Human Molecular Genetics, 2000, Vol. 9, No. 2 187-194
© 2000 Oxford University Press
Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase
The Murdoch Institute, Royal Children’s Hospital, Flemington Road, Parkville 3052, Australia and 1Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA
A double-stranded 9 bp GTGAAAAAG pJ
sequence found in human centromeric -satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible ‘spreading’ of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on -satellite-negative human neo- centromeres and on the active but not the inactive -satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G2 phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.
+ These authors contributed equally to this work
§ To whom correspondence should be addressed. Tel: +61 3 8341 6306; Fax: +61 3 9348 1391; Email: choo@cryptic.rch.unimelb.edu.au
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Okada, T. Inoue, T. Kikuta, N. Kato, Y. Kanno, N. Hirosawa, Y. Sakamoto, T. Sugaya, and H. Suzuki Poly(ADP-Ribose) Polymerase-1 Enhances Transcription of the Profibrotic CCN2 Gene J. Am. Soc. Nephrol., May 1, 2008; 19(5): 933 - 942. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Beneke and A. Burkle Poly(ADP-ribosyl)ation in mammalian ageing Nucleic Acids Res., December 3, 2007; 35(22): 7456 - 7465. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. H. Wong, K. H. Brettingham-Moore, L. Chan, J. M. Quach, M. A. Anderson, E. L. Northrop, R. Hannan, R. Saffery, M. L. Shaw, E. Williams, et al. Centromere RNA is a key component for the assembly of nucleoproteins at the nucleolus and centromere Genome Res., August 1, 2007; 17(8): 1146 - 1160. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Y. Kim, T. Zhang, and W. L. Kraus Poly(ADP-ribosyl)ation by PARP-1: `PAR-laying' NAD+ into a nuclear signal Genes & Dev., September 1, 2005; 19(17): 1951 - 1967. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. C. Yung, S. Sato, and M. S. Satoh Poly(ADP-ribosyl)ation as a DNA Damage-induced Post-translational Modification Regulating Poly(ADP-ribose) Polymerase-1-Topoisomerase I Interaction J. Biol. Chem., September 17, 2004; 279(38): 39686 - 39696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Ohsaki, K. Ueda, S. Sakakibara, E. Do, K. Yada, and K. Yamanishi Poly(ADP-Ribose) Polymerase 1 Binds to Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Terminal Repeat Sequence and Modulates KSHV Replication in Latency J. Virol., September 15, 2004; 78(18): 9936 - 9946. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Sumer, J. M. Craig, M. Sibson, and K.H. A. Choo A Rapid Method of Genomic Array Analysis of Scaffold/Matrix Attachment Regions (S/MARs) Identifies a 2.5-Mb Region of Enhanced Scaffold/Matrix Attachment at a Human Neocentromere Genome Res., July 1, 2003; 13(7): 1737 - 1743. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Trofimova, A. Dimtchev, M. Jung, D. Rosenthal, M. Smulson, A. Dritschilo, and V. Soldatenkov Gene Therapy for Prostate Cancer by Targeting Poly(ADP-Ribose) Polymerase Cancer Res., December 1, 2002; 62(23): 6879 - 6883. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Saxena, L. H. Wong, P. Kalitsis, E. Earle, L. G. Shaffer, and K.H. A. Choo Poly(ADP-ribose) polymerase 2 localizes to mammalian active centromeres and interacts with PARP-1, Cenpa, Cenpb and Bub3, but not Cenpc Hum. Mol. Genet., September 15, 2002; 11(19): 2319 - 2329. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Saxena, R. Saffery, L. H. Wong, P. Kalitsis, and K. H. A. Choo Centromere Proteins Cenpa, Cenpb, and Bub3 Interact with Poly(ADP-ribose) Polymerase-1 Protein and Are Poly(ADP-ribosyl)ated J. Biol. Chem., July 19, 2002; 277(30): 26921 - 26926. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Liu, G. Wang, and A. G. Yakovlev Identification and Functional Analysis of the Rat Caspase-3 Gene Promoter J. Biol. Chem., March 1, 2002; 277(10): 8273 - 8278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Politi, G. Perini, S. Trazzi, A. Pliss, I. Raska, W. C. Earnshaw, and G. D. Valle CENP-C binds the alpha-satellite DNA in vivo at specific centromere domains J. Cell Sci., January 6, 2002; 115(11): 2317 - 2327. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Barry, M. Bateman, E. V. Howman, M. R. Cancilla, K. M. Tainton, D. V. Irvine, R. Saffery, and K.H. A. Choo The 10q25 Neocentromere and its Inactive Progenitor Have Identical Primary Nucleotide Sequence: Further Evidence for Epigenetic Modification Genome Res., June 1, 2000; 10(6): 832 - 838. [Abstract] [Full Text]
|
|