Human Molecular Genetics, 2000, Vol. 9, No. 9 1259-1271
© 2000 Oxford University Press
Decreased expression of striatal signaling genes in a mouse model of Huntingtons disease
Department of Neurology, Massachusetts General Hospital, Boston, MA 02114, USA, 1Human Biology Division, Fred Hutchinson Cancer Research Center, Seattle, WA 98109, USA, 2Department of Neuropathology and 3Department of Psychiatry, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA
Received 31 January 2000; Revised and Accepted 11 March 2000.
| ABSTRACT |
|---|
|
|
|---|
To understand gene expression changes mediated by a polyglutamine repeat expansion in the human huntingtin protein, we used oligonucleotide DNA arrays to profile ~6000 striatal mRNAs in the R6/2 mouse, a transgenic Huntingtons disease (HD) model. We found diminished levels of mRNAs encoding components of the neurotransmitter, calcium and retinoid signaling pathways at both early and late symptomatic time points (6 and 12 weeks of age). We observed similar changes in gene expression in another HD mouse model (N171-82Q). These results demonstrate that mutant huntingtin directly or indirectly reduces the expression of a distinct set of genes involved in signaling pathways known to be critical to striatal neuron function.
| INTRODUCTION |
|---|
|
|
|---|
Huntingtons disease (HD) is an autosomal dominant neurodegenerative disorder manifested by psychiatric, cognitive and motor symptoms typically starting in mid life and progressing relentlessly to death. HD is caused by an expansion of a polyglutamine-encoding region in exon 1 of the IT15 gene that encodes huntingtin (1). Although huntingtin is ubiquitously expressed, the medium spiny GABAergic cells of the striatum are preferentially damaged in HD. There is no cure for this disorder and there is currently no therapeutic approach to delay the onset of symptoms.
Positron emission tomography (PET) studies of presymptomatic human patients indicate that neurotransmitter receptor decreases occur prior to the onset of overt clinical symptoms (2). We have recently demonstrated decreases in neurotransmitter receptors in a transgenic mouse HD model which are selective in that certain receptors are decreased while others are not (3,4). The pattern of neurotransmitter receptor decreases cannot be attributed to degeneration of a specific population of cells, but rather appears to reflect down-regulation of a specific subset of genes. These receptor changes, which occur at the levels of both protein and mRNA, precede and may therefore contribute to the onset of clinical symptoms. A transcription-related mechanism of huntingtin toxicity can also be inferred from other recent studies (57). We therefore hypothesized that huntingtin-induced changes in gene expression might extend to functional categories besides neurotransmitter receptors and that understanding these changes might provide an insight into HD progression.
In the present study, we extended our previous analysis of gene expression in HD models to determine the scope of mRNAs affected by mutant huntingtin. Of nearly 6000 mRNAs that were measured, a small number were decreased, and these were remarkably restricted to genes encoding neurotransmitter, calcium and retinoid signaling pathway components. This study demonstrates that the decrease in the abundance of specific neurotransmitter receptors is associated with decreased expression of many genes that mediate the signaling response from these receptors. The data provide additional evidence that mutant huntingtin compromises the ability of striatal neurons to receive and integrate afferent input and establishes bases for rational therapeutic intervention.
| RESULTS |
|---|
|
|
|---|
We analyzed gene expression in the striata of R6/2 mice at both 6 and 12 weeks of age, representing stages of minimal and pronounced deterioration in neurological function, respectively (mice described in Materials and Methods). At each age, we extracted RNA from pooled striata of mice carrying the expanded exon 1 HD transgene and from wild-type littermate controls. Each RNA sample was divided in half and analyzed using two sets of Affymetrix murine expression arrays. Within each age group we made four comparisons: each data set from the HD transgenics to each of the two control data sets. Using the Affymetrix algorithm for assessing gene expression differences (8), we identified mRNAs that were increased or decreased in R6/2 mice relative to controls in all four comparisons (high stringency analysis). mRNAs that met this criterion are presented in Table 1A. We also analyzed the data by the criterion of three of four comparisons (moderate stringency analysis, Table 1B). Because confirmation studies in our laboratory demonstrated that the Affymetrix algorithm-based change calls are reliable even when the fold change is relatively small, no arbitrary thresholds were imposed on the data set (see Confirmation of microarray findings below, Criteria for selecting affected genes in Materials and Methods and www.neumetrix.com ). Raw data and complementary data analyses (e.g. low stringency analysis and cross time point comparisons) are available at www.neumetrix.com . Using the three of four comparison cut-off, 1.7 and 1.2% of the genes tiled on the microarrays were changed in R6/2 mice compared with controls at 6 and 12 weeks, respectively. mRNAs that were decreased in R6/2 mice outnumbered those increased by 3:1. Increases were restricted largely to mRNAs associated with inflammatory and cell cycle function, while decreases were observed primarily in mRNAs involved in signal transduction, ion channels, transcription, metabolism and cell structure (Table 1 and Fig. 1). The representations of functional groups of molecules and the ratios between increased and decreased mRNAs obtained were similar using high, medium or low stringency criteria (Table 1 and www.neumetrix.com ).
|
|
It is important to note that the striatum represents a mixed population of neurons and glia and, therefore, the reported fold change might not accurately reflect the magnitude of change within an affected sub-population of cells. It is likely, however, that most of the neuron-specific gene changes are attributable to GABAergic medium spiny neurons, since these represent >85% of the neuronal population in striatum. The microarray-based results are presented in the next sections and are followed by northern blot and in situ hybridization histochemistry (ISHH) analyses that confirm and extend the data from the expression arrays.
Reduced expression of genes central to neural signaling
The most striking finding of this study was the relatively restricted decrease in mRNAs that encode neuronal signaling molecules (Table 1). This study extends our previous observations that dopamine, glutamate and adenosine receptors are decreased in the R6/2 model of HD by demonstrating that multiple components of each of these signaling pathways are decreased at the mRNA level.
Neurotransmitter receptors, neurotransmitters and neuropeptides.
Messenger RNAs encoding the G-protein-coupled receptors dopamine D2, dopamine D4, cannabinoid CB1, adrenergic
2 and an orphan glucocorticoid-inducible receptor (GIR) were decreased in R6/2 mice. Expression of the suspected HD modifier gene GluR6 (29) was also decreased. mRNAs for some receptor interacting proteins were affected, including
-actinin 2 (which was decreased) and the heterotrimeric G-protein subunit G
3 (which was increased). Decreases in mRNAs encoding the GABA-synthesizing enzyme glutamic acid decarboxylase and the neuropeptide precursors for enkephalin and somatostatin were also observed.
Signal transducing enzymes.
Dysregulation of genes encoding signal transduction proteins in R6/2 mice extended beyond plasma membrane-bound receptors and involved many intracellular signaling components. These include adenylyl cyclases and phosphodiesterases, protein kinases and phosphatases, small G-proteins and inhibitors or regulatory subunits of these enzymes. These changes could affect synaptic transmission and plasticity, because the proteins in this category integrate, amplify and limit signals controlling many neuronal functions. In several instances, genes that encode proteins of opposing function are decreased. These balanced disruptions are consistent with the notion that expression of genes having opposing roles in signaling cascades is coordinately regulated. Even so, decreased expression of immediate early genes that are normally up-regulated by neuronal stimulation (Table 1) and reduced levels of adenylyl cyclase (see below) suggest that neuronal signal transduction is generally diminished.
Calcium homeostasis and mobilization.
Calcium dysregulation has been postulated to be a component of HD pathology (30,31), but the mechanisms by which such changes occur have not been well defined. The present study revealed that this problem might be attributable, at least in part, to the down-regulation of mRNAs whose products regulate calcium homeostasis and calcium signaling. Calcium-related mRNAs that showed decreased expression in the R6/2 striata include a plasma membrane calcium ATPase (PMCA1AB), the type 1 ryanodine receptor (RYR1), the type 1 inositol 1,4,5-trisphosphate receptor (IP3R1, P400), calcineurin, hippocalcin, a calmodulin-dependent phosphodiesterase (PDE1B1) and a calcium/calmodulin-dependent protein kinase (CAMK IV/Gr). In addition, many of the proteins in the signal transduction group are regulated or modulated by calcium and calcium-sensing proteins. One possible mechanism by which mutant huntingtin may cause calcium signaling disturbances is through physical association with a calmodulin-containing complex (32).
Nuclear hormone receptors.
Retinoids (vitamin A derivatives) bind to nuclear hormone receptors and induce transcription of genes involved in neural differentiation and other processes (9). Expression of the striatally enriched retinoic acid receptor, RXR
, and a retinol-binding protein was decreased in R6/2 striata compared with controls. In addition, >20% of the genes less abundantly expressed in R6/2 striatum contain retinoic acid response elements and are induced by retinoic acid receptor agonists in cell culture experiments (Tables 1A and B).
Unchanged expression of genes associated with neurodegenerative events or diabetes
Previous histopathological studies of R6/2 mice demonstrated that the striata of these animals show neither gross neuronal loss nor gliosis up to 13 weeks of age (33). Consistent with these findings, no decreases in the expression of axonal or dendritic neuronal marker genes (e.g. MAP2 or neurofilaments) or increases in the expression of glial marker genes (e.g. glial fibrillary acidic protein, myelin basic protein or major histocompatability complex II components) were observed. Likewise, some mRNAs known to be expressed in medium spiny neurons (e.g. preprotachykinin) were unchanged. These findings indicate that decreases in the expression of neuronal signaling genes are not due to large shifts in striatal cell populations.
While many components of signaling cascades implicated in human HD were obviously changed in R6/2 brains, some mechanisms previously associated with the disease were represented only minimally. For example, very few changes were detected in mRNAs that encode mitochondrial proteins, proteolytic enzymes or apoptotic molecules. This may be due to their regulation by post-transcriptional mechanisms. Alternatively, these HD-related toxicities may be modest, and thus undetectable, at the R6/2 time points selected.
At 12 weeks, R6/2 animals are diabetic, showing both elevated baseline glucose levels and abnormal glucose tolerance tests, whereas 6-week-old animals handle glucose normally by these criteria (ref. 34; O. Andreasson and M.F. Beal, personal communication). Changes in mRNAs associated with glucose metabolism were not prominent in R6/2 mice at either age. Specifically, no differences in mRNAs, including glyceraldehyde phosphate dehydrogenase, glucose 6-phosphate isomerase, 6-phosphofructokinase, fructose bisphosphate aldolase, pyruvate dehydrogenase, phosphoglycerate kinase, lactate dehydrogenase and triose phosphate isomerase, were detected between R6/2 mice and controls. These data indicate that diabetes in R6/2 mice does not obscure the detection of bona fide huntingtin fragment-induced changes in gene expression.
Increased expression of genes associated with inflammation
Of over 6000 mRNAs represented on the microarrays, only 22 were increased in 6-week-old R6/2 mice and 21 were increased in 12-week-old mice compared with controls. In contrast to the mRNAs that were decreased in R6/2 mice, the increases in gene expression were generally not concentrated in discrete functional categories. The possible exceptions were mRNAs that encode stress or inflammation mediators and the expression of genes associated with cell cycle regulation. mRNAs increased at 6 weeks included rotamase/cyclophilin A and immunophilin P59. The proteins encoded by these mRNAs regulate the function of calcineurin, ryanodine receptors and phosphatidylinositol triphosphate (IP3) receptors (see Calcium homeostasis and mobilization above) and are inhibited by immunosuppressants such as cyclosporin and FK506. At the 12-week time point cathepsin S, apolipoprotein D and MHC ß2 microglobulin mRNAs were increased. These mRNAs are also induced in a mouse scrapie model, which represents another protein aggregation disease (35). Several inflammation-related mRNAs and other mRNAs that are increased in R6/2 mice were induced by interferon-
in mouse primary fibroblasts assayed on Mu6500 microarrays (Tables 1A and B; S. Der and B. Williams, personal communication). Whether these mRNAs can be coordinately regulated in R6/2 mice by immune mediators remains to be determined.
Confirmation of microarray findings
In order to confirm changes in mRNA expression detected by the microarrays and to extend our understanding of the anatomical distribution of these changes, we performed northern blotting and in situ hybridization histochemistry (ISHH) experiments using independent litters of R6/2 mice. Northern hybridization results correspond to the array data for three decreased genes (zif268, GIR and PCTP), one unchanged gene (NMDA-NR1) and two increased genes (G
3 and PA28
) in R6/2 mice (Fig. 2). mRNAs were also measured in brain tissue sections by ISHH (Fig. 3). We confirmed striatal decreases for six mRNAs at 6 and 12 weeks and striatal increases in two mRNAs at 12 weeks by this method. These studies confirmed the array data with regard to differences in expression levels and provided anatomical resolution in the striatum and cortex. Cortical decreases in junB, N10 and zif268 at 6 and 12 weeks and cortical increases in G
3 and PA28
at 12 weeks were observed.
|
|
Striatal gene expression profiles from 6-week-old R6/2 mice were directly compared with those from 12-week-old animals to determine whether there were changes indicative of disease progression (analysis not shown, refer to www.neumetrix.com ). While many genes in both R6/2 animals and controls differed between the two time points, certain mRNAs characteristic of mature medium spiny neurons, such as preproenkephalin, dopamine D2 receptors and glutamic acid decarboxylase, decreased as neurological symptoms progressed. This was confirmed by the ISHH data for preproenkephalin and DARPP-32, another mRNA characteristic of this cell population (ref. 36 and Fig. 3). Previous ISHH assays have also shown progressive decreases in adenosine A2a and dopamine D1 and D2 receptor mRNAs (3,4).
Type II and V adenylyl cyclases were decreased whereas type VII adenylyl cyclase was increased in the microarray analysis. To determine the overall impact on adenylyl cyclase levels, [3H]forskolin binding assays were performed. [3H]forskolin binds to all adenylyl cyclase subtypes and provides a measure of adenylyl cyclase protein levels. [3H]forskolin binding was decreased in R6/2 striata to 24% of wild-type in 12-week-old animals (P = 0.0053, n = 5).
Signaling molecules affected in R6/2 mice are also decreased in other HD transgenic mice
The comparisons of R6/2 data to littermate controls demonstrated that the presence of the expanded repeat ITI5 exon 1 transgene resulted in the mRNA changes described above. To determine the extent to which these changes might be specific to this mouse model, we examined the expression of a subset of these mRNAs in another line of HD transgenic mice, N171-82Q (mice described in Materials and Methods and ref. 37). Significant decreases in symptomatic 4-month-old N171-82Q mice relative to N171-18Q or wild-type mice were observed in binding assays for dopamine D2 receptors (78% control), adenosine A2a receptors (61% control) and adenylyl cyclase (71% control) and in situ hybridization for D2 (61% control), N10 (49% control), preproenkephalin (59% control) and DARPP-32 (62% control) (Table 2). ISHH for junB, G
3 and zif268 was not different from controls (n = 3). Differences between the findings in R6/2 and N171-82Q lines could arise from differing polyglutamine lengths, promoters, transgene insertion sites or mouse strains. Overall, the concordance between microarray, northern, in situ and binding analyses performed on independent litters of mice from the two transgenic lines suggest that gene expression changes are characteristic of HD pathogenesis (see below).
|
Changes in gene expression in R6/2 brains parallel decreased mRNA and protein levels described in previous HD studies
It is important to consider whether the observed changes in steady-state mRNA populations in HD mouse models result in reduced protein levels and function and whether there is a link between mouse model data and human disease. In the present study, we addressed changes in protein levels in a limited fashion by demonstrating that forskolin binding was diminished in R6/2 mice and that binding to dopamine D2 receptors, adenosine A2a receptors and adenylyl cyclase was decreased in N171-18Q mice. Though extensive protein analysis was beyond the scope of this study, microarray-based mRNA findings were consistent with previous work that used both human tissue and mouse models of HD. Previous studies in our laboratory have shown decreases in A2a, D1 and D2 receptor mRNAs and in corresponding protein levels based on receptor binding assays performed in three different lines of mice transgenic for a CAG-expanded exon 1 of the ITI5 gene (R6/1, R6/2 and R6/5) (3,4). In the HDex6 and HDex27 lines, which are transgenic for exon 1 of the human IT15 gene containing 18 CAG repeats, striatal levels of A2a, D1 and D2 binding and mRNA are equivalent to wild-type animals, indicating that the CAG expansion of exon 1 is necessary for their down-regulation (4). In addition, other researchers have shown that decreases in preproenkephalin mRNA are associated with decreased enkephalin immunoreactivity in R6/2 striata (38).
Parallels can also be found between decreased mRNAs in R6/2 striata and decreased mRNA and protein levels in human HD brains. Preproenkephalin mRNA is diminished in early stage human Huntingtons disease brains (39,40). Human HD brains also show specific decreases in the enzymatic activities of neuron-specific enolase, protein kinase C isoform ßII and glutamic acid decarboxylase (4143). In vitro binding assays show decreases in IP3 receptor, L-type calcium channel and cannabinoid receptor (42,4446; see ref. 47 for cannabinoid ISHH data in R6/2 mice). Moreover, D1 and D2 dopamine receptor binding is decreased in vitro and in vivo in presymptomatic patients carrying the HD mutation (2). Although the subset of mRNAs in Table 1 that have been tested at the protein level is small, the results demonstrate that gene expression changes in the 6- and 12-week-old R6/2 striata mirror previously described changes in HD.
| DISCUSSION |
|---|
|
|
|---|
This study identified genes that were aberrantly expressed in the striata of R6/2 mice using an expression array that interrogates ~6000 mRNAs. This screen, while far from saturating, identified gene networks that are affected by the HD mutation. Our data suggest that the dysregulation of mRNAs encoding neurotransmitter receptors and related second messenger systems is an early component of the pathological process. In addition, a small number of mRNAs responsive to inflammatory mediators were increased. mRNAs encoding mitochondrial proteins, caspases and other apoptosis-related molecules, all of which have been implicated in HD, were relatively unaffected. mRNAs encoding neuronal structural proteins were also generally unchanged between experimental and control mice, consistent with histopathological observations that R6/2 mice have normal cell counts (33). Thus, RNA changes in these mice are not simply due to neuronal death.
Although we and others have previously demonstrated decreased expression of dopamine, glutamate and adenosine receptors in HD, this study demonstrates that many components of their signaling pathways and target genes are similarly reduced. In Figure 4, genes whose expression is altered by mutant huntingtin are integrated into a schematic drawing of a striatal medium spiny neuron, demonstrating the extent to which signal transduction genes are affected. Reduced levels of neurotransmission-regulated immediate early gene mRNAs and adenylyl cyclase protein suggest that, overall, mutant huntingtin-mediated mRNA changes impair transduction of neuron-specific signals. Whether this is an adaptive response of neurons to mutant huntingtin remains to be determined. In addition to the decreased messages encoding afferent signaling molecules, decreased expression of preproenkephalin and glutamic acid decarboxylase suggests that medium spiny neurons may generate abnormally decreased efferent signals.
|
The array data further demonstrate abnormal expression of multiple genes involved in calcium signaling, consistent with studies in another mouse HD model that showed increased basal calcium levels and decreased glutamate-induced calcium mobilization (31). The mRNA profiling in our study indicates that elevated basal calcium could be attributed to a diminution of plasma membrane calcium ATPase activity. Also, losses of mRNAs encoding IP3 and ryanodine receptors, voltage-sensitive calcium channels, calcium-binding proteins, and calcium/calmodulin-dependent enzymes could prevent the generation of appropriate calcium-mediated intracellular signals in response to glutamate. The blunting of calcium-mediated responses through all of these mechanisms could cause deficits in many important neuronal functions, including synaptic plasticity.
Both microarray and ISHH demonstrate that gene expression changes occur in minimally symptomatic animals and persisted during progression of the disease in R6/2 mice. This suggests that disease progression might represent the accumulation of neuronal damage caused by a persistent dysregulation of signaling systems. It has been shown that long-term potentiation (LTP) and long-term depression (LTD) deficits occur in transgenic models of HD, including R6/2 mice (ref. 31; K. Murphy, personal communication). The array data showed decreased expression of many of the mediators of LTP and LTD, such as cyclic AMP cascades, calcium-dependent kinases and phosphatases, voltage-dependent calcium channels and glutamate receptors. The notion that deficits in neurotransmission occur early in disease progression is supported by human PET studies reporting losses of D1 and D2 receptors in clinically asymptomatic HD gene-positive individuals (2).
This study also provides the first evidence that impaired retinoid signaling might contribute to HD pathophysiology. In addition to decreased RXR
, retinoic acid signaling regulates at least 22 of the 104 genes that show decreased expression in R6/2 mice. The disruption of RA signaling by mutant huntingtin can be explained by either of two mechanisms: first, dopamine can positively regulate the expression of retinoic acid receptor genes and the diminished activity of the dopamine signaling pathway in HD might decrease RXR
expression (10); second, the nuclear co-repressor NCoR binds both mutant huntingtin and retinoic acid receptors (7,11) and could sequester receptors in a non-functional complex. It is interesting to note that glial cells in the lateral striatum produce more retinoids than those in the medial striatum, resulting in a concentration gradient across the structure that is opposite to the gradient of neural degeneration in HD (12). In other words, the striatal neurons that degenerate first in HD are those surrounded by the lowest concentration of retinoids.
The signaling pathways affected by the mutant huntingtin protein represent logical targets for therapeutic intervention. The current data indicate a potential therapeutic role for drugs that restore neuronal calcium homeostasis, modulate dopamine or glutamate signaling pathways or that inhibit inflammatory responses. Because retinoic acid analogs have been clinically demonstrated to overcome retinoic acid receptor deficits (e.g. in acute promyelocytic leukemia; ref. 48), it is possible that the deficits in HD striatal neuron retinoic acid receptors and binding proteins could be compensated for by pharmacological doses of retinoic acid agonists. The identification of a distinct gene expression signature in the striata of R6/2 mice provides a valuable reference for the rapid assessment of therapeutic efficacy in candidate drug screens.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Animals
Female R6/2 mice (33) and wild-type controls (F1) were purchased from The Jackson Laboratory (Bar Harbor, ME) and killed at 56 or 1112 weeks of age. R6/2 mice express exon 1 of the human IT15 gene containing an extremely expanded CAG repeat (140147) under control of the human IT15 promoter. These animals appear to develop normally through weaning, but display subtle deficits starting at 56 weeks of age which progress to a resting tremor, involuntary movements, stereotypic grooming and handling-induced seizures by 912 weeks of age (33,49).
N171-82Q mice and controls (N171-18Q and wild-type) (37) were obtained from the authors colony (G.S., C.A.R. and D.R.B.) and killed at 4 months of age (late symptomatic stage for the N171-82Q mice). The N171 mice used for the present study carry a transgene encoding the N-terminal 171 amino acids of human huntingtin with a polyglutamine repeat length of 18 (N171-18Q) or 82 (N171-82Q), expressed under the control of the PrP promoter. Phenotypically, N171-82Q animals show loss of coordination, tremors, hypokinesis, gait abnormalities and premature death (37).
Gene expression changes in R6/2 and N171-82Q mice are attributable to an N-terminal portion of the human huntingtin protein expressed from a partial IT15 transgene. There are several lines of evidence to support the relevance of a similar mutant huntingtin fragment to the human disease. First, a similar proteolytic fragment of huntingtin has been detected in human HD brains and those of several HD models (32,50). Second, such a fragment has a higher propensity for aggregation (50,51) and appears to be present in huntingtin-positive aggregates in human brain (52). Additionally, this fragment contains structural domains that mediate most of huntingtins known proteinprotein interactions (7,53,54).
Tissue
For RNA extractions, the striata were dissected bilaterally, removed immediately to dry ice and stored at 70°C until the tissue was processed. For in situ hybridization histochemistry and autoradiographic studies, brains were frozen whole by immersion in isopentane on dry ice for 3 min, then stored at 70°C until the tissue was sectioned. Cryostat sections (12 µm) containing striatum and cortex were thaw mounted onto polylysine-coated glass slides.
RNA extraction
RNA was extracted using TRI-Reagent (Sigma, St Louis, MO) according to the manufacturers recommended protocol, except that the isopropanol precipitation step was performed at 20°C overnight. RNA pellets were resuspended in nuclease-free water and quantitated spectrophotometrically.
Preparation of labeled cRNA
RNA from the striata of six R6/2 or six age-matched wild-type animals at each age was combined to comprise each sample, consisting of 70100 µg of total RNA. Poly(A)+ RNA was isolated from the samples using Oligotex mRNA isolation kits (Qiagen, Chatsworth, CA). At this point the samples were split in half and all further procedures were performed on each pool independently. Biotinylated cRNAs were prepared per Affymetrix protocol. Labeled cRNA (32 µg) was fragmented in 40 µl of 40 mM Trisacetate pH 8.0, 100 mM KOAc, 30 mM MgOAc for 35 min at 95°C. The fragmented cRNA was brought to a final volume of 300 µl in hybridization buffer containing 100 mM MES, 20 mM EDTA, 0.01% Tween-20 (all from Sigma), 1 M NaCl (Ambion, Austin, TX), 0.5 mg/ml acetylated BSA (Gibco BRL, Gaithersburg, MD), 0.1 mg/ml herring sperm DNA (Promega, Madison, WI) and biotinylated controls B2, BioB, BioC, BioD and Cre (Affymetrix, Santa Clara, CA) at 50, 1.5, 5, 25, 100 pM, respectively.
Array hybridization
Mu6500 A, B, C and D oligonucleotide arrays were prehybridized, hybridized, washed and stained as recommended by the manufacturer (Affymetrix) using a GeneChip Fluidics Station 400 (Affymetrix). The arrays were hybridized sequentially over the course of 4 days using 200 µl of cRNA (0.1 µg/µl) per hybridization. After hybridization of one array, the aliquot was recovered from the array, recombined with the unused portion of the sample and frozen. This process was repeated with each sample until the sample had been hybridized to the entire set of four arrays. Immediately after washing and staining, the probed arrays were scanned with a Hewlett Packard GeneArray scanner. The scanned images were analyzed and compared using GeneChip3.1 software (Affymetrix) (8). Images were globally scaled to compensate for minor variations in fluorescence and bring the mean average difference for all of the genes on each array to 2500 intensity units.
Criteria for selecting affected genes
We designed our study to minimize potential experimental confounds as follows. First, we used a pooled sample for the Affymetrix GeneChip analysis, followed by validation in independent litters of mice in order to minimize effects of animal-to-animal and litter-to-litter variability. Second, we analyzed each sample in duplicate, to control for differences in efficiency of mRNA amplification and chip variability. Third, we confirmed a subset of our findings by other methodologies and in other lines of HD transgenic mice.
We compared each R6/2 sample to both age-matched control samples, thus for each age of mice obtaining four mutant to wild-type comparisons. We used the default parameters in the GeneChip3.1 software to call mRNAs increased, decreased or not changed in the R6/2 striata relative to the controls. No additional thresholds (e.g. minimum fold change) were introduced. The GeneChip3.1 Difference Call Decision Matrix (8) is a metric based on the magnitude and sign of the hybridization signal difference between the two samples being compared plus a tallying of the various oligonucleotide probes that have a positive or negative signal change. Typically, the genes on the arrays are represented by an average of 20 probe pairs. mRNAs that were called as increased or decreased in at least three of the four comparisons were designated for inclusion in this report. This cut-off was chosen based on the following considerations: (i) prior findings show a >90% concordance between Affymetrix microarray data and northern/S1 protection assay data in studies of similar design (J.M. Olson, A. Strand and S.J. Tapscott, unpublished observations); (ii) comparison of two hybridizations of the same sample yields a call rate <1% (which can be considered an estimate of the false positive rate). Thus, the representation of mRNAs called in three of four comparisons at a false positive rate of up to 1% is extremely low. Table 1 lists genes that differed between R6/2 and wild-type striata in 4/4 (high stringency) and 3/4 (moderate stringency) comparisons and the entire data set is available at www.neumetrix.com . As mentioned above, the persistent expression of genes in cells not affected by mutant huntingtin serves to reduce the apparent magnitude of any changes. A less stringent examination of the data that relies solely on the probe pairs is also presented at www.neumetrix.com
Probes for in situ and northern hybridization
Probe sequences used for in situ and northern hybridization were cloned by RTPCR, obtained as I.M.A.G.E. Consortium clones (from Genome Systems, St Louis, MO) or ordered as custom oligonucleotides (from Gibco BRL). Oligonucleotide primers and probes were either designed (those listing GenBank accession nos) using Oligo 4.06 software (National Biosciences, Plymouth, MN) and analyzed for specificity by database searching using BLASTN (National Center for Biotechnology Information, Bethesda, MD) or selected based on use in previous studies. T7 and SP6 promoter sequences (CTGTAATACGACTCACTATAGGG and GGGATTTAGGTGACACTATAGAA, respectively) were added to the 5'-ends of PCR primers in some cases for use in in vitro transcription of riboprobes. Gene-specific sequences of primers used to clone probes by RTPCR were as follows:
-actinin 2 (GenBank accession no. AA800206), CGTAGAGGGCAGGAGAAG and TTTGACAGGAGGAAGAATGG; NMDA-NR1, GGAGTGGAACGGAATGATGG and AAAGCCTGAGCGGAAGAACA (outer) and CTGTAATACGACTCACTATAGGGTTATGCAGCCTTTTCAGAGC and GGGATTTAGGTG- ACACTATAGAAGCACGGCCGAGTCCCAGAT (inner); zif268 (GenBank accession no. M22326), GTTCGGCTCCTTTCCTCACT and GCCTCTTGCGTTCATCACTC (outer) and TGAAGAAGGCGATGGTGGAGA and GGCAGAGGAAGACGATGAA (inner). PCR-generated probe templates were purified using a Strataprep PCR Purification Kit (Stratagene, La Jolla, CA). The following in situ probes were obtained as I.M.A.G.E. Consortium clones: GIR (ID 421187); G
3 (ID 47893); PA28
(ID 598746). Oligonucleotide in situ probes comprised: DARPP-32 (GenBank accession no. U23160), GAGCTGGCTCGGGGGCGCGGGCACAGAGAA; junB, ACTGGGCGCAGGCGGGCGGGCCGGAGTCCAGTGTGTGAGCTGCGCC; N10, GTGGTCACGCGGTCCTGGGCTC- GTTGCTGGTGTTCCATATTGAGC; ß-actin, GCCGATCC- ACACGGAGTACTTGCGCTCAGGAGGAGCAATGATCTT; preproenkephalin (GenBank accession no. M28263), ATCTGCATCCTTCTTCATGAAACCGCCATACCTCTTGGCAAG GATCTC. Probes used for the following northern blots were generated by PCR subcloning partial I.M.A.G.E. Consortium clone sequences: PA28
(primers AGAAGAAAGGGGACGAAGAC and TGTTTGGGAGGCAGAGTGAG); G
3 (primers CTCCCCACTGACCCTACATC and CTGCCTTGGACACCTTTATC); GIR (primers TGACAGCTATCGCAGTGGAC and CAGCAGAGGGCAAAGAGGAC). The identities of PCR products and I.M.A.G.E. Consortium clones were confirmed by sequencing.
Northern analysis
Two micrograms of each RNA sample were denatured in 1x MOPS containing 50% formamide and 3% formaldehyde, electrophoresed through a 1.2% agarose gel containing 3% formaldehyde and electorphoretically transferred to a nylon membrane. Random primed 32P-radiolabeled cDNA probes (sp. act. ~6.0 x 109 d.p.m./µg) were prepared using a Prime-It kit (Stratagene). Oligonucleotide probes were labeled using the Renaissance oligonucleotide 3'-end-labeling system (NEN Life Sciences). Hybridization took place overnight at 42°C, and final high-stringency washes were performed with 0.5x SSC (for oligonucleotide probes) or 0.1x SSC (for cDNA probes) plus 0.1% SDS at 42°C. Hybridization was detected by autoradiography using a Molecular Dynamics PhosphorImager (Sunnyvale, CA) and the signal was quantitated using ImageQuant software (v.1.2).
In situ hybridization histochemistry
PCR products and I.M.A.G.E. clones (above) were used as templates for in vitro transcription of 35S-labeled riboprobes. Oligonucleotide probes were prepared using the Renaissance oligonucleotide 3'-end-labeling system and purified with NENsorb columns (NEN Life Sciences). ISHH was conducted according to Landwehrmeyer et al. (55) (cRNA probes) or Augood et al. (56) (oligonucleotide probes) with 12 µm fresh-frozen cryostat sections of mouse brain. Autoradiograms were obtained on Hyperfilm ß-Max (Amersham, Arlington Heights, IL) by 228 day exposures. Films were developed and analyzed using a computer-based image analysis system (M1; Imaging Research, St Catharines, Ontario, Canada).
Receptor and adenylyl cyclase autoradiography
All studies were performed on coded samples by experimenters blinded to the genotype status of the animals. Dopamine D1 and D2 receptor assays used a buffer containing 25 mM TrisHCl pH 7.5, 100 mM NaCl, 1 mM MgCl2, 1 µM pargyline and 0.001% ascorbate. For D1 receptors, slides were incubated with 1.65 nM [3H]SCH-23390 (sp. act. 70.3 Ci/mmol; NEN Life Sciences) for 2.5 h. Non-specific binding was defined in the presence of 1 µM cis-flupentixol (57). For D2 receptors, slides were incubated with 180 pM [3H]YM-09151-2 (sp. act. 85.5 Ci/mmol) for 3 h. Non-specific binding was defined in the presence of 50 µM dopamine (58). For adenosine A2a receptors, the buffer used was 50 mM TrisHCl, pH 7.4 with 10 mM MgCl2. Following a preincubation for 30 min at room temperature in buffer containing 2 IU/ml adenosine deaminase, slides were incubated in buffer containing 5 nM [3H]CGS 21680 (sp. act. 39.5 Ci/mmol) for 90 min (59). Non-specific binding was defined in the presence of 20 µM 2-chloroadenosine. Slides were rinsed for 5 min in ice-cold buffer, then quickly in ice-cold ddH2O and dried rapidly under a stream of warm air. For adenylyl cyclase, slides were incubated in 10 nM [3H]forskolin in 50 mM TrisHCl with 100 mM NaCl and 5 mM MgCl2 for 10 min at room temperature (60). Slides were rinsed twice for 2 min at 4°C and then dried. Slides were apposed to tritium-sensitive film (Hyperfilm 3H; Amersham) with calibrated radioactive standards and exposed for 13 weeks. Films were developed and analyzed using a computer-based image analysis system (M1; Imaging Research). Image density corresponding to binding of [3H]ligand was converted to pmol/mg protein using calibrated radioactive standards and non-specific binding was subtracted.
| ACKNOWLEDGEMENTS |
|---|
We are grateful to Jim Eberwine, Leslie Thompson, Sarah Augood and Jonathan Cooper for helpful discussions and critical evaluation of the manuscript. We also thank Jeff Delrow and colleagues in the DNA Microarray Laboratory at the FHCRC. This work was supported by the Hereditary Disease Foundation (R.L.-C., C.A.R., D.R.B., A.B.Y. and J.-H.J.C.), the Huntingtons Disease Society of America (R.L.-C., C.A.R., D.R.B. and J.-H.J.C.), USPHS grants (NS10800 to R.L.-C.; NS16375 and NS38144 to C.A.R. and D.R.B.; AG13617 and NS38106 to A.B.Y.; NS01916 to J.-H.J.C; HD28834 to J.M.O. through the University of Washington Child Health Research Center), the Glendorn Foundation (A.B.Y.) the W.M. Keck Foundation and the Burroughs Wellcome Fund (Career Award to J.M.O.).
| FOOTNOTES |
|---|
+ To whom correspondence should be addressed. Tel: +1 206 667 7955; Fax: +1 206 667 6524; Email: jimmyo@u.washington.edu
| REFERENCES |
|---|
|
|
|---|
1 Huntingtons Disease Collaborative Research Group (1993) A novel gene containing a trinucleotide repeat that is unstable in Huntingtons disease chromosomes. Cell, 72, 971983.[Web of Science][Medline]
2 Weeks, R.A., Piccini, P., Harding, A.E. and Brooks, D.J. (1996) Striatal D1 and D2 dopamine receptor loss in asymptomatic mutation carriers of Huntingtons disease. Ann. Neurol., 40, 4954.[Web of Science][Medline]
3 Cha, J.-H., Kosinski, C.M., Kerner, J.A., Alsdorf, S.A., Mangiarini, L., Davies, S.W., Penney, J.B., Bates, G.P. and Young, A.B. (1998) Altered brain neurotransmitter receptors in transgenic mice expressing a portion of an abnormal human Huntington disease gene. Proc. Natl Acad. Sci. USA, 95, 64806485.
4 Cha, J.-H., Frey, A.S., Alsdorf, S.A., Kerner, J.A., Kosinski, C.M., Mangiarini, L., Penney, J.B., Davies, S.W., Bates, G.P. and Young, A.B. (1999) Altered neurotransmitter receptor expression in transgenic mouse models of Huntingtons disease. Phil. Trans. R. Soc. Lond. B Biol. Sci., 354, 981989.[Web of Science][Medline]
5 Li, S.H., Cheng, A.L., Li, H. and Li, X.J. (1999) Cellular defects and altered gene expression in PC12 cells stably expressing mutant huntingtin. J. Neurosci., 19, 51595172.
6 Huang, C.C., Faber, P.W., Persichetti, F., Mittal, V., Vonsatte, J.-P., MacDonald, M.E. and Gusella, J.F. (1998) Amyloid formation by mutant huntingtin: threshold, progressivity and recruitment of normal polygluatmine proteins. Somat. Cell Mol. Genet., 24, 217233.[Web of Science][Medline]
7 Boutell, J.M., Thomas, P., Neal, J.W., Weston, V.J., Duce, J., Harper, P.S. and Jones, A.L. (1999) Aberrant interactions of transcriptional repressor proteins with the Huntingtons disease gene product, huntingtin. Hum. Mol. Genet., 8, 16471655.
8 Lipshutz, R.J., Fodor, S.P., Gingeras, T.R. and Lockhart, D.J. (1999) High density synthetic oligonucleotide arrays. Nature Genet., 21 (suppl. 1), 2024.[Web of Science][Medline]
9 Clagett-Dame, M. and Plum, L.A. (1997) Retinoid-regulated gene expression in neural development. Crit. Rev. Eukaryot. Gene Expr., 7, 299342.[Web of Science][Medline]
10 Matkovits, T. and Christakos, S. (1995) Ligand occupancy is not required for vitamin D receptor and retinoid receptor-mediated transcriptional activation. Mol. Endocrinol., 9, 232242.
11 Horlein, A.J., Nar, A.M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamel, Y., Soderstrom, M., Glass, C.K. and Rosenfeld, M.G. (1995) Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature, 377, 397404.[Medline]
12 Toresson, H., Urquiza, A.M., Fagerstrom, C., Perlmann, T. and Campbell, K. (1999) Retinoids are produced by glia in the lateral ganglionic eminence and regulate striatal neuron differentiation. Development, 126, 13171326.[Abstract]
13 Samad, T.A., Krezel, W., Chambon, P. and Borrelli, E. (1997) Regulation of dopaminergic pathways by retinoids: activation of the D2 receptor promoter by members of the retinoic acid receptor-retinoic X receptor family. Proc. Natl Acad. Sci. USA, 94, 1434914354.
14 Jonk, L.J.C., deJonge, M.E.J., Vervaart, J.M.A., Wissink, S. and Kruijer, W. (1994) Isolation and developmental expression of retinoic-acid-induced genes. Dev. Biol., 161, 604614.[Web of Science][Medline]
15 Bain, G., Ray, W.J., Yao, M. and Gottlieb, D.I. (1994) From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays, 16, 343348.[Web of Science][Medline]
16 Kogner, P., Borgstrom, P., Bjellerup, P., Schilling, F.H., Refai, E., Jonsson, C., Dominici, C., Wassberg, E., Bihl, H. and Jacobsson, H., Theodorsson, E. and Hassan, M. (1997) Somatostatin in neuroblastoma and ganglioneuroma. Eur. J. Cancer, 33, 20842089.
17 Sato, T., Xiao, D.M., Li, H., Huang, F.L. and Huang, K.P. (1995) Structure and regulation of the gene encoding the neuron-specific protein kinase C substrate neurogranin (RC3 protein). J. Biol. Chem., 270, 1031410322.
18 Pennypacker, K.R., Kincaid, R.L., Polli, J.W. and Billingsley, M.L. (1989) Expression of calmodulin-dependent phosphodiesterase, calmodulin-dependent protein phosphatase and other calmodulin-binding proteins in human SMS-KCNR neuroblastoma cells. J. Neurochem., 52, 14381448.[Web of Science][Medline]
19 Lipskaia, L., Djiane, A., Defer, N. and Hanoune, J. (1997) Different expression of adenylyl cyclase isoforms after retinoic acid induction of P19 teratocarcinoma cells. FEBS Lett., 415, 275280.[Web of Science][Medline]
20 Kihira, H., Hiasa, A., Yamamoto, M., Katayama, N., Kuno, T, Ohtsuka, K., Shiku, H. and Nishikawa, M. (1998) Possible involvement of calcineurin in retinoic acid-induced inhibition of leukemic HL-60 cell proliferation. Int. J. Oncol., 12, 629634.[Web of Science][Medline]
21 Comb, M., Mermod, N., Hyman, S.E., Pearlberg, J., Ross, M.E. and Goodman, H.M. (1988) Proteins bound at adjacent DNA elements act synergistically to regulate human proenkephalin cAMP inducible transcription. EMBO J., 7, 37983805.
22 Montminy, M.R., Low, M.J., Tapia-Arancibia, L., Reichlin, S., Mandel, G. and Goodman, R.H. (1986) Cyclic AMP regulates somatostatin mRNA accumulation in primary diencephalic cultures and in transfected fibroblasts. J. Neurosci., 6, 11711176.[Abstract]
23 Laprade, N. and Soghomonian, J.J. (1997) Glutamate decarboxylase (GAD65) gene expression is increased by dopamine receptor agonists in a subpopulation of rat striatal neurons. Brain Res. Mol. Brain Res., 48, 333345.[Medline]
24 Reutter, M.A., Richards, E.M. and Sumners, C. (1997) Regulation of alpha 2A-adrenergic receptor mRNA in rat astroglial cultures: role of cyclic AMP and protein kinase C. J. Neurochem., 68, 4757.[Web of Science][Medline]
25 Du, Y., Carlock, L. and Kuo, T.H. (1995) The mouse plasma membrane Ca2+ pump isoform 1 promoter: cloning and characterization. Arch. Biochem. Biophys., 316, 302310.[Web of Science][Medline]
26 Matranga, V., Oliva, D., Sciarrino, S., DAmelio, L. and Giallongo, A. (1993) Differential expression of neuron-specific enolase mRNA in mouse neuroblastoma cells in response to differentiation inducing agents. Cell. Mol. Neurobiol., 13, 137145.[Web of Science][Medline]
27 Vaccarino, F.M., Hayward, M.D., Le, H.N., Hartigan, D.J., Duman, R.S. and Nestler, E.J. (1993) Induction of immediate early genes by cyclic AMP in primary cultures of neurons from rat cerebral cortex. Brain Res. Mol. Brain Res., 19, 7682.[Medline]
28 Kuzhikandathil, E.V. and Molloy, G.R. (1994) Transcription of the brain creatine kinase gene in glial cells is modulated by cyclic AMP-dependent protein. J. Neurosci. Res., 39, 7082[Web of Science][Medline]
29 Rubinsztein, D.C., Leggo, J., Chiano, M., Dodge, A., Norbury, G., Rosser, E. and Craudfurd, D. (1997) Genotypes at the GluR6 kainate receptor locus are associated with variation in the age of onset of Huntingtons disease. Proc. Natl Acad. Sci. USA, 94, 38723876.
30 Schousboe, A., Belhage, B. and Frandsen, A. (1997) Role of Ca2+ and other second messengers in excitatory amino acid receptor mediated neurodegeneration: clinical perspectives. Clin. Neurosci., 4, 194198.[Web of Science][Medline]
31 Hodgson, J.G., Agopyan, N., Gutekunst, C.A., Leavitt, B.R., LePiane, F., Singaraja, R., Smith, D.J., Bissada, N., McCutcheon, K., Nasir, J. et al. (1999) A YAC mouse model for Huntingtons disease with full-length mutant huntingtin, cytoplasmic toxicity and selective striatal neurodegeneration. Neuron, 23, 181192.[Web of Science][Medline]
32 Bao, J., Sharp, A.H., Wagster, M.V., Becher, M., Schilling, G., Ross, C.A., Dawson, V.L. and Dawson, T.M. (1996) Expansion of polyglutamine repeat in huntingtin leads to abnormal protein interactions involving calmodulin. Proc. Natl Acad. Sci. USA, 93, 50375042.
33 Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H., Davies, S.W. and Bates, G.P. (1996) Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell, 87, 493506.[Web of Science][Medline]
34 Hurlbert, M.S., Zhou, W., Wasmeier, C., Kaddis, F.G., Hutton, J.C. and Freed, C.R. (1999) Mice transgenic for an expanded CAG repeat in the Huntingtons disease gene develop diabetes. Diabetes, 48, 649651.[Abstract]
35 Dandoy-Dron, F., Guillo, F., Benboudjema, L., Deslys, J.P., Lasmezas, C., Dormont, D., Tovey, M.G. and Dron, M. (1998) Gene expression in scrapie. Cloning of a new scrapie-responsive gene and the identification of increased levels of seven other mRNA transcripts. J. Biol. Sci., 273, 76917697.
36 Greengard, P., Allen, P.B. and Nairn, A.C. (1999) Beyond the dopamine receptor: the DARPP-32/protein phosphatase-1 cascade. Neuron, 23, 435447.[Web of Science][Medline]
37 Schilling, G., Becher, M.W., Sharp, A.H., Jinnah, H.A., Duan, K., Kotzuk, J.A., Slunt, H.H., Ratovitski, T., Cooper, J.K., Jenkins, N.A., Copeland, N.G., Price, D.L., Ross, C.A. and Borchelt, D.R. (1999) Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N-terminal fragment of huntingtin. Hum. Mol. Genet., 8, 397407.
38 Menalled, L., Zanjani, H., MacKenzie, L., Koppel, A., Carpenter, E., Zeitlin, S. and Chesselet, M.-F. (2000) Decrease in striatal enkephalin mRNA in mouse models of Huntingtons disease. Exp. Neurol., 162, 328342. [Web of Science][Medline]
39 Albin, R.L., Qin, Y., Young, A.B., Penney, J.B. and Chesselet, M.F. (1991) Preproenkephalin messenger RNA-containing neurons in striatum of patients with symptomatic and presymptomatic Huntingtons disease: an in situ hybridization study. Ann. Neurol., 30, 542549.[Web of Science][Medline]
40 Augood, S.J., Faull, R.L.M., Love, D.R. and Emson, P.C. (1996) Reduction in enkephalin and substance P messenger RNA in the striatum of early grade Huntingtons disease: a detailed cellular in situ hybridization study. Neuroscience, 72, 10231036.[Web of Science][Medline]
41 Marangos, P.J. and Paul, S.M. (1981) Brain levels of neuron-specific and nonneuronal enolase in Huntingtons disease. J. Neurochem., 37, 13381340.[Web of Science][Medline]
42 Tanaka, C., Nishino, N., Hashimoto, T., Kitamura, N., Yoshihara, C. and Saito, N. (1993) Second messenger systems in brains of patients with Parkinsons or Huntingtons disease. Adv. Neurol., 60, 175180.[Medline]
43 Enna, S.J., Bird, E.D., Bennett, J.P., Bylund, D.B., Yammura, H.I., Iversen, L.L. and Snyder, S.H. (1976) Huntingtons chorea: changes in neurotransmitter receptors in the brain. N. Engl. J. Med., 294, 13051309.[Abstract]
44 Warsh, J.J., Politsky, J.M., Li, P.P., Kish, S.J. and Hornykiewicz, O. (1991) Reduced striatal [3H]inositol 1, 4, 5-trisphosphate binding in Huntingtons disease. J. Neurochem., 56, 14171422.[Web of Science][Medline]
45 Sen, A.P., Boksa, P. and Quirion, R. (1993) Brain calcium channel related dihydropyridine and phenylalkylamine binding sites in Alzheimers, Parkinsons and Huntingtons diseases. Brain Res., 611, 216221.[Web of Science][Medline]
46 Glass, M., Faull, R.L.M. and Dragunow, M. (1993) Loss of cannabinoid receptors in the substantia nigra in Huntingtons disease. Neuroscience, 56, 523527.[Web of Science][Medline]
47 Robertson, H.A., MacDonald, C.J. and Denovan-Wright, E.M. (1999) Cannabinoid receptor (CB1) mRNA loss in the lateral striatum of Huntingtons disease transgenic mice. Soc. Neurosci. Abstr., 25 (Part 1), 829.
48 Tallman, M.S. (1998) Therapy of acute promyelocytic leukemia: all-trans retinoic acid and beyond. Leukemia, 12 (suppl. 1), S37S40.
49 Carter, R.J., Lione, L.A., Humby, T., Mangiarini, L., Mahal, A., Bates, G.P., Dunnett, S.B. and Morton, A.J. (1999) Characterization of progressive motor deficits in mice transgenic for the human Huntingtons disease mutation. J. Neurosci., 19, 32483257.
50 Ross, C.A., Wood, J.D., Schilling, G., Peters, M.F., Nucifora Jr, F.C., Cooper, J.K., Sharp, A.H., Margolis, R.L. and Borchelt, D.R. (1999) Polyglutamine pathogenesis. Phil. Trans. R. Soc. Lond. B Biol. Sci., 354, 10051011.
51 Cooper, J.K., Schilling, G., Peters, M.F., Herring, W.J., Sharp, A.H., Kaminsky, Z., Masone, J., Khan, F.A., Delanoy, M., Borchelt, D.R. et al. (1998) Truncated N-terminal fragments of huntingtin with expanded glutamine repeats form nuclear and cytoplasmic aggregates in cell culture. Hum. Mol. Genet., 7, 783790.
52 DiFiglia, M., Sapp, E., Chase, K.O., Davies, S.W., Bates, G.P., Vonsattel, J.-P. and Aronin, N. (1997) Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neurites in brain. Science, 277, 19901993.
53 Sittler, A., Walter, S., Wedemeyer, N., Hasenbank, R., Scherzinger, E., Eickhoff, H., Bates, G.P., Lehrach, H. and Wanker, E.E. (1998) SH3GL3 associates with the Huntingtin exon 1 protein and promotes the formation of polygln-containing protein aggregates. Mol. Cell, 2, 427436.[Web of Science][Medline]
54 Faber, P.W., Barnes, G.T., Srinidhi, J., Chen, J., Gusella, J.F. and MacDonald, M.E. (1998) Huntingtin interacts with a family of WW domain proteins. Hum. Mol. Genet., 7, 14631474.
55 Landwehrmeyer, G.B., McNeil, S.M., Dure, L.S., Ge, P., Aizawa, H., Huang, Q., Ambrose, C.M., Duyao, M.P., Bird, E.D., Bonilla, E. et al. (1995) Huntingtons disease gene: regional and cellular expression in brain of normal and affected individuals. Ann. Neurol., 37, 218230.[Web of Science][Medline]
56 Augood, S.J., Faull, R.L.M. and Emson, P.C. (1997) Dopamine D1 and D2 receptor gene expression in the striatum in Huntingtons disease. Ann. Neurol., 42, 215221.[Web of Science][Medline]
57 Richfield, E.K., Young, A.B. and Penney, J.B. (1986) Properties of D2 dopamine receptor autoradiography: high percentage of high-affinity agonist sites and increased nucleotide sensitivity in tissue sections. Brain Res., 383, 121128.[Web of Science][Medline]
58 Cox, R.F. and Waszczak, B.L. (1991) Autoradiography of dopamine D2 receptors using [3H]YM-09151-2. Eur. J. Pharmacol., 199, 103106.[Web of Science][Medline]
59 Jarvis, M.F. and Williams, M. (1989) Direct autoradiographic localization of adenosine A2 receptors in the rat brain using the A2-selective agonist, [3H]CGS 21680. Eur. J. Pharmacol., 168, 243246.[Web of Science][Medline]
60 Worley, P.F., Baraban, J.M., De Souza, E.B. and Snyder, S.H. (1986) Mapping second messenger systems in the brain: differential localizations of adenylate cyclase and protein kinase C. Proc. Natl Acad. Sci. USA, 83, 40534057.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. Zabel, L. Mao, B. Woodman, M. Rohe, M. A. Wacker, Y. Klare, A. Koppelstatter, G. Nebrich, O. Klein, S. Grams, et al. A Large Number of Protein Expression Changes Occur Early in Life and Precede Phenotype Onset in a Mouse Model for Huntington Disease Mol. Cell. Proteomics, April 1, 2009; 8(4): 720 - 734. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Phan, M. A. Hickey, P. Zhang, M.-F. Chesselet, and K. Reue Adipose tissue dysfunction tracks disease progression in two Huntington's disease mouse models Hum. Mol. Genet., March 15, 2009; 18(6): 1006 - 1016. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Fang, A. Strand, W. Law, V. M. Faca, M. P. Fitzgibbon, N. Hamel, B. Houle, X. Liu, D. H. May, G. Poschmann, et al. Brain-specific Proteins Decline in the Cerebrospinal Fluid of Humans with Huntington Disease Mol. Cell. Proteomics, March 1, 2009; 8(3): 451 - 466. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Brown, A. I. Bogush, and M. E. Ehrlich Neocortical expression of mutant huntingtin is not required for alterations in striatal gene expression or motor dysfunction in a transgenic mouse Hum. Mol. Genet., October 15, 2008; 17(20): 3095 - 3104. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Benn, T. Sun, G. Sadri-Vakili, K. N. McFarland, D. P. DiRocco, G. J. Yohrling, T. W. Clark, B. Bouzou, and J.-H. J. Cha Huntingtin Modulates Transcription, Occupies Gene Promoters In Vivo, and Binds Directly to DNA in a Polyglutamine-Dependent Manner J. Neurosci., October 15, 2008; 28(42): 10720 - 10733. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Thomas, G. Coppola, P. A. Desplats, B. Tang, E. Soragni, R. Burnett, F. Gao, K. M. Fitzgerald, J. F. Borok, D. Herman, et al. The HDAC inhibitor 4b ameliorates the disease phenotype and transcriptional abnormalities in Huntington's disease transgenic mice PNAS, October 7, 2008; 105(40): 15564 - 15569. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pratt and M. Rechsteiner Proteasomes Cleave at Multiple Sites within Polyglutamine Tracts: ACTIVATION BY PA28{gamma}(K188E) J. Biol. Chem., May 9, 2008; 283(19): 12919 - 12925. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-O. Kim, P. Chawla, R. P. Overland, E. Xia, G. Sadri-Vakili, and J.-H. J. Cha Altered Histone Monoubiquitylation Mediated by Mutant Huntingtin Induces Transcriptional Dysregulation J. Neurosci., April 9, 2008; 28(15): 3947 - 3957. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Roze, S. Betuing, C. Deyts, E. Marcon, K. Brami-Cherrier, C. Pages, S. Humbert, K. Merienne, and J. Caboche Mitogen- and stress-activated protein kinase-1 deficiency is involved in expanded-huntingtin-induced transcriptional dysregulation and striatal death FASEB J, April 1, 2008; 22(4): 1083 - 1093. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Brochier, M.-C. Gaillard, E. Diguet, N. Caudy, C. Dossat, B. Segurens, P. Wincker, E. Roze, J. Caboche, P. Hantraye, et al. Quantitative gene expression profiling of mouse brain regions reveals differential transcripts conserved in human and affected in disease models Physiol Genomics, April 1, 2008; 33(2): 170 - 179. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Giorgini, T. Moller, W. Kwan, D. Zwilling, J. L. Wacker, S. Hong, L.-C. L. Tsai, C. S. Cheah, R. Schwarcz, P. Guidetti, et al. Histone Deacetylase Inhibition Modulates Kynurenine Pathway Activation in Yeast, Microglia, and Mice Expressing a Mutant Huntingtin Fragment J. Biol. Chem., March 21, 2008; 283(12): 7390 - 7400. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lim, L. Fedrizzi, M. Tartari, C. Zuccato, E. Cattaneo, M. Brini, and E. Carafoli Calcium Homeostasis and Mitochondrial Dysfunction in Striatal Neurons of Huntington Disease J. Biol. Chem., February 29, 2008; 283(9): 5780 - 5789. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. B. Fernandes, K. G. Baimbridge, J. Church, M. R. Hayden, and L. A. Raymond Mitochondrial Sensitivity and Altered Calcium Handling Underlie Enhanced NMDA-Induced Apoptosis in YAC128 Model of Huntington's Disease J. Neurosci., December 12, 2007; 27(50): 13614 - 13623. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Strand, Z. C. Baquet, A. K. Aragaki, P. Holmans, L. Yang, C. Cleren, M. F. Beal, L. Jones, C. Kooperberg, J. M. Olson, et al. Expression Profiling of Huntington's Disease Models Suggests That Brain-Derived Neurotrophic Factor Depletion Plays a Major Role in Striatal Degeneration J. Neurosci., October 24, 2007; 27(43): 11758 - 11768. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kuhn, D. R. Goldstein, A. Hodges, A. D. Strand, T. Sengstag, C. Kooperberg, K. Becanovic, M. A. Pouladi, K. Sathasivam, J.-H. J. Cha, et al. Mutant huntingtin's effects on striatal gene expression in mice recapitulate changes observed in human Huntington's disease brain and do not differ with mutant huntingtin length or wild-type huntingtin dosage Hum. Mol. Genet., August 1, 2007; 16(15): 1845 - 1861. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sadri-Vakili, B. Bouzou, C. L. Benn, M.-O. Kim, P. Chawla, R. P. Overland, K. E. Glajch, E. Xia, Z. Qiu, S. M. Hersch, et al. Histones associated with downregulated genes are hypo-acetylated in Huntington's disease models Hum. Mol. Genet., June 1, 2007; 16(11): 1293 - 1306. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Ren, I. O. Rosas, S. D. MacDonald, H.-P. Wu, E. M. Billings, and B. R. Gochuico Impairment of Alveolar Macrophage Transcription in Idiopathic Pulmonary Fibrosis Am. J. Respir. Crit. Care Med., June 1, 2007; 175(11): 1151 - 1157. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Stack, S. J. Del Signore, R. Luthi-Carter, B. Y. Soh, D. R. Goldstein, S. Matson, S. Goodrich, A. L. Markey, K. Cormier, S. W. Hagerty, et al. Modulation of nucleosome dynamics in Huntington's disease Hum. Mol. Genet., May 15, 2007; 16(10): 1164 - 1175. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zourlidou, T. Gidalevitz, M. Kristiansen, C. Landles, B. Woodman, D. J. Wells, D. S. Latchman, J. de Belleroche, S. J. Tabrizi, R. I. Morimoto, et al. Hsp27 overexpression in the R6/2 mouse model of Huntington's disease: chronic neurodegeneration does not induce Hsp27 activation Hum. Mol. Genet., May 1, 2007; 16(9): 1078 - 1090. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Chiang, C.-G. Juo, H.-H. Chang, H.-M. Chen, E. C. Yi, and Y. Chern Systematic Uncovering of Multiple Pathways Underlying the Pathology of Huntington Disease by an Acid-cleavable Isotope-coded Affinity Tag Approach Mol. Cell. Proteomics, May 1, 2007; 6(5): 781 - 797. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bogush, S. Pedrini, J. Pelta-Heller, T. Chan, Q. Yang, Z. Mao, E. Sluzas, T. Gieringer, and M. E. Ehrlich AKT and CDK5/p35 Mediate Brain-derived Neurotrophic Factor Induction of DARPP-32 in Medium Size Spiny Neurons in Vitro J. Biol. Chem., March 9, 2007; 282(10): 7352 - 7359. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Chiang, H.-M. Chen, Y.-H. Lee, H.-H. Chang, Y.-C. Wu, B.-W. Soong, C.-M. Chen, Y.-R. Wu, C.-S. Liu, D.-M. Niu, et al. Dysregulation of C/EBP{alpha} by mutant Huntingtin causes the urea cycle deficiency in Huntington's disease Hum. Mol. Genet., March 1, 2007; 16(5): 483 - 498. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N.T. Strehlow, J. Z. Li, and R. M. Myers Wild-type huntingtin participates in protein trafficking between the Golgi and the extracellular space Hum. Mol. Genet., February 15, 2007; 16(4): 391 - 409. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cyr, T. D. Sotnikova, R. R. Gainetdinov, and M. G. Caron Dopamine enhances motor and neuropathological consequences of polyglutamine expanded huntingtin FASEB J, December 1, 2006; 20(14): 2541 - 2543. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cornett, L. Smith, M. Friedman, J.-Y. Shin, X.-J. Li, and S.-H. Li Context-dependent Dysregulation of Transcription by Mutant Huntingtin J. Biol. Chem., November 24, 2006; 281(47): 36198 - 36204. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Cummings, A. J. Milnerwood, G. M. Dallerac, V. Waights, J. Y. Brown, S. C. Vatsavayai, M. C. Hirst, and K. P.S.J. Murphy Aberrant cortical synaptic plasticity and dopaminergic dysfunction in a mouse model of huntington's disease Hum. Mol. Genet., October 1, 2006; 15(19): 2856 - 2868. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Milnerwood, D. M. Cummings, G. M. Dallerac, J. Y. Brown, S. C. Vatsavayai, M. C. Hirst, P. Rezaie, and K. P.S.J. Murphy Early development of aberrant synaptic plasticity in a mouse model of Huntington's disease Hum. Mol. Genet., May 15, 2006; 15(10): 1690 - 1703. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hodges, A. D. Strand, A. K. Aragaki, A. Kuhn, T. Sengstag, G. Hughes, L. A. Elliston, C. Hartog, D. R. Goldstein, D. Thu, et al. Regional and cellular gene expression changes in human Huntington's disease brain Hum. Mol. Genet., March 15, 2006; 15(6): 965 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Abou-Sleymane, F. Chalmel, D. Helmlinger, A. Lardenois, C. Thibault, C. Weber, K. Merienne, J.-L. Mandel, O. Poch, D. Devys, et al. Polyglutamine expansion causes neurodegeneration by altering the neuronal differentiation program Hum. Mol. Genet., March 1, 2006; 15(5): 691 - 703. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Apostol, K. Illes, J. Pallos, L. Bodai, J. Wu, A. Strand, E. S. Schweitzer, J. M. Olson, A. Kazantsev, J. L. Marsh, et al. Mutant huntingtin alters MAPK signaling pathways in PC12 and striatal cells: ERK1/2 protects against mutant huntingtin-associated toxicity Hum. Mol. Genet., January 15, 2006; 15(2): 273 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Perluigi, H. F. Poon, W. Maragos, W. M. Pierce, J. B. Klein, V. Calabrese, C. Cini, C. De Marco, and D. A. Butterfield Proteomic Analysis of Protein Expression and Oxidative Modification in R6/2 Transgenic Mice: A Model of Huntington Disease Mol. Cell. Proteomics, December 1, 2005; 4(12): 1849 - 1861. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Glynn, C. J. Drew, K. Reim, N. Brose, and A. J. Morton Profound ataxia in complexin I knockout mice masks a complex phenotype that includes exploratory and habituation deficits Hum. Mol. Genet., August 15, 2005; 14(16): 2369 - 2385. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Borovecki, L. Lovrecic, J. Zhou, H. Jeong, F. Then, H. D. Rosas, S. M. Hersch, P. Hogarth, B. Bouzou, R. V. Jensen, et al. Genome-wide expression profiling of human blood reveals biomarkers for Huntington's disease PNAS, August 2, 2005; 102(31): 11023 - 11028. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Iijima-Ando, P. Wu, E. A. Drier, K. Iijima, and J. C. P. Yin cAMP-response element-binding protein and heat-shock protein 70 additively suppress polyglutamine-mediated toxicity in Drosophila PNAS, July 19, 2005; 102(29): 10261 - 10266. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Lievens, T. Rival, M. Iche, H. Chneiweiss, and S. Birman Expanded polyglutamine peptides disrupt EGF receptor signaling and glutamate transporter expression in Drosophila Hum. Mol. Genet., March 1, 2005; 14(5): 713 - 724. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zucker, R. Luthi-Carter, J. A. Kama, A. W. Dunah, E. A. Stern, J. H. Fox, D. G. Standaert, A. B. Young, and S. J. Augood Transcriptional dysregulation in striatal projection- and interneurons in a mouse model of Huntington's disease: neuronal selectivity and potential neuroprotective role of HAP1 Hum. Mol. Genet., January 15, 2005; 14(2): 179 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gardian, S. E. Browne, D.-K. Choi, P. Klivenyi, J. Gregorio, J. K. Kubilus, H. Ryu, B. Langley, R. R. Ratan, R. J. Ferrante, et al. Neuroprotective Effects of Phenylbutyrate in the N171-82Q Transgenic Mouse Model of Huntington's Disease J. Biol. Chem., January 7, 2005; 280(1): 556 - 563. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Morton, N. I. Wood, M. H. Hastings, C. Hurelbrink, R. A. Barker, and E. S. Maywood Disintegration of the Sleep-Wake Cycle and Circadian Timing in Huntington's Disease J. Neurosci., January 5, 2005; 25(1): 157 - 163. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Everett and N. W. Wood Trinucleotide repeats and neurodegenerative disease Brain, November 1, 2004; 127(11): 2385 - 2405. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mey and P. Mccaffery Retinoic Acid Signaling in the Nervous System of Adult Vertebrates Neuroscientist, October 1, 2004; 10(5): 409 - 421. [Abstract] [PDF] |
||||
![]() |
G. Schilling, A. V. Savonenko, A. Klevytska, J. L. Morton, S. M. Tucker, M. Poirier, A. Gale, N. Chan, V. Gonzales, H. H. Slunt, et al. Nuclear-targeting of mutant huntingtin fragments produces Huntington's disease-like phenotypes in transgenic mice Hum. Mol. Genet., August 1, 2004; 13(15): 1599 - 1610. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Hay, K. Sathasivam, S. Tobaben, B. Stahl, M. Marber, R. Mestril, A. Mahal, D. L. Smith, B. Woodman, and G. P. Bates Progressive decrease in chaperone protein levels in a mouse model of Huntington's disease and induction of stress proteins as a therapeutic approach Hum. Mol. Genet., July 1, 2004; 13(13): 1389 - 1405. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Oyama, S. Kotliarova, A. Harada, M. Ito, H. Miyazaki, Y. Ueyama, N. Hirokawa, N. Nukina, and Y. Ihara Gem GTPase and Tau: MORPHOLOGICAL CHANGES INDUCED BY GEM GTPase IN CHO CELLS ARE ANTAGONIZED BY TAU J. Biol. Chem., June 25, 2004; 279(26): 27272 - 27277. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Minamiyama, M. Katsuno, H. Adachi, M. Waza, C. Sang, Y. Kobayashi, F. Tanaka, M. Doyu, A. Inukai, and G. Sobue Sodium butyrate ameliorates phenotypic expression in a transgenic mouse model of spinal and bulbar muscular atrophy Hum. Mol. Genet., June 1, 2004; 13(11): 1183 - 1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Ruan, M. Lesort, M. E. MacDonald, and G. V.W. Johnson Striatal cells from mutant huntingtin knock-in mice are selectively vulnerable to mitochondrial complex II inhibitor-induced cell death through a non-apoptotic pathway Hum. Mol. Genet., April 1, 2004; 13(7): 669 - 681. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Spires, H. E. Grote, N. K. Varshney, P. M. Cordery, A. van Dellen, C. Blakemore, and A. J. Hannan Environmental Enrichment Rescues Protein Deficits in a Mouse Model of Huntington's Disease, Indicating a Possible Disease Mechanism J. Neurosci., March 3, 2004; 24(9): 2270 - 2276. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Jarabek, R. P. Yasuda, and B. B. Wolfe Regulation of proteins affecting NMDA receptor-induced excitotoxicity in a Huntington's mouse model Brain, March 1, 2004; 127(3): 505 - 516. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Ferrante, J. K. Kubilus, J. Lee, H. Ryu, A. Beesen, B. Zucker, K. Smith, N. W. Kowall, R. R. Ratan, R. Luthi-Carter, et al. Histone Deacetylase Inhibition by Sodium Butyrate Chemotherapy Ameliorates the Neurodegenerative Phenotype in Huntington's Disease Mice J. Neurosci., October 15, 2003; 23(28): 9418 - 9427. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Michalik and C. Van Broeckhoven Pathogenesis of polyglutamine disorders: aggregation revisited Hum. Mol. Genet., October 15, 2003; 12(90002): R173 - 186. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, T. Wyman, Z.-X. Yu, S.-H. Li, and X.-J. Li Abnormal association of mutant huntingtin with synaptic vesicles inhibits glutamate release Hum. Mol. Genet., August 15, 2003; 12(16): 2021 - 2030. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Curtis, E. B. Penney, A. G. Pearson, W. M. C. van Roon-Mom, N. J. Butterworth, M. Dragunow, B. Connor, and R. L. M. Faull Increased cell proliferation and neurogenesis in the adult human Huntington's disease brain PNAS, July 22, 2003; 100(15): 9023 - 9027. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. de Chaldee, M.-C. Gaillard, N. Bizat, J.-M. Buhler, O. Manzoni, J. Bockaert, P. Hantraye, E. Brouillet, and J.-M. Elalouf Quantitative Assessment of Transcriptome Differences Between Brain Territories Genome Res., July 1, 2003; 13(7): 1646 - 1653. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lin, M. T. Vahey, D. Thach, D. A. Stenger, and J. J. Pancrazio Biological Threat Detection via Host Gene Expression Profiling Clin. Chem., July 1, 2003; 49(7): 1045 - 1049. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Taylor, A. A. Taye, C. Campbell, P. Kazemi-Esfarjani, K. H. Fischbeck, and K.-T. Min Aberrant histone acetylation, altered transcription, and retinal degeneration in a Drosophila model of polyglutamine disease are rescued by CREB-binding protein Genes & Dev., June 15, 2003; 17(12): 1463 - 1468. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Merienne, D. Helmlinger, G. R. Perkin, D. Devys, and Y. Trottier Polyglutamine Expansion Induces a Protein-damaging Stress Connecting Heat Shock Protein 70 to the JNK Pathway J. Biol. Chem., May 2, 2003; 278(19): 16957 - 16967. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-M. Sturla, A. Fernandez-Teijeiro, and S. L. Pomeroy Application of Microarrays to Neurological Disease Arch Neurol, May 1, 2003; 60(5): 676 - 682. [Full Text] [PDF] |
||||
![]() |
F. C. Nucifora Jr., L. M. Ellerby, C. L. Wellington, J. D. Wood, W. J. Herring, A. Sawa, M. R. Hayden, V. L. Dawson, T. M. Dawson, and C. A. Ross Nuclear Localization of a Non-caspase Truncation Product of Atrophin-1, with an Expanded Polyglutamine Repeat, Increases Cellular Toxicity J. Biol. Chem., April 4, 2003; 278(15): 13047 - 13055. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gines, I. S. Seong, E. Fossale, E. Ivanova, F. Trettel, J. F. Gusella, V. C. Wheeler, F. Persichetti, and M. E. MacDonald Specific progressive cAMP reduction implicates energy deficit in presymptomatic Huntington's disease knock-in mice Hum. Mol. Genet., March 1, 2003; 12(5): 497 - 508. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hockly, V. M. Richon, B. Woodman, D. L. Smith, X. Zhou, E. Rosa, K. Sathasivam, S. Ghazi-Noori, A. Mahal, P. A. S. Lowden, et al. Suberoylanilide hydroxamic acid, a histone deacetylase inhibitor, ameliorates motor deficits in a mouse model of Huntington's disease PNAS, February 18, 2003; 100(4): 2041 - 2046. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Cattaneo Dysfunction of Wild-Type Huntingtin in Huntington disease Physiology, February 1, 2003; 18(1): 34 - 37. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Li, T. Macfarlan, R. N. Pittman, and D. Chakravarti Ataxin-3 Is a Histone-binding Protein with Two Independent Transcriptional Corepressor Activities J. Biol. Chem., November 15, 2002; 277(47): 45004 - 45012. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-L. Wu, T. M. O'Kane, R. W. Scott, M. J. Savage, and D. Bozyczko-Coyne Protein Tyrosine Phosphatases Are Up-regulated and Participate in Cell Death Induced by Polyglutamine Expansion J. Biol. Chem., November 8, 2002; 277(46): 44208 - 44213. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Strand, J. M. Olson, and C. Kooperberg Estimating the statistical significance of gene expression changes observed with oligonucleotide arrays Hum. Mol. Genet., September 15, 2002; 11(19): 2207 - 2221. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kooperberg, S. Sipione, M. LeBlanc, A. D. Strand, E. Cattaneo, and J. M. Olson Evaluating test statistics to select interesting genes in microarray experiments Hum. Mol. Genet., September 15, 2002; 11(19): 2223 - 2232. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Fossale, V. C. Wheeler, V. Vrbanac, L.-A. Lebel, A. Teed, J. S. Mysore, J. F. Gusella, M. E. MacDonald, and F. Persichetti Identification of a presymptomatic molecular phenotype in Hdh CAG knock-in mice Hum. Mol. Genet., September 15, 2002; 11(19): 2233 - 2241. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Wellington, L. M. Ellerby, C.-A. Gutekunst, D. Rogers, S. Warby, R. K. Graham, O. Loubser, J. van Raamsdonk, R. Singaraja, Y.-Z. Yang, et al. Caspase Cleavage of Mutant Huntingtin Precedes Neurodegeneration in Huntington's Disease J. Neurosci., September 15, 2002; 22(18): 7862 - 7872. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Luthi-Carter, S. A. Hanson, A. D. Strand, D. A. Bergstrom, W. Chun, N. L. Peters, A. M. Woods, E. Y. Chan, C. Kooperberg, D. Krainc, et al. Dysregulation of gene expression in the R6/2 model of polyglutamine disease: parallel changes in muscle and brain Hum. Mol. Genet., August 15, 2002; 11(17): 1911 - 1926. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Luthi-Carter, A. D. Strand, S. A. Hanson, C. Kooperberg, G. Schilling, A. R. La Spada, D. E. Merry, A. B. Young, C. A. Ross, D. R. Borchelt, et al. Polyglutamine and transcription: gene expression changes shared by DRPLA and Huntington's disease mouse models reveal context-independent effects Hum. Mol. Genet., August 15, 2002; 11(17): 1927 - 1937. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Y.W. Chan, R. Luthi-Carter, A. Strand, S. M. Solano, S. A. Hanson, M. M. DeJohn, C. Kooperberg, K. O. Chase, M. DiFiglia, A. B. Young, et al. Increased huntingtin protein length reduces the number of polyglutamine-induced gene expression changes in mouse models of Huntington's disease Hum. Mol. Genet., August 15, 2002; 11(17): 1939 - 1951. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sipione, D. Rigamonti, M. Valenza, C. Zuccato, L. Conti, J. Pritchard, C. Kooperberg, J. M. Olson, and E. Cattaneo Early transcriptional profiles in huntingtin-inducible striatal cells by microarray analyses Hum. Mol. Genet., August 15, 2002; 11(17): 1953 - 1965. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Lieberman, G. Harmison, A. D. Strand, J. M. Olson, and K. H. Fischbeck Altered transcriptional regulation in cells expressing the expanded polyglutamine androgen receptor Hum. Mol. Genet., August 15, 2002; 11(17): 1967 - 1976. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. L. Xu, J. M. Olson, and L. P. Zhao A regression-based method to identify differentially expressed genes in microarray time course studies and its application in an inducible Huntington's disease transgenic model Hum. Mol. Genet., August 15, 2002; 11(17): 1977 - 1985. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kirby, F. M. Menzies, M. R. Cookson, K. Bushby, and P. J. Shaw Differential gene expression in a cell culture model of SOD1-related familial motor neurone disease Hum. Mol. Genet., August 15, 2002; 11(17): 2061 - 2075. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Keene, C. M. P. Rodrigues, T. Eich, M. S. Chhabra, C. J. Steer, and W. C. Low Tauroursodeoxycholic acid, a bile acid, is neuroprotective in a transgenic animal model of Huntington's disease PNAS, August 6, 2002; 99(16): 10671 - 10676. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. F. Behrens, P. Franz, B. Woodman, K. S. Lindenberg, and G. B. Landwehrmeyer Impaired glutamate transport and glutamate-glutamine cycling: downstream effects of the Huntington mutation Brain, August 1, 2002; 125(8): 1908 - 1922. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chai, J. Shao, V. M. Miller, A. Williams, and H. L. Paulson Live-cell imaging reveals divergent intracellular dynamics of polyglutamine disease proteins and supports a sequestration model of pathogenesis PNAS, July 9, 2002; 99(14): 9310 - 9315. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gafni and L. M. Ellerby Calpain Activation in Huntington's Disease J. Neurosci., June 15, 2002; 22(12): 4842 - 4849. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. P. de Almeida, C. A. Ross, D. Zala, P. Aebischer, and N. Deglon Lentiviral-Mediated Delivery of Mutant Huntingtin in the Striatum of Rats Induces a Selective Neuropathology Modulated by Polyglutamine Repeat Size, Huntingtin Expression Levels, and Protein Length J. Neurosci., May 1, 2002; 22(9): 3473 - 3483. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zabel, D. C. Chamrad, J. Priller, B. Woodman, H. E. Meyer, G. P. Bates, and J. Klose Alterations in the Mouse and Human Proteome Caused by Huntington's Disease Mol. Cell. Proteomics, May 1, 2002; 1(5): 366 - 375. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-X. Yu, S.-H. Li, H.-P. Nguyen, and X.-J. Li Huntingtin inclusions do not deplete polyglutamine-containing transcription factors in HD mice Hum. Mol. Genet., April 15, 2002; 11(8): 905 - 914. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Li, A. L. Cheng, H. Zhou, S. Lam, M. Rao, H. Li, and X.-J. Li Interaction of Huntington Disease Protein with Transcriptional Activator Sp1 Mol. Cell. Biol., March 1, 2002; 22(5): 1277 - 1287. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Ferrante, O. A. Andreassen, A. Dedeoglu, K. L. Ferrante, B. G. Jenkins, S. M. Hersch, and M. F. Beal Therapeutic Effects of Coenzyme Q10 and Remacemide in Transgenic Mouse Models of Huntington's Disease J. Neurosci., March 1, 2002; 22(5): 1592 - 1599. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Kegel, A. R. Meloni, Y. Yi, Y. J. Kim, E. Doyle, B. G. Cuiffo, E. Sapp, Y. Wang, Z.-H. Qin, J. D. Chen, et al. Huntingtin Is Present in the Nucleus, Interacts with the Transcriptional Corepressor C-terminal Binding Protein, and Represses Transcription J. Biol. Chem., February 22, 2002; 277(9): 7466 - 7476. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Kelz, G. W. Dent, S. Therianos, P. G. Marciano, T. K. McIntosh, P. D. Coleman, and J. H. Eberwine Single-Cell Antisense RNA Amplification and Microarray Analysis as a Tool for Studying Neurological Degeneration and Restoration Sci. Aging Knowl. Environ., January 9, 2002; 2002(1): re1 - 1. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Klapstein, R. S. Fisher, H. Zanjani, C. Cepeda, E. S. Jokel, M.-F. Chesselet, and M. S. Levine Electrophysiological and Morphological Changes in Striatal Spiny Neurons in R6/2 Huntington's Disease Transgenic Mice J Neurophysiol, December 1, 2001; 86(6): 2667 - 2677. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, S.-H. Li, Z.-X. Yu, P. Shelbourne, and X.-J. Li Huntingtin Aggregate-Associated Axonal Degeneration is an Early Pathological Event in Huntington's Disease Mice J. Neurosci., November 1, 2001; 21(21): 8473 - 8481. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N. Rosenberg Genomic Neurology: A New Beginning Arch Neurol, November 1, 2001; 58(11): 1739 - 1741. [Full Text] [PDF] |
||||
![]() |
R. E. Hughes, R. S. Lo, C. Davis, A. D. Strand, C. L. Neal, J. M. Olson, and S. Fields Altered transcription in yeast expressing expanded polyglutamine PNAS, October 25, 2001; (2001) 191498198. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sathasivam, B. Woodman, A. Mahal, F. Bertaux, E. E. Wanker, D. T. Shima, and G. P. Bates Centrosome disorganization in fibroblast cultures derived from R6/2 Huntington's disease (HD) transgenic mice and HD patients Hum. Mol. Genet., October 1, 2001; 10(21): 2425 - 2435. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Yvert, K. S. Lindenberg, D. Devys, D. Helmlinger, G. B. Landwehrmeyer, and J.-L. Mandel SCA7 mouse models show selective stabilization of mutant ataxin-7 and similar cellular responses in different neuronal cell types Hum. Mol. Genet., August 1, 2001; 10(16): 1679 - 1692. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wyttenbach, J. Swartz, H. Kita, T. Thykjaer, J. Carmichael, J. Bradley, R. Brown, M. Maxwell, A. Schapira, T. F. Orntoft, et al. Polyglutamine expansions cause decreased CRE-mediated transcription and early gene expression changes prior to cell death in an inducible cell model of Huntington's disease Hum. Mol. Genet., August 1, 2001; 10(17): 1829 - 1845. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. O. Evert, I. R. Vogt, C. Kindermann, L. Ozimek, R. A. I. de Vos, E. R. P. Brunt, I. Schmitt, T. Klockgether, and U. Wullner Inflammatory Genes Are Upregulated in Expanded Ataxin-3-Expressing Cell Lines and Spinocerebellar Ataxia Type 3 Brains J. Neurosci., August 1, 2001; 21(15): 5389 - 5396. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Petersen, K. E. Larsen, G. G. Behr, N. Romero, S. Przedborski, P. Brundin, and D. Sulzer Expanded CAG repeats in exon 1 of the Huntington's disease gene stimulate dopamine-mediated striatal neuron autophagy and degeneration Hum. Mol. Genet., June 1, 2001; 10(12): 1243 - 1254. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Waelter, A. Boeddrich, R. Lurz, E. Scherzinger, G. Lueder, H. Lehrach, and E. E. Wanker Accumulation of Mutant Huntingtin Fragments in Aggresome-like Inclusion Bodies as a Result of Insufficient Protein Degradation Mol. Biol. Cell, May 1, 2001; 12(5): 1393 - 1407. [Abstract] [Full Text] |
||||
![]() |
F. C. Nucifora Jr., M. Sasaki, M. F. Peters, H. Huang, J. K. Cooper, M. Yamada, H. Takahashi, S. Tsuji, J. Troncoso, V. L. Dawson, et al. Interference by Huntingtin and Atrophin-1 with CBP-Mediated Transcription Leading to Cellular Toxicity Science, March 23, 2001; 291(5512): 2423 - 2428. [Abstract] [Full Text] |
||||
![]() |
S.-H. Li, S. Lam, A. L. Cheng, and X.-J. Li Intranuclear huntingtin increases the expression of caspase-1 and induces apoptosis Hum. Mol. Genet., November 1, 2000; 9(19): 2859 - 2867. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Wood, F. C. Nucifora , Jr., K. Duan, C. Zhang, J. Wang, Y. Kim, G. Schilling, N. Sacchi, J. M. Liu, and C. A. Ross Atrophin-1, the Dentato-rubral and Pallido-luysian Atrophy Gene Product, Interacts with ETO/MTG8 in the Nuclear Matrix and Represses Transcription J. Cell Biol., September 5, 2000; 150(5): 939 - 948. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zuccato, A. Ciammola, D. Rigamonti, B. R. Leavitt, D. Goffredo, L. Conti, M. E. MacDonald, R. M. Friedlander, V. Silani, M. R. Hayden, et al. Loss of Huntingtin-Mediated BDNF Gene Transcription in Huntington's Disease Science, July 20, 2001; 293(5529): 493 - 498. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chai, L. Wu, J. D. Griffin, and H. L. Paulson The Role of Protein Composition in Specifying Nuclear Inclusion Formation in Polyglutamine Disease J. Biol. Chem., November 21, 2001; 276(48): 44889 - 44897. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Hughes, R. S. Lo, C. Davis, A. D. Strand, C. L. Neal, J. M. Olson, and S. Fields Altered transcription in yeast expressing expanded polyglutamine PNAS, November 6, 2001; 98(23): 13201 - 13206. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

























