Human Molecular Genetics, 2000, Vol. 9, No. 8 1245-1249
© 2000 Oxford University Press
A mutation in the human heme A:farnesyltransferase gene (COX10 ) causes cytochrome c oxidase deficiency
INSERM U393, Hôpital Necker-Enfants Malades, 149 rue de Sèvres, 75015 Paris, France, 1Department of Biological Sciences, Columbia University, New York, NY 10027, USA and 2Royal Free and University College Medical School, Department of Clinical Neurosciences, Rowland Hill Street, London NW3 2PF, UK
Received 10 February 2000; Revised and Accepted 10 March 2000.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Cytochrome c oxidase (COX) defects are found in a clinically and genetically heterogeneous group of mitochondrial disorders. To date, mutations in only two nuclear genes causing COX deficiency have been described. We report here a genetic linkage study of a consanguineous family with an isolated COX defect and subsequent identification of a mutation in a third nuclear gene causing a deficiency of the enzyme. A genome-wide search for homozygosity allowed us to map the disease gene to chromosome 17p13.1–q11.1 (Zmax = 2.46;
= 0.00 at the locus D17S799). This region encompasses two genes, SCO1 and COX10, encoding proteins involved in COX assembly. Mutation analysis followed by a complementation study in yeast permitted us to ascribe the COX deficiency to a homozygous missense mutation in the COX10 gene. This gene encodes heme A:farnesyltransferase, which catalyzes the first step in the conversion of protoheme to the heme A prosthetic groups of the enzyme. All three nuclear genes now linked to isolated COX deficiency are involved in the maturation and assembly of COX, emphasizing the major role of such genes in COX pathology. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Cytochrome c oxidase (COX), the terminal complex of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. Isolated COX deficiency is the most frequent cause of respiratory chain defects in humans and results in a variety of clinical manifestations including Leigh syndrome (1), hepatic failure (2) and encephalomyopathy (3). This clinical heterogeneity presumably stems from the large number of nuclear genes involved in the expression of the 13 COX subunit polypeptides and their subsequent maturation and assembly into the functional complex.
Mutations in the three mitochondrial genes encoding COX subunits, COXI, COXII and COXIII, have been reported in only a few patients (4–9). No mutations have been described in the nuclear genes encoding COX subunits. This suggests that the prevalent non-maternally transmitted mutations causing COX deficiency are present in genes involved in COX assembly, as recently reported for the SURF1 and SCO2 genes (1,10,11). The high rate of recurrence risk and parental consanguinity in COX deficient families of Northern and Western African ancestry is highly suggestive of an autosomal recessive genotype (12). Therefore, in order to identify additional nuclear genes responsible for COX deficiency, we performed homozygosity mapping in a large African consanguineous family with COX deficiency. Here we report on the mapping of a new locus for isolated COX deficiency to chromosome 17p13.1–q11.1, which shows an autosomal recessive mode of inheritance. Further genetic examination allowed us to ascribe the disease to a homozygous missense mutation in the COX10 gene.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Patients
A boy born to first cousin parents after a term pregnancy and normal delivery had an unremarkable development until the age of 18 months. He had an older sister who died at 5 years of age of a mitochondrial encephalopathy ascribed to cytochrome c oxidase deficiency (13). At 18 months, he had ataxia, and his neurological condition gradually worsened over the next 6 months. At 2 years of age, he presented with poor eye contact, severe muscle weakness, hypotonia, ataxia, ptosis, pyramidal syndrome and status epilepticus. Heart ultrasound was normal. Blood and CSF lactate were elevated (3.8 and 3.1 mmol/l, respectively), and GC/MS detected urinary lactate and Krebs’ cycle intermediates. Increased urinary amino acids were suggestive of a proximal tubulopathy. He presented with isolated COX deficiency in muscle, lymphocytes and fibroblast cultures (13). He died at 2 years of age. His younger sister had progressive neurological deterioration with similar biochemical anomalies at the age of 2 years and died at 3 years of age (14). Neither of the patients presented large mitochondrial DNA (mtDNA) deletions or the MERRF, MELAS or NARP mtDNA mutations. Sequencing of the COXI, COXII and COXIII mitochondrial genes as well as the surrounding tRNA genes failed to reveal mutations (15).
Genetic linkage
A genome-wide search for homozygosity was undertaken using a total of 382 polymorphic markers. We obtained evidence for homozygosity in all affected individuals at loci D17S1852, D17S799 and D17S921. The shortest area of homozygosity in affected individuals was defined by the D17S1858–D17S1873 interval, but a recombination event in a healthy sib reduced the critical region to the 27.4 cM interval defined by loci D17S954 and D17S1873 on chromosome 17p13.1–q11.1 (Fig. 1). The maximum pair-wise LOD score was obtained at D17S799 (Zmax = 2.46; = 0.00). The lack of informativity accounts for the relatively low LOD score in this consanguineous family. No other homozygous region was found with other markers.
|
Candidate gene analysis
Based on homologies to COX-related genes in yeast, the 17p13–q11 region encompasses two candidate genes, SCO1 and COX10. SCO1 encodes a protein involved in mitochondrial copper transport and/or insertion in COX (16,17). COX10 codes for the heme A:farnesyltransferase, which converts protoheme to heme O (18,19). The latter serves as the immediate precursor of heme A, the heme prosthetic group of the COXI subunit. Mutations in either of these two genes in yeast result in the absence of functional heme in the complex. A low temperature difference spectrum of the
region of cytochromes revealed the absence of aa3 heme in fibroblast cultures of the patient (Fig. 2), consistent with an abnormal function of either COX10 or SCO1.
|
A search for mutations in the COX10 gene was therefore undertaken in the family by direct sequencing of the seven exons of COX10. A homozygous C
A transversion was found in exon 4, corresponding to nucleotide 612 of the cDNA (Fig. 3a). This transversion results in the change of an uncharged asparagine into a basic lysine residue (N204K) at a conserved position in the protein (Fig. 3c). Both parents were heterozygous for the 612 CA transversion and unaffected children were either heterozygous or homozygous for the wild-type allele. The base change caused an abnormal SSCP migration pattern that segregated with the disease in the entire pedigree and was absent from 100 controls of the same ethnic origin (Fig. 3b).
|
Western blot analysis revealed a mild reduction of COX subunit steady-state levels (Fig. 4) with more marked reduction of subunits III and VIc (~50% of normal levels) and barely detectable levels of subunit II (<3%). We subsequently screened the COX10 gene in seven additional patients with isolated COX deficiency and roughly similar COX subunit profile. No mutations could be identified in any of these patients (data not shown). In an additional screening of four unrelated patients with similar clinical presentations we also failed to find any mutations in the COX10 gene.
|
Functional complementation
To confirm the deleterious nature of the N204K COX10 genotype, the human wild-type and mutant genes were tested for their ability to complement the respiratory defect of a yeast cox10 null mutant. Indeed, due to the high residual activity present in the fibroblast of the patient, transfection of these cells may result in not absolutely clear-cut results. The mutation was introduced into a wild-type COX10 cDNA clone by PCR. The wild-type and mutant COX10 genes were cloned into three types of plasmid: (i) a high-copy plasmid containing the yeast 2µ origin of replication; (ii) a low-copy CEN plasmid; and (iii) an integrative plasmid linearized at LEU2 to direct integration in the homologous locus in chromosomal DNA (20). The six different plasmids were used to transform a yeast cox10 null strain previously shown to be readily complemented by the wild-type human gene (21). Growth of the mutant on glycerol-rich medium was restored by the wild-type but not the N204K gene when present in low copy (Fig. 5). Similar results were obtained when the two genes were integrated at the leu2 locus of the host (not shown). However, a small percentage (5–10%) of cells carrying the integrated mutant gene showed some growth on the non-fermentable carbon source. This is probably due to multiple integrations of the gene (20). Both the wild-type and the mutant N204K genes complemented the COX10 deficient strain when introduced on the high copy plasmid (Fig. 5), indicating retention of some residual function by the mutant protein. In keeping with this, it is worth remembering that a residual COX activity was retained in the patient’s lymphocytes (patient: 47 nmol/min/mg protein; normal range: 72–203, n = 85). The inability of the mutant gene to complement the yeast cox10 null strain, when expressed in low copy strongly supports the view that COX deficiency is a consequence of the N204K COX10 mutation in our patients.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
We report a third nuclear gene responsible for complex IV deficiency, COX10. This gene has been identified by a combination of conventional linkage analysis in a large consanguineous family of African ancestry and a candidate gene screening. This allowed us to find a homozygous substitution in the COX10 gene resulting in an asparagine to lysine substitution (N204K) at a conserved position in the protein. The inability of the mutant gene to complement the yeast cox10 null strain, when expressed in low copy, confirms that this substitution is the disease-causing mutation.
The COX10 gene encodes a heme A:farnesyltransferase. The gene was originally isolated in yeast and shown to be required for the biogenesis of functional cytochrome c oxidase in yeast (22). The human cDNA has been isolated by functional complementation of a yeast cox10 mutant. It encodes a protein predicted to contain seven to nine transmembrane domains localized in the mitochondrial inner membrane (21). The protein structure is conserved from Escherichia coli to human, with the amino acid sequence of transmembrane segments II to V being highly conserved. A study of E.coli mutants has shown that the II/III loop, which is on the mitochondrial matrix side of the enzyme in eukaryotes, is essential for catalytic function (19). This loop contains a highly conserved motif involved in the transfer of a farnesyl moiety to the pyrrol ring A of ferrous protoheme IX. This farnesyl chain of the heme would then be used as a lipophilic anchor holding the heme at the proper position within the oxidase complex (19). The substitution of a lysine for an asparagine (N204K), identified in our patients, is in the second transmembrane segment of the heme A:farnesyltransferase at the II/III loop junction. A substitution in this region is likely to elicit a conformational change in the loop with adverse effects on heme A synthesis.
Isolated COX deficiency is a frequent cause of respiratory chain dysfunction. Sequencing of the mitochondrial genes that encode the three catalytic core subunits has allowed the identification of mutations in the COXI, COXII and COXIII genes, in a limited number of patients (4–9). In addition to the COX10 mutation reported in this study, mutations in two other nuclear genes involved in COX assembly have been described but no mutations have been reported in any of the structural nuclear genes coding for COX subunits. Functional complementation studies, using microcell-mediated chromosome transfer have led to the discovery of mutations in the SURF1 gene as a frequent cause of a COX defect in patients with Leigh’s syndrome (1,10). Systematic sequencing of candidate genes led to the identification of mutations in the SCO2 gene underlying COX deficiency in fatal infantile cardioencephalomyopathy (11). We used homozygosity mapping to identify a disease-causing mutation in the COX10 gene. The yeast homologues of these three genes are involved in COX assembly (16,18,23). Yeast strains with mutations in the SURF1 homologue display inadequate electron transfer between COX and other components of respiratory chain (23). The SCO2 gene product plays a role in the transport of the copper to COX (16), whereas COX10 gene codes for heme A:farnesyltransferase which functions in the maturation of the heme A prosthetic group of COX (18).
Patients with mutations in any one of these three genes present with a severe and isolated COX deficiency associated with an abnormal expression pattern of COX subunits; however, the COX subunit anomalies resulting from SURF1, SCO2 and COX10 mutations differ noticeably. Western blot analysis has indicated that in SURF1 patients, COX subunit levels are very much reduced with the exception of subunits Va and Vb (24). Immunohistochemistry revealed severe reductions of subunits I and II in SCO2 patients, while subunits IV and Va levels are less affected (11). We show here on Western blots that a mutation in the COX10 gene has a major effect on the level of subunit II. The steady-state levels of other subunits, including subunit I, are relatively normal. This is remarkable because subunit I in the COX10 patients can not be associated with heme aa3 prosthetic groups. This suggests that the heme groups are not necessary to stabilize subunit I and subassemblies of the enzyme complex may be present which protect the subunits from proteolytic degradation by mitochondrial proteases (25). The clinical phenotypes caused by mutations in these three genes differ as well. SURF1 mutations are associated with subacute necrotizing encephalomyopathy, also known as ‘Leigh disease’. Patients with SCO2 mutations presented with encephalocardiomyopathy, while patients with the COX10 mutation reported here, presented with tubulopathy and leukodystrophy.
At present, only a limited number of genes involved in the biogenesis of COX are known. However, this is likely to change as the search for the molecular bases of human mitochondrial diseases takes advantage of the ever increasing functional data available for yeast. At least a dozen nuclear yeast gene products have been described as acting in the late stages of the COX assembly pathway (26). Even though the functions of many of these mitochondrial proteins still need to be clarified, they are good candidates for future studies in human COX deficiencies.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
DNA analyses
DNA was extracted from peripheral blood. A genome-wide search for homozygosity was undertaken with 382 pairs of fluorescent oligonucleotides from the Genescan Linkage Mapping Set, version II (Perkin-Elmer Applied Biosystems, Foster City, CA) under conditions recommended by the manufacturer. Amplified fragments were electrophoresed and analyzed with an automatic sequencer (ABI 377). The polymorphic markers have an average spacing of 10 cM throughout the genome. Linkage analysis was performed using M-LINK and LINKMAP, version 5.1.
Mutation screening
The seven exons of the COX10 gene were amplified by PCR using the following COX10-specific intronic primers (forward/reverse, 5'–3'):
exon 1: TTCGGAGCCCGCCCGCCGGAAGT, CGGCCTCGCAC- GTGGTAATA,
exon 2: TAGTCATCATTTGATAAGAAG, ACTTTAATTAAATAGGAATTTCTG,
exon 3: GTTGCTAAATAACCATTTGAGAG, CACTAAAGATAGAGTTTCAAATAAG,
exon 4: TGGCCTTTACAGTTGGGACTCCT, AGCCATCTAGGA- AAAAGTGACAA,
exon 5: TCGAAATTAAAATGAAGTTTA, TAGTGGGAAATGA- TTCAGATGAACAAG,
exon 6: GATTTTAGGTAGTGTGATTGA, AGGAAATGCCTCC- TTGACCGAGTGT,
exon 7 (1): ATTCTTTGGAAATCTCTGGTGATGAC, TCCAGAA- TTACCACAACATGCTCG,
exon 7 (2): TTCTTCTGCAGCCTGTGGGA, CTTTGAGGGACCTGAGCTCA,
exon 7 (3): TTTTGGTTCCATCCTTACCAC, TATTTGGTAACC- GAGACCACA,
exon 7 (4): TTAGCCTCCACATGTGCAATG, ACTCCTGTTCTTGTATACCATT.
Amplification products were electrophoresed through a 2% low melting point agarose gel, purified and directly sequenced using the PRISMTM Ready Reaction Sequencing Kit (Perkin-Elmer) on an automatic sequencer (Applied Biosystems). SSCP analysis was performed using the GeneGel Excel 12.5/24 Kit from Amersham Pharmacia Biotech (Buckinghamshire, UK).
Complementation of a yeast cox10 null mutant
The N204K mutation was introduced into the wild-type human cDNA sequence by amplification of the 114 nucleotide region spanning the NheI and StuI sites with primers 5'-GGCGAGGCCTTGCATCCTGTGCTGCCAA(A)TCCATCAATCAG (the CA mutation is indicated in parentheses) and 5'-GGACACAGCTAGCAATGG. The PCR-generated fragment with the mutation was digested with NheI and StuI and substituted for the native fragment in pG19/HST5, a plasmid identical to pG19/HST2 (21) except that the 1.5 kb HindIII–EcoRI fragment containing human COX10 is in the 2µ plasmid Yep351 (27). The resultant plasmid (pG19/HST6) was confirmed by sequencing to have only the CA transversion in the NheI–StuI region. Both wild-type and mutant genes were transferred to the integrative plasmid YEp351 (27) yielding pG19/HST7 (wild-type) and pG19/HST8 (mutant). These plasmids were linearized at the ClaI site of LEU2. The two alleles were also cloned in the CEN plasmid pRS316 (28); these plasmids were designated as pG19/HST9 (wild-type) and pG19/HST10 (mutant). All six constructs were used to transform the haploid strain of Saccharomyces cerevisiae aW303
COX10 bearing the cox10 null allele (22).
Immunoblot analysis
Western blot analysis was performed as described (24). Quantification of COX subunit was performed using Sigma Gel software.
Low temperature difference spectra
Low temperature difference spectra performed at liquid nitrogen temperature (–196°C) were recorded in 80 µl cells with a computerized UV-3000 Shimazu spectrophotometer. Baseline (oxidized minus oxidized) was subtracted from difference spectra (reduced minus oxidized). Quantitative measurements of cytochromes were performed according to Chance (29). The study was carried out in 300 mM mannitol, 10 mM KH2PO4 pH 7.2, 10 mM KCl, 5 mM MgCl2 and 1 g/l of bovine serum albumin (30).
|
ACKNOWLEDGEMENTS |
|---|
This research was supported in part by research grant NIH GM50187 (to A.T.) and by the Association Française contre les Myopathies. J.-C.v.K.-R. is recipient of a grant from the INSERM and J.-W.T. is a recipient of a grant from the Wellcome Trust.
|
FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +33 1 47 38 15 84; Fax: +33 1 47 34 85 14; Email: roetig@necker.fr
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Zhu, Z., Yao, J., Johns, T., Fu, K., De Bie, I., Macmillan, C., Cuthbert, A.P., Newbold, R.F., Wang, J., Chevrette, M. et al. (1998) SURF1, encoding a factor involved in the biogenesis of cytochrome c oxidase, is mutated in Leigh syndrome. Nature Genet., 20, 337–343.[Web of Science][Medline]
2 Cormier, V., Rustin, P., Bonnefont, J.P., Rambaud, C., Vassault, A., Rabier, D., Parvy, P., Couderc, S., Parrot-Roulaud, F., Carre, M. et al. (1991) Hepatic failure in disorders of oxidative phosphorylation with neonatal onset. J. Pediatr., 119, 951–954.[Web of Science][Medline]
3 DiMauro, S., Lombes, A., Nakase, H., Mita, S., Fabrizi, G.M., Tritschler, H.J., Bonilla, E., Miranda, A.F., DeVivo, D.C., Schon, E.A. (1990) Cytochrome c oxidase deficiency. Pediatr. Res., 28, 536–541.[Web of Science][Medline]
4 Keightley, J.A., Hoffbuhr, K.C., Burton, M.D., Salas, V.M., Johnston, W.S., Penn, A.M., Buist, N.R. and Kennaway, N.G. (1996) A microdeletion in cytochrome c oxidase (COX) subunit III associated with COX deficiency and recurrent myoglobinuria. Nature Genet., 12, 410–416.[Web of Science][Medline]
5 Comi, G.P., Bordoni, A., Salani, S., Franceschina, L., Sciacco, M., Prelle, A., Fortunato, F., Zeviani, M., Napoli, L., Bresolin, N. et al. (1998) Cytochrome c oxidase subunit I microdeletion in a patient with motor neuron disease. Ann. Neurol., 43, 110–116.[Web of Science][Medline]
6 Hanna, M.G., Nelson, I.P., Rahman, S., Lane, R.J., Land, J., Heales, S., Cooper, M.J., Schapira, A.H., Morgan-Hughes, J.A. and Wood, N.W. (1998) Cytochrome c oxidase deficiency associated with the first stop-codon point mutation in human mtDNA. Am. J. Hum. Genet., 63, 29–36.[Web of Science][Medline]
7 Bruno, C., Martinuzzi, A., Tang, Y., Andreu, A.L., Pallotti, F., Bonilla, E., Shanske, S., Fu, J., Sue, C.M., Angelini, C. et al. (1999) A stop-codon mutation in the human mtDNA cytochrome c oxidase I gene disrupts the functional structure of complex IV. Am. J. Hum. Genet., 65, 611–620.[Web of Science][Medline]
8 Clark, K.M., Taylor, R.W., Johnson, M.A., Chinnery, P.F., Chrzanowska-Lightowlers, Z.M., Andrews, R.M., Nelson, I.P., Wood, N.W., Lamont, P.J., Hanna, M.G. et al. (1999) An mtDNA mutation in the initiation codon of the cytochrome c oxidase subunit II gene results in lower levels of the protein and a mitochondrial encephalomyopathy. Am. J. Hum. Genet., 64, 1330–1339.[Web of Science][Medline]
9 Rahman, S., Taanman, J.W., Cooper, J.M., Nelson, I., Hargreaves, I., Meunier, B., Hanna, M.G., Garcia, J.J., Capaldi, R.A., Lake, B.D. et al. (1999) A missense mutation of cytochrome oxidase subunit II causes defective assembly and myopathy. Am. J. Hum. Genet., 65, 1030–1039.[Web of Science][Medline]
10 Tiranti, V., Hoertnagel, K., Carrozzo, R., Galimberti, C., Munaro, M., Granatiero, M., Zelante, L., Gasparini, P., Marzella, R., Rocchi, M. et al. (1998) Mutations of SURF-1 in Leigh disease associated with cytochrome c oxidase deficiency. Am. J. Hum. Genet., 63, 1609–1621.[Web of Science][Medline]
11 Papadopoulou, L.C., Sue, C.M., Davidson, M.M., Tanji, K., Nishino, I., Sadlock, J.E., Krishna, S., Walker, W., Selby, J., Glerum, D.M. et al. (1999) Fatal infantile cardioencephalomyopathy with COX deficiency and mutations in SCO2, a COX assembly gene. Nature Genet., 23, 333–337.[Web of Science][Medline]
12 von Kleist-Retzow, J.C., Cormier-Daire, V., de Lonlay, P., Parfait, B., Chretien, D., Rustin, P., Feingold, J., Rötig, A. and Munnich, A. (1998) A high rate (20–30%) of parental consanguinity in cytochrome-oxidase deficiency. Am. J. Hum. Genet., 63, 428–435.[Web of Science][Medline]
13 Ogier, H., Lombès, A., Scholte, H.R., Poll-The, B.T., Fardeau, M., Alcardi, J., Vignes, B., Niaudet, P. and Saudubray, J.M. (1988) de Toni-Fanconi-Debré syndrome with Leigh syndrome revealing severe muscle cytochrome c oxidase deficiency. J. Pediatr., 112, 734–739.[Web of Science][Medline]
14 de Lonlay-Debeney, P., von Kleist-Retzow, J.C., Hertz-Pannier, L., Peudenier, S., Cormier-Daire, V., Berquin, P., Chretien, D., Rötig, A., Saudubray, J.M., Baraton, J. et al. (2000) Cerebral white matter disease in children may be caused by mitochondrial respiratory chain deficiency. J. Pediatr., 136, 209–214.[Web of Science][Medline]
15 Parfait, B., Percheron, A., Chretien, D., Rustin, P., Munnich, A. and Rötig, A. (1997) No mitochondrial cytochrome oxidase (COX) gene mutations in 18 cases of COX deficiency. Hum. Genet., 101, 247–250.[Web of Science][Medline]
16 Glerum, D.M., Shtanko, A. and Tzagoloff, A. (1996) SCO1 and SCO2 act as high copy suppressors of a mitochondrial copper recruitment defect in Saccharomyces cerevisiae. J. Biol. Chem., 271, 20531–20535.
17 Rentzsch, A., Krummeck-Weiss, G., Hofer, A., Bartuschka, A., Ostermann, K. and Rodel, G. (1999) Mitochondrial copper metabolism in yeast: mutational analysis of Sco1p involved in the biogenesis of cytochrome c oxidase. Curr. Genet., 35, 103–108.[Web of Science][Medline]
18 Tzagoloff, A., Nobrega, M., Gorman, N. and Sinclair, P. (1993) On the functions of the yeast COX10 and COX11 gene products. Biochem. Mol. Biol. Intl., 31, 593–598.[Web of Science][Medline]
19 Mogi, T., Saiki, K. and Anraku, Y. (1994) Biosynthesis and functional role of haem O and haem A. Mol. Microbiol., 14, 391–398.[Web of Science][Medline]
20 Rothstein, R. (1991) Targeting, disruption, replacement and allele rescue: integrative DNA transformation in yeast. Methods Enzymol., 194, 281–301.[Web of Science][Medline]
21 Glerum, D.M. and Tzagoloff, A. (1994) Isolation of a human cDNA for heme A:farnesyltransferase by functional complementation of a yeast cox10 mutant. Proc. Natl Acad. Sci. USA, 91, 8452–8456.
22 Nobrega, M.P., Nobrega, F.G. and Tzagoloff, A. (1990) COX10 codes for a protein homologous to the ORF1 product of Paracoccus denitrificans and is required for the synthesis of yeast cytochrome oxidase. J. Biol. Chem., 265, 14220–14226.
23 Mashkevich, G., Repetto, B., Glerum, D.M. and Tzagoloff, A. (1997) SHY1, the yeast homolog of the mammalian SURF-1 gene, encode a mitochondrial protein required for respiration. J. Biol. Chem., 272, 14356–14364.
24 von Kleist-Retzow, J.C., Vial, E., Chantrel-Groussard, K., Rötig, A., Munnich, A., Rustin, P. and Taanman, J.W. (1999) Biochemical, genetic and immunoblot analyses of 17 patients with an isolated cytochrome c oxidase deficiency. Biochim. Biophys. Acta, 1455, 35–44.[Medline]
25 Rep, M. and Grivell, L.A. (1996) The role of the protein degradation in mitochondrial function. Curr. Genet., 30, 367–380.[Web of Science][Medline]
26 Tzagoloff, A. and Dieckmann, C.L. (1990) PET genes of Saccharomyces cerevisiae. Microbiol. Rev., 54, 211–225.
27 Hill, J.E., Myers, A.M., Koerner, T.J. and Tzagoloff, A. (1986) Yeast/E.coli shuttle vectors with multiple unique restriction sites. Yeast, 2, 163–167.[Web of Science][Medline]
28 Sikorski, R.S. and Hieter, P. (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics, 122, 19–27.
29 Chance, B. and Williams, G.R.J. (1955) Respiratory enzymes in oxidative phosphorylation. II. Difference spectra. Biol. Chem., 217, 395–407.
30 Bourgeron, T., Chretien, D., Rotig, A., Munnich, A. and Rustin, P. (1992) Isolation and characterization of mitochondria from human B lymphoblastoid cell lines. Biochem. Biophys. Res. Commun., 186, 16–23.[Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  E. Trevisson, A. Burlina, M. Doimo, V. Pertegato, A. Casarin, L. Cesaro, P. Navas, G. Basso, G. Sartori, and L. Salviati Functional Complementation in Yeast Allows Molecular Characterization of Missense Argininosuccinate Lyase Mutations J. Biol. Chem., October 16, 2009; 284(42): 28926 - 28934. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. C. Leary, F. Sasarman, T. Nishimura, and E. A. Shoubridge Human SCO2 is required for the synthesis of CO II and as a thiol-disulphide oxidoreductase for SCO1 Hum. Mol. Genet., June 15, 2009; 18(12): 2230 - 2240. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Wang, Y. Wang, and E. L. Hegg Regulation of the Heme A Biosynthetic Pathway: DIFFERENTIAL REGULATION OF HEME A SYNTHASE AND HEME O SYNTHASE IN SACCHAROMYCES CEREVISIAE J. Biol. Chem., January 9, 2009; 284(2): 839 - 847. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A.M. Hall, R.J. Unwin, M.G. Hanna, and M.R. Duchen Renal function and mitochondrial cytopathy (MC): more questions than answers? QJM, October 1, 2008; 101(10): 755 - 766. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Bastin, F. Aubey, A. Rotig, A. Munnich, and F. Djouadi Activation of Peroxisome Proliferator-Activated Receptor Pathway Stimulates the Mitochondrial Respiratory Chain and Can Correct Deficiencies in Patients' Cells Lacking Its Components J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1433 - 1441. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Diaz, H. Fukui, S. Garcia, and C. T. Moraes Cytochrome C oxidase is required for the assembly/stability of respiratory complex I in mouse fibroblasts. Mol. Cell. Biol., July 1, 2006; 26(13): 4872 - 4881. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Kaltimbacher, C. Bonnet, G. Lecoeuvre, V. Forster, J.-A. Sahel, and M. Corral-Debrinski mRNA localization to the mitochondrial surface allows the efficient translocation inside the organelle of a nuclear recoded ATP6 protein RNA, July 1, 2006; 12(7): 1408 - 1417. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Cobine, F. Pierrel, S. C. Leary, F. Sasarman, Y.-C. Horng, E. A. Shoubridge, and D. R. Winge The P174L Mutation in Human Sco1 Severely Compromises Cox17-dependent Metallation but Does Not Impair Copper Binding J. Biol. Chem., May 5, 2006; 281(18): 12270 - 12276. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Diaz, C. K. Thomas, S. Garcia, D. Hernandez, and C. T. Moraes Mice lacking COX10 in skeletal muscle recapitulate the phenotype of progressive mitochondrial myopathies associated with cytochrome c oxidase deficiency Hum. Mol. Genet., September 15, 2005; 14(18): 2737 - 2748. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. K.H. Tay, S. Sacconi, H. Ohran Akman, J. F. Morales, A. Morales, D. C. De Vivo, S. Shanske, E. Bonilla, and S. DiMauro Unusual Clinical Presentations in Four Cases of Leigh Disease, Cytochrome C Oxidase Deficiency, and SURF1 Gene Mutations J Child Neurol, August 1, 2005; 20(8): 670 - 674. [Abstract] [PDF]
|
|
|
|
 |
|
 S. K. H. Tay, C. Nesti, M. Mancuso, E. A. Schon, S. Shanske, E. Bonilla, M. M. Davidson, and S. DiMauro Studies of COX16, COX19, and PET191 in Human Cytochrome-c Oxidase Deficiency Arch Neurol, December 1, 2004; 61(12): 1935 - 1937. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zeviani and S. Di Donato Mitochondrial disorders Brain, October 1, 2004; 127(10): 2153 - 2172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Leary, B. A. Kaufman, G. Pellecchia, G.-H. Guercin, A. Mattman, M. Jaksch, and E. A. Shoubridge Human SCO1 and SCO2 have independent, cooperative functions in copper delivery to cytochrome c oxidase Hum. Mol. Genet., September 1, 2004; 13(17): 1839 - 1848. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C E Oquendo, H Antonicka, E A Shoubridge, W Reardon, and G K Brown Functional and genetic studies demonstrate that mutation in the COX15 gene can cause Leigh syndrome J. Med. Genet., July 1, 2004; 41(7): 540 - 544. [Full Text] [PDF]
|
|
|
|
|
|
S. K. H. Tay, S. Shanske, P. Kaplan, and S. DiMauro Association of Mutations in SCO2, a Cytochrome c Oxidase Assembly Gene, With Early Fetal Lethality Arch Neurol, June 1, 2004; 61(6): 950 - 952. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Williams, I. Valnot, P. Rustin, and J.-W. Taanman Cytochrome c Oxidase Subassemblies in Fibroblast Cultures from Patients Carrying Mutations in COX10, SCO1, or SURF1 J. Biol. Chem., February 27, 2004; 279(9): 7462 - 7469. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Rotig and A. Munnich Genetic Features of Mitochondrial Respiratory Chain Disorders J. Am. Soc. Nephrol., December 1, 2003; 14(12): 2995 - 3007. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Antonicka, S. C. Leary, G.-H. Guercin, J. N. Agar, R. Horvath, N. G. Kennaway, C. O. Harding, M. Jaksch, and E. A. Shoubridge Mutations in COX10 result in a defect in mitochondrial heme A biosynthesis and account for multiple, early-onset clinical phenotypes associated with isolated COX deficiency Hum. Mol. Genet., October 16, 2003; 12(20): 2693 - 2702. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Fosslien Mitochondrial Medicine - Cardiomyopathy Caused by Defective Oxidative Phosphorylation Ann. Clin. Lab. Sci., October 1, 2003; 33(4): 371 - 395. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. G. Carlson, A. Barrientos, A. Tzagoloff, and D. M. Glerum COX16 Encodes a Novel Protein Required for the Assembly of Cytochrome Oxidase in Saccharomyces cerevisiae J. Biol. Chem., January 31, 2003; 278(6): 3770 - 3775. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. de Lonlay, C. Mugnier, D. Sanlaville, K. Chantrel-Groussard, P. Benit, S. Lebon, D. Chretien, N. Kadhom, S. Saker, G. Gyapay, et al. Cell complementation using Genebridge 4 human:rodent hybrids for physical mapping of novel mitochondrial respiratory chain deficiency genes Hum. Mol. Genet., December 15, 2002; 11(26): 3273 - 3281. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Salviati, S. Sacconi, M. M. Rasalan, D. F. Kronn, A. Braun, P. Canoll, M. Davidson, S. Shanske, E. Bonilla, A. P. Hays, et al. Cytochrome c Oxidase Deficiency Due to a Novel SCO2 Mutation Mimics Werdnig-Hoffmann Disease Arch Neurol, May 1, 2002; 59(5): 862 - 865. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Leary, B. C. Hill, C. N. Lyons, C. G. Carlson, D. Michaud, C. S. Kraft, K. Ko, D. M. Glerum, and C. D. Moyes Chronic Treatment with Azide in Situ Leads to an Irreversible Loss of Cytochrome c Oxidase Activity via Holoenzyme Dissociation J. Biol. Chem., March 22, 2002; 277(13): 11321 - 11328. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A H V Schapira The "new" mitochondrial disorders J. Neurol. Neurosurg. Psychiatry, February 1, 2002; 72(2): 144 - 149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D'Aurelio, F. Pallotti, A. Barrientos, C. D. Gajewski, J. Q. Kwong, C. Bruno, M. F. Beal, and G. Manfredi In Vivo Regulation of Oxidative Phosphorylation in Cells Harboring a Stop-codon Mutation in Mitochondrial DNA-encoded Cytochrome c Oxidase Subunit I J. Biol. Chem., December 7, 2001; 276(50): 46925 - 46932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Jaksch, C. Paret, R. Stucka, N. Horn, J. Muller-Hocker, R. Horvath, N. Trepesch, G. Stecker, P. Freisinger, C. Thirion, et al. Cytochrome c oxidase deficiency due to mutations in SCO2, encoding a mitochondrial copper-binding protein, is rescued by copper in human myoblasts Hum. Mol. Genet., December 1, 2001; 10(26): 3025 - 3035. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jaksch, R. Horvath, N. Horn, D. P. Auer, C. Macmillan, J. Peters, K.-D. Gerbitz, I. Kraegeloh-Mann, A. Muntau, V. Karcagi, et al. Homozygosity (E140K) in SCO2 causes delayed infantile onset of cardiomyopathy and neuropathy Neurology, October 23, 2001; 57(8): 1440 - 1446. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Shoubridge Nuclear genetic defects of oxidative phosphorylation Hum. Mol. Genet., October 1, 2001; 10(20): 2277 - 2284. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Jaksch, S. Kleinle, C. Scharfe, T. Klopstock, D. Pongratz, J. Muller-Hocker, K.-D Gerbitz, S. Liechti-Gallati, H. Lochmuller, and R. Horvath Frequency of mitochondrial transfer RNA mutations and deletions in 225 patients presenting with respiratory chain deficiencies J. Med. Genet., October 1, 2001; 38(10): 665 - 673. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Ellison, J. Lofing, and G. A. Bitter Functional analysis of human MLH1 and MSH2 missense variants and hybrid human-yeast MLH1 proteins in Saccharomyces cerevisiae Hum. Mol. Genet., September 1, 2001; 10(18): 1889 - 1900. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Geromel, N. Kadhom, I. Cebalos-Picot, O. Ouari, A. Polidori, A. Munnich, A. Rotig, and P. Rustin Superoxide-induced massive apoptosis in cultured skin fibroblasts harboring the neurogenic ataxia retinitis pigmentosa (NARP) mutation in the ATPase-6 gene of the mitochondrial DNA Hum. Mol. Genet., May 1, 2001; 10(11): 1221 - 1228. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-C. VON KLEIST-RETZOW, J. YAO, J.-W. TAANMAN, K. CHANTREL, D. CHRETIEN, V. CORMIER-DAIRE, A. RÖTIG, A. MUNNICH, P. RUSTIN, and E. A SHOUBRIDGE Mutations in SURF1 are not specifically associated with Leigh syndrome J. Med. Genet., February 1, 2001; 38(2): 109 - 113. [Full Text]
|
|
|
|
|
|
V. Tiranti, P. Corona, M. Greco, J.-W. Taanman, F. Carrara, E. Lamantea, L. Nijtmans, G. Uziel, and M. Zeviani A novel frameshift mutation of the mtDNA COIII gene leads to impaired assembly of cytochrome c oxidase in a patient affected by Leigh-like syndrome Hum. Mol. Genet., November 1, 2000; 9(18): 2733 - 2742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Hanson, R. Carrozzo, F. Piemonte, A. Tessa, B. H. Robinson, and R. A. Capaldi Cytochrome c Oxidase-deficient Patients Have Distinct Subunit Assembly Profiles J. Biol. Chem., May 4, 2001; 276(19): 16296 - 16301. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Hiser and J. P. Hosler Heme A Is Not Essential for Assembly of the Subunits of Cytochrome c Oxidase of Rhodobacter sphaeroides J. Biol. Chem., November 21, 2001; 276(48): 45403 - 45407. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||