic cells. J. Cell Sci., 87, 269–282.
26 Harshman, K.D., Moye-Rowley, W.S. and Parker, C.S. (1988) Transcriptional activation by the SV40 AP-1 recognition element in yeast is mediated by a factor similar to AP-1 that is distinct from GCN4. Cell, 53, 321–330.[Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Hiller, K. Szafranski, R. Sinha, K. Huse, S. Nikolajewa, P. Rosenstiel, S. Schreiber, R. Backofen, and M. Platzer Assessing the fraction of short-distance tandem splice sites under purifying selection RNA, April 1, 2008; 14(4): 616 - 629. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Bor, J. Swartz, A. Morrison, D. Rekosh, M. Ladomery, and M.-L. Hammarskjold The Wilms' tumor 1 (WT1) gene (+KTS isoform) functions with a CTE to enhance translation from an unspliced RNA with a retained intron Genes & Dev., June 15, 2006; 20(12): 1597 - 1608. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. G. Miles, L. Rankin, S. I. Smith, M. Niksic, G. Elgar, and N. D. Hastie Faithful expression of a tagged Fugu WT1 protein from a genomic transgene in zebrafish: efficient splicing of pufferfish genes in zebrafish but not mice Nucleic Acids Res., June 1, 2003; 31(11): 2795 - 2802. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||